ID: 962224674

View in Genome Browser
Species Human (GRCh38)
Location 3:133596069-133596091
Sequence TGGAGCCAAAACACCTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962224674_962224678 -3 Left 962224674 3:133596069-133596091 CCAACCCAGGTGTTTTGGCTCCA 0: 1
1: 0
2: 2
3: 11
4: 176
Right 962224678 3:133596089-133596111 CCAGCATGTTTTTAACCATGAGG 0: 1
1: 0
2: 0
3: 19
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962224674 Original CRISPR TGGAGCCAAAACACCTGGGT TGG (reversed) Intergenic
900824444 1:4914616-4914638 TGGTGCCCAAAGACCTTGGTGGG + Intergenic
902552310 1:17226412-17226434 TGCACCCAAGACACCTGGGTTGG - Intronic
902797674 1:18809963-18809985 TGGAGCCAAGGCCCTTGGGTTGG - Intergenic
902977653 1:20100678-20100700 TGGAGTCAAAACTCTTGGGCTGG - Intergenic
903020235 1:20388443-20388465 TGAAGCCACACCATCTGGGTTGG - Intergenic
903379930 1:22889628-22889650 TGGACCCACAACCCCTGGCTGGG + Intronic
903461682 1:23525056-23525078 TGGAGCCCAAACATGGGGGTGGG - Intronic
908380380 1:63592712-63592734 TGGAGCCAGACCACCTGAATTGG + Intronic
909610947 1:77551411-77551433 TGGAGCCCAAAGATATGGGTAGG - Intronic
910697009 1:90030073-90030095 TGGAGCTGAAACAACTGTGTAGG - Intronic
910832454 1:91474509-91474531 TGAAGCCAGAAAACCTGGGCTGG + Intergenic
915453671 1:156024640-156024662 TGGAAACAAAACACATGGGCCGG + Intergenic
916372405 1:164113886-164113908 TGGAGCCAGACCCCTTGGGTTGG - Intergenic
920380400 1:205531664-205531686 AGGTGCCCAAACACCAGGGTGGG - Exonic
920818913 1:209362128-209362150 TGGAGCCACACAACCTGGATTGG - Intergenic
1067685161 10:48462513-48462535 TGGAGCCAGACTGCCTGGGTTGG - Intronic
1069608757 10:69758105-69758127 TGAAGTGAAAACACATGGGTAGG + Intergenic
1071812984 10:89203902-89203924 TGCAGCCAGATTACCTGGGTGGG - Intergenic
1071982860 10:91021401-91021423 TGCAGACAAATCACCTGGGAAGG - Intergenic
1071991459 10:91104282-91104304 TGGATCCAAATCCCCAGGGTGGG - Intergenic
1073550712 10:104398326-104398348 TGGAATCAAAAGATCTGGGTTGG + Intronic
1076171686 10:128325232-128325254 AGAACCCAAAACACCTGGGCTGG - Intergenic
1078085204 11:8229740-8229762 TGGAGCTTCAAGACCTGGGTTGG - Intronic
1078895886 11:15596836-15596858 TGGAGCCAAAAGAACTGGGATGG - Intergenic
1080623572 11:34008102-34008124 ATGAGCCAACACACCTGGCTGGG + Intergenic
1081774388 11:45667349-45667371 TGTAGCCACAGCACCTGGGATGG + Intergenic
1083187105 11:61024130-61024152 TGCAGGGAAAACACCTGGTTTGG + Intergenic
1083638150 11:64131293-64131315 TGGAGCCCCCACACGTGGGTGGG - Intronic
1084365134 11:68692840-68692862 TGGAGCCAAGAGGGCTGGGTGGG + Intergenic
1087127543 11:94642302-94642324 TGGACCCAAAACTCCGGTGTCGG + Intergenic
1088225857 11:107619116-107619138 TGGAACCAAAACCACTGGGGTGG - Intronic
1089003090 11:115068465-115068487 GGGACCAAAAACAACTGGGTGGG + Intergenic
