ID: 962234145

View in Genome Browser
Species Human (GRCh38)
Location 3:133693410-133693432
Sequence TTTCAGCCCTTGAATAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234138_962234145 26 Left 962234138 3:133693361-133693383 CCAGGCTCCCTGTTCAGTTATGT No data
Right 962234145 3:133693410-133693432 TTTCAGCCCTTGAATAATGATGG No data
962234141_962234145 18 Left 962234141 3:133693369-133693391 CCTGTTCAGTTATGTTGAGGCAC No data
Right 962234145 3:133693410-133693432 TTTCAGCCCTTGAATAATGATGG No data
962234140_962234145 19 Left 962234140 3:133693368-133693390 CCCTGTTCAGTTATGTTGAGGCA No data
Right 962234145 3:133693410-133693432 TTTCAGCCCTTGAATAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234145 Original CRISPR TTTCAGCCCTTGAATAATGA TGG Intergenic
No off target data available for this crispr