ID: 962234166

View in Genome Browser
Species Human (GRCh38)
Location 3:133693577-133693599
Sequence CAAGTGATCACTCCCAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234166_962234175 26 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234175 3:133693626-133693648 CCATCTGGGCAGCTGTGCAGTGG No data
962234166_962234176 30 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234176 3:133693630-133693652 CTGGGCAGCTGTGCAGTGGCTGG No data
962234166_962234172 12 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234172 3:133693612-133693634 GTGCTACTGGACACCCATCTGGG No data
962234166_962234169 -1 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG No data
962234166_962234168 -10 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234168 3:133693590-133693612 TGATCACTTGCCTCAGTGTCAGG No data
962234166_962234171 11 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234171 3:133693611-133693633 GGTGCTACTGGACACCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234166 Original CRISPR CAAGTGATCACTCCCAGAAA GGG (reversed) Intergenic