1089636979 11:119821048-119821070 TGGAGCCAGACCCCCAGGGTTGG + Intergenic
1091039359 11:132262261-132262283 AGGAGCCAAAAGGCCTTGGTAGG - Intronic
1091550537 12:1531886-1531908 TGGAGCCGAAAACCCTGGCTCGG + Intronic
1092627001 12:10337878-10337900 TGGACCCAAAACTCCTGCGCCGG - Intergenic
1092779704 12:11974244-11974266 TGGAGCCAAAACAGCTCAATAGG + Intergenic
1093344420 12:18023804-18023826 TGGAGCCAAGACAGCTGAATAGG + Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094716586 12:33020131-33020153 TGGAGCCACAGGAGCTGGGTTGG - Intergenic
1098000840 12:65940706-65940728 TGGAGCTATACAACCTGGGTGGG + Intronic
1099011518 12:77296979-77297001 TGAAGCCAAAAGACTTGGCTTGG + Intergenic
1100732424 12:97487214-97487236 AAGAACCAAATCACCTGGGTTGG + Intergenic
1103210849 12:119165307-119165329 TGCAGCCCAGACACCTGGGCTGG - Intergenic
1104785349 12:131444956-131444978 TGGGGCCAAGAGGCCTGGGTGGG + Intergenic
1114660180 14:24338847-24338869 AGGAGCTAAAACTCCTGGCTGGG + Intronic
1116947666 14:50850984-50851006 TGGAGCCAATGCACCTCGTTTGG - Intergenic
1118324455 14:64771834-64771856 TGGGGACAGAACACCAGGGTTGG - Intronic
1120647312 14:87089440-87089462 TGGAGCCAGAATACCTGGGTTGG - Intergenic
1120831560 14:89001699-89001721 TGGAGCCATAGAACCTGGCTTGG + Intergenic
1122405670 14:101499355-101499377 AGGAGCCAGCAGACCTGGGTTGG + Intergenic
1124468537 15:29962294-29962316 TGTAGCCAAAGCTCCTGAGTTGG - Intronic
1125250633 15:37698681-37698703 TGGTGACAAAACCACTGGGTAGG + Intergenic
1125424628 15:39536423-39536445 TAGAGCCACACCAACTGGGTAGG + Intergenic
1127931726 15:63601365-63601387 TGGACCGAAATCACCTCGGTGGG + Exonic
1128054160 15:64687514-64687536 TGGAGTCAAAACAGTTTGGTAGG + Intergenic
1128263104 15:66246357-66246379 TTGAGCCCAAACATCTGGGAAGG + Intronic
1129674788 15:77626688-77626710 GGGAGCCAAGACCCATGGGTGGG + Intronic
1129684829 15:77679672-77679694 TGGAGTCAGAACACCTGACTAGG + Intronic
1132122253 15:99186317-99186339 TGAAGTCAAAAAATCTGGGTTGG - Intronic
1136173068 16:28499787-28499809 TGGGGCCAGGACACCTGGGCCGG + Exonic
1136559258 16:31029249-31029271 GGGAGCCAGATGACCTGGGTTGG - Intergenic
1138129705 16:54469441-54469463 CGGAGGCTAAACCCCTGGGTAGG - Intergenic
1138336028 16:56253323-56253345 TGGAGTCAGAAGACCTGGGTTGG + Intronic
1140279552 16:73542247-73542269 TGGAACCAGAACATTTGGGTGGG + Intergenic
1140486195 16:75295596-75295618 AGGAACCAAAACACCTGGTCTGG + Intronic
1142242099 16:88952255-88952277 TGGAGCCAGGACACCCGGGGAGG + Intronic
1145936125 17:28715928-28715950 TGGAGCCAGCCCACCTGGCTAGG + Intronic
1146721865 17:35129613-35129635 TGCAGCCAACACAGCTGGGGTGG + Exonic
1149559491 17:57598145-57598167 TGGAGCAAAAACATTTTGGTTGG + Intronic
1150292178 17:63988301-63988323 TGGAGCCACATCACCTGTGCGGG - Intergenic
1151189204 17:72385858-72385880 TGGAGGAAAAACACCAGGGAAGG - Intergenic
