ID: 962234170

View in Genome Browser
Species Human (GRCh38)
Location 3:133693600-133693622
Sequence TCCAGTAGCACCTGACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234170_962234175 3 Left 962234170 3:133693600-133693622 CCTCAGTGTCAGGTGCTACTGGA No data
Right 962234175 3:133693626-133693648 CCATCTGGGCAGCTGTGCAGTGG No data
962234170_962234176 7 Left 962234170 3:133693600-133693622 CCTCAGTGTCAGGTGCTACTGGA No data
Right 962234176 3:133693630-133693652 CTGGGCAGCTGTGCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234170 Original CRISPR TCCAGTAGCACCTGACACTG AGG (reversed) Intergenic