ID: 962234162

View in Genome Browser
Species Human (GRCh38)
Location 3:133693549-133693571
Sequence CATGGCCAGAGCTGCGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234162_962234163 -8 Left 962234162 3:133693549-133693571 CCTGGATCGCAGCTCTGGCCATG No data
Right 962234163 3:133693564-133693586 TGGCCATGCTTTGCCCTTTCTGG No data
962234162_962234164 -7 Left 962234162 3:133693549-133693571 CCTGGATCGCAGCTCTGGCCATG No data
Right 962234164 3:133693565-133693587 GGCCATGCTTTGCCCTTTCTGGG No data
962234162_962234168 18 Left 962234162 3:133693549-133693571 CCTGGATCGCAGCTCTGGCCATG No data
Right 962234168 3:133693590-133693612 TGATCACTTGCCTCAGTGTCAGG No data
962234162_962234169 27 Left 962234162 3:133693549-133693571 CCTGGATCGCAGCTCTGGCCATG No data
Right 962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234162 Original CRISPR CATGGCCAGAGCTGCGATCC AGG (reversed) Intergenic
No off target data available for this crispr