1152005583 17:77678317-77678339 TGGTGCCAGCAGACCTGGGTTGG + Intergenic
1153819605 18:8822261-8822283 TAGAGCCAAACTGCCTGGGTTGG + Intronic
1155725521 18:29077090-29077112 TGGAGTCAAAGTACCTGGCTTGG + Intergenic
1156404148 18:36768944-36768966 TAAAGACAACACACCTGGGTTGG + Intronic
1157853433 18:51080931-51080953 TGGAGCCAAGCCACCTGTCTTGG + Exonic
1160441300 18:78894755-78894777 AGGAGACAGAACATCTGGGTTGG - Intergenic
1168034854 19:53711240-53711262 TGAATCCAAAAGACCTAGGTTGG - Intergenic
1168215349 19:54921085-54921107 GGGAGTGAAAACATCTGGGTCGG - Intergenic
927228171 2:20791231-20791253 TGAAGCCAGACTACCTGGGTTGG + Intronic
928511232 2:32005899-32005921 GGGAGGCAAAGCACCAGGGTAGG + Intronic
928719403 2:34101685-34101707 TGAAGCCAACTCACCTTGGTAGG - Intergenic
930071325 2:47369077-47369099 TGGAGACGAAGCACCTGGGGCGG + Intronic
930632437 2:53768124-53768146 TGGGGCCAAAGCACATGGCTTGG + Intronic
931111223 2:59113644-59113666 TTGAGACAAAGCACCTGGGAGGG + Intergenic
931839121 2:66130099-66130121 TGGAGACAAAACAAGTGGTTTGG - Intergenic
933090448 2:78110551-78110573 TTGAGCTACAGCACCTGGGTGGG + Intergenic
933322961 2:80800089-80800111 AGGAGTCAGAAGACCTGGGTTGG - Intergenic
934947109 2:98550090-98550112 TCAACCCAAAACACCTGGGTTGG - Intronic
936870598 2:117131265-117131287 TGGACCCAAAACTCCTGCGGCGG + Intergenic
937272374 2:120661186-120661208 TGGAGCCAACATATCTGGGATGG - Intergenic
937708777 2:124953107-124953129 TGGAGGCAAAGCAACTGGTTAGG - Intergenic
939125922 2:138177333-138177355 TGGAGTTAAAAGACCTGGGTTGG - Intergenic
940573064 2:155466127-155466149 TGAAGCCAAAACACGAGGCTTGG + Intergenic
941404114 2:165068207-165068229 TGGAGCCGAAACAGCAGGGCTGG - Intergenic
943618497 2:190120347-190120369 TGGTGCCAAAAAAGCTGGGGGGG + Intronic
946885363 2:224217294-224217316 TGGAACCAAGACAGCTGGGTGGG + Intergenic
946960500 2:224979925-224979947 TGGAGCCAGAACACCTAGGTTGG - Intronic
948797717 2:240413202-240413224 AGGAGCCAAACCACCCTGGTGGG + Intergenic
1168842499 20:918426-918448 TGGAGCCAGCACATCTGGATCGG + Intergenic
1170522698 20:17204611-17204633 TGGAGACAAATCAGCTGGGTTGG + Intergenic
1172804063 20:37598541-37598563 TGGAGCCTGAACTCCTGGGGAGG + Intergenic
1173045390 20:39504709-39504731 TTGAGCCAACAGACTTGGGTTGG + Intergenic
1173606877 20:44337818-44337840 GGGAGCCAAAATTCTTGGGTAGG - Intronic
1174704697 20:52643749-52643771 TGGAGTCAAAAGACCTCTGTTGG - Intergenic
1176232677 20:64040128-64040150 TGGAGCCAAAGCACTTGAGGGGG + Intronic
1176424232 21:6538150-6538172 TGGAGCAAAAACACCAGCCTTGG + Intergenic
1178278945 21:31264576-31264598 TGGAGCCAAAATATCCGGCTTGG + Intronic
1179699725 21:43146465-43146487 TGGAGCAAAAACACCAGCCTTGG + Intergenic
1180192713 21:46173753-46173775 TGGAGGCAAAGCAGCTGGGGTGG - Intronic
