ID: 962234176

View in Genome Browser
Species Human (GRCh38)
Location 3:133693630-133693652
Sequence CTGGGCAGCTGTGCAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234167_962234176 29 Left 962234167 3:133693578-133693600 CCTTTCTGGGAGTGATCACTTGC No data
Right 962234176 3:133693630-133693652 CTGGGCAGCTGTGCAGTGGCTGG No data
962234166_962234176 30 Left 962234166 3:133693577-133693599 CCCTTTCTGGGAGTGATCACTTG No data
Right 962234176 3:133693630-133693652 CTGGGCAGCTGTGCAGTGGCTGG No data
962234170_962234176 7 Left 962234170 3:133693600-133693622 CCTCAGTGTCAGGTGCTACTGGA No data
Right 962234176 3:133693630-133693652 CTGGGCAGCTGTGCAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234176 Original CRISPR CTGGGCAGCTGTGCAGTGGC TGG Intergenic
No off target data available for this crispr