ID: 962234169

View in Genome Browser
Species Human (GRCh38)
Location 3:133693599-133693621
Sequence GCCTCAGTGTCAGGTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234162_962234169 27 Left 962234162 3:133693549-133693571 CCTGGATCGCAGCTCTGGCCATG No data
Right 962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG No data
962234167_962234169 -2 Left 962234167 3:133693578-133693600 CCTTTCTGGGAGTGATCACTTGC No data
Right 962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG No data
962234166_962234169 -1 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG No data
962234165_962234169 9 Left 962234165 3:133693567-133693589 CCATGCTTTGCCCTTTCTGGGAG No data
Right 962234169 3:133693599-133693621 GCCTCAGTGTCAGGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234169 Original CRISPR GCCTCAGTGTCAGGTGCTAC TGG Intergenic
No off target data available for this crispr