ID: 962234301

View in Genome Browser
Species Human (GRCh38)
Location 3:133694281-133694303
Sequence TGTCAACTGTGTGCAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962234293_962234301 11 Left 962234293 3:133694247-133694269 CCCCTGTGAGGACATGAAGAATT 0: 1
1: 1
2: 4
3: 15
4: 185
Right 962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG 0: 1
1: 0
2: 1
3: 21
4: 281
962234294_962234301 10 Left 962234294 3:133694248-133694270 CCCTGTGAGGACATGAAGAATTT 0: 1
1: 1
2: 5
3: 23
4: 263
Right 962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG 0: 1
1: 0
2: 1
3: 21
4: 281
962234291_962234301 24 Left 962234291 3:133694234-133694256 CCAGCAGCTGCGTCCCCTGTGAG 0: 1
1: 0
2: 1
3: 20
4: 232
Right 962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG 0: 1
1: 0
2: 1
3: 21
4: 281
962234295_962234301 9 Left 962234295 3:133694249-133694271 CCTGTGAGGACATGAAGAATTTC 0: 1
1: 0
2: 2
3: 25
4: 195
Right 962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG 0: 1
1: 0
2: 1
3: 21
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962234301 Original CRISPR TGTCAACTGTGTGCAGGGAA AGG Intergenic
901840087 1:11948802-11948824 TGTCATCTGTGTGCAGTCCATGG + Intronic
903023892 1:20413371-20413393 TCTTACCTGTGTGCAGGGTAGGG - Intergenic
903186959 1:21634282-21634304 GGTCAACGGTGCCCAGGGAAAGG - Intronic
903197605 1:21703269-21703291 TGTCAGCTGTGTTCCAGGAATGG - Intronic
903317351 1:22518726-22518748 TGTAAACTGCTTGGAGGGAAAGG - Intronic
904364957 1:30004658-30004680 GGTCAGCTGTGTACAGGGGAGGG - Intergenic
904651304 1:32007942-32007964 TGCCAAATATGTGGAGGGAAGGG - Intergenic
904651731 1:32011076-32011098 TGGGAAATGTGTTCAGGGAATGG - Intergenic
904900407 1:33852590-33852612 TGTCCACTGGGGGCAGGGAGAGG - Intronic
905108534 1:35577900-35577922 TGACAAATGTGGGCAGGAAATGG - