ID: 962234165

View in Genome Browser
Species Human (GRCh38)
Location 3:133693567-133693589
Sequence CTCCCAGAAAGGGCAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234165_962234169 9 Left 962234165 3:133693567-133693589 CCATGCTTTGCCCTTTCTGGGAG No data
Right 962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG No data
962234165_962234172 22 Left 962234165 3:133693567-133693589 CCATGCTTTGCCCTTTCTGGGAG No data
Right 962234172 3:133693612-133693634 GTGCTACTGGACACCCATCTGGG No data
962234165_962234171 21 Left 962234165 3:133693567-133693589 CCATGCTTTGCCCTTTCTGGGAG No data
Right 962234171 3:133693611-133693633 GGTGCTACTGGACACCCATCTGG No data
962234165_962234168 0 Left 962234165 3:133693567-133693589 CCATGCTTTGCCCTTTCTGGGAG No data
Right 962234168 3:133693590-133693612 TGATCACTTGCCTCAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234165 Original CRISPR CTCCCAGAAAGGGCAAAGCA TGG (reversed) Intergenic
No off target data available for this crispr