1181585697 22:23852364-23852386 TGGAGCCACCACACCTGGCCAGG + Intergenic
1183352064 22:37340014-37340036 TGGAGCCCAAGGACCTGGGGTGG + Intergenic
1183542864 22:38439806-38439828 GTGAGCCAATACACCTGGCTAGG - Intronic
1183542910 22:38440125-38440147 ATGAGCCAATACACCTGGCTAGG - Intronic
1183668594 22:39258994-39259016 TGGTGCACAAACACCTGGGCTGG - Intergenic
1184619559 22:45665359-45665381 AGGAACCAAAACACCTGAATTGG - Intergenic
949953679 3:9250105-9250127 TGGAGGCAGAACAGCTGGGTGGG + Intronic
950023412 3:9804875-9804897 TGGAGGCAACCCACCTGTGTGGG + Intronic
950202664 3:11056168-11056190 TGGAGCCACAGGGCCTGGGTTGG - Intergenic
951482815 3:23179528-23179550 TGAAGGCAACACACATGGGTGGG + Intergenic
955155452 3:56412637-56412659 TAGAGTCCAACCACCTGGGTTGG + Intronic
962224674 3:133596069-133596091 TGGAGCCAAAACACCTGGGTTGG - Intergenic
962304431 3:134273013-134273035 TTGTTTCAAAACACCTGGGTGGG - Intergenic
962391205 3:134974302-134974324 TGGAGCCAGACTGCCTGGGTTGG + Intronic
964451007 3:156813285-156813307 AGGATGCAAAACACCTGTGTTGG + Intergenic
964767749 3:160195173-160195195 TGGAGCAGAAAAATCTGGGTGGG - Intergenic
965503880 3:169489664-169489686 TAGAGCCAGAACACTTGGTTAGG + Intronic
966289973 3:178343832-178343854 TGGAGGCAATGCAGCTGGGTTGG - Intergenic
969273653 4:6119881-6119903 TGGAGGCAGGAGACCTGGGTTGG - Intronic
970767987 4:19574287-19574309 TGGAACCAAATGACCTGAGTTGG + Intergenic
971366943 4:25985078-25985100 GGGAGCCAGAACACTTGGTTTGG - Intergenic
972547864 4:40098247-40098269 TGGAGTCAAGAAACGTGGGTTGG + Intronic
972813737 4:42620606-42620628 TGGAGCCAAAATGCCTTGTTTGG + Intronic
975347017 4:73303541-73303563 TGTAGCCAAATCACCTTGGAGGG - Intergenic
978582751 4:110248453-110248475 TGGAGTCAAAACCCCTAGATAGG - Intergenic
982247393 4:153366930-153366952 TGGAGTCAAAATACCTGAGACGG - Intronic
982497396 4:156108582-156108604 TGGACCCAAAACTCCGGTGTCGG - Intergenic
984144403 4:176043944-176043966 TGGAGGCAACACAGCTGGTTGGG + Intergenic
986482348 5:8202229-8202251 TGGACCCAGAACACCCGGGTTGG - Intergenic
987008200 5:13732649-13732671 TTGAGCCACCGCACCTGGGTGGG + Intronic
987446384 5:18024642-18024664 TGGAGCCACAATGCTTGGGTTGG + Intergenic
989139938 5:38192262-38192284 TGTTTCCAAAACCCCTGGGTAGG - Intergenic
995540715 5:113183525-113183547 TGGAACCAAAACCCTTGGGAGGG - Intronic
995769178 5:115651465-115651487 TGGACCCAAAACTCCAGCGTCGG + Intergenic
1003984960 6:11426245-11426267 TGGACCCAAAACCCATGGTTAGG - Intergenic
1005773964 6:29108646-29108668 TGTATCAAAAATACCTGGGTCGG - Intergenic
1005818443 6:29576793-29576815 TGGAGCCCAAACTCCTAGATCGG + Intronic
1006727136 6:36207560-36207582 TGGAGCCTACAATCCTGGGTAGG - Intronic
1006788435 6:36683309-36683331 TGGAGCCAGATCACCTGGGCTGG - Intronic
1008071779 6:47105585-47105607 TGGAGCCAGTACACCAGGGCTGG - Intergenic
1010071938 6:71753338-71753360 TGGACCCAAAACTCCAGCGTGGG - Intergenic
1011180776 6:84617962-84617984 TGAAATCAAAAGACCTGGGTTGG - Intergenic
1011759233 6:90542601-90542623 TGGAGTCAGAAGATCTGGGTTGG + Intronic
1012406394 6:98904894-98904916 AGGAGCGGAAACACCTGGGCAGG + Intronic
1013918836 6:115375392-115375414 TTGACCTAAAACACCTGAGTTGG - Intergenic
1018782072 6:167077201-167077223 TGGAGACAAAGCACCTGGCCTGG + Intergenic
1021460608 7:20882781-20882803 AGGAGCTAAAACCCCTGGTTTGG - Intergenic
1021831558 7:24617854-24617876 TGGAGACACAATGCCTGGGTTGG + Intronic
1023810505 7:43907600-43907622 TGAAGCCAGAATACCTGTGTTGG + Intronic
1024953959 7:54896482-54896504 TGGAGTCAGATCACATGGGTTGG - Intergenic
1028091730 7:86710954-86710976 TGGAGCCAGACAACCTGGATAGG - Intronic
1031922798 7:127613868-127613890 TGGAGCCAAAACAGCTGAAAAGG + Exonic
1032715748 7:134507707-134507729 TGGAGCCAAACCTCCTTGGATGG - Intergenic
1035492522 7:159292818-159292840 TGGTGCCCAAACTCCTGGTTTGG - Intergenic
1035778790 8:2210813-2210835 TTGAAACAAAACAGCTGGGTTGG + Intergenic
1036433585 8:8712318-8712340 TACAGGCAAAACAGCTGGGTAGG + Intergenic
1038144590 8:24883492-24883514 TGGAGTCAGAAGACCTGGGCTGG - Intergenic
1038584773 8:28778689-28778711 TTGAGCCAAAAGACCTCGCTCGG + Intronic
1044925852 8:97208211-97208233 TGGTGCCAACACACGTAGGTGGG + Intergenic
1045298937 8:100894198-100894220 TGGAGTCAGAAGACTTGGGTTGG - Intergenic
1045319187 8:101068872-101068894 TGGAGCCAACAGACCTGGAGAGG + Intergenic
1045553031 8:103189680-103189702 TGGAGAAATAACACCTAGGTGGG + Intronic
1047853809 8:128887834-128887856 TGGAGCCAAGAATCCTGGCTTGG - Intergenic
1053078664 9:35155956-35155978 TGGACCCAAAACACCAGCGCTGG - Intergenic
1053903165 9:42815217-42815239 TGGAGACAATACAACTGGGCTGG + Intergenic
1056156128 9:83839392-83839414 TAGAGTCAAAAGATCTGGGTTGG - Intronic
1056354406 9:85784177-85784199 TAGAGTCAAAAGATCTGGGTTGG + Intergenic
1056773388 9:89495735-89495757 TGGAGCCAGAGCTCCAGGGTTGG - Intronic
1059795111 9:117686036-117686058 AGGAGCCAAAACACCCTGGAAGG + Intergenic
1062196615 9:135277656-135277678 TTGAGCAAAAACGCCTGCGTTGG - Intergenic
1062384295 9:136303012-136303034 TGGGGCCCCAACACCTGGGGTGG + Exonic
1187289379 X:17938272-17938294 TGGAACCAGAAGACCTGGGTAGG + Intergenic
1187321179 X:18238782-18238804 TGGAGCCGCAACTCCTGGGGTGG + Intergenic
1187834628 X:23419209-23419231 GTGAGCCAATGCACCTGGGTTGG - Intergenic
1192261480 X:69508378-69508400 TGGCACCAAAACACGTGGGCTGG - Intronic
1196703506 X:118696860-118696882 AGCAGCCAAAACACCCAGGTAGG - Intergenic
1198076945 X:133202909-133202931 TGGAGCGAACACATCTGGTTGGG + Intergenic
1200256627 X:154585955-154585977 GGGAACCAAGACAGCTGGGTGGG + Intronic
1200261142 X:154618448-154618470 GGGAACCAAGACAGCTGGGTGGG - Intronic