ID: 962231377

View in Genome Browser
Species Human (GRCh38)
Location 3:133668553-133668575
Sequence CTACACACTGGGGAATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962231377_962231388 1 Left 962231377 3:133668553-133668575 CCTCCCCATTCCCCAGTGTGTAG No data
Right 962231388 3:133668577-133668599 AGATGTGTGCTTGGGCAGGGAGG No data
962231377_962231385 -7 Left 962231377 3:133668553-133668575 CCTCCCCATTCCCCAGTGTGTAG No data
Right 962231385 3:133668569-133668591 TGTGTAGCAGATGTGTGCTTGGG No data
962231377_962231387 -2 Left 962231377 3:133668553-133668575 CCTCCCCATTCCCCAGTGTGTAG No data
Right 962231387 3:133668574-133668596 AGCAGATGTGTGCTTGGGCAGGG No data
962231377_962231384 -8 Left 962231377 3:133668553-133668575 CCTCCCCATTCCCCAGTGTGTAG No data
Right 962231384 3:133668568-133668590 GTGTGTAGCAGATGTGTGCTTGG No data
962231377_962231389 2 Left 962231377 3:133668553-133668575 CCTCCCCATTCCCCAGTGTGTAG No data
Right 962231389 3:133668578-133668600 GATGTGTGCTTGGGCAGGGAGGG No data
962231377_962231391 25 Left 962231377 3:133668553-133668575 CCTCCCCATTCCCCAGTGTGTAG No data
Right 962231391 3:133668601-133668623 AAAAAAACATGTCTGGATTCTGG No data
962231377_962231390 18 Left 962231377 3:133668553-133668575 CCTCCCCATTCCCCAGTGTGTAG No data
Right 962231390 3:133668594-133668616 GGGAGGGAAAAAAACATGTCTGG No data
962231377_962231386 -3 Left 962231377 3:133668553-133668575 CCTCCCCATTCCCCAGTGTGTAG No data
Right 962231386 3:133668573-133668595 TAGCAGATGTGTGCTTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962231377 Original CRISPR CTACACACTGGGGAATGGGG AGG (reversed) Intergenic
No off target data available for this crispr