ID: 962234172

View in Genome Browser
Species Human (GRCh38)
Location 3:133693612-133693634
Sequence GTGCTACTGGACACCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234167_962234172 11 Left 962234167 3:133693578-133693600 CCTTTCTGGGAGTGATCACTTGC No data
Right 962234172 3:133693612-133693634 GTGCTACTGGACACCCATCTGGG No data
962234165_962234172 22 Left 962234165 3:133693567-133693589 CCATGCTTTGCCCTTTCTGGGAG No data
Right 962234172 3:133693612-133693634 GTGCTACTGGACACCCATCTGGG No data
962234166_962234172 12 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234172 3:133693612-133693634 GTGCTACTGGACACCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234172 Original CRISPR GTGCTACTGGACACCCATCT GGG Intergenic
No off target data available for this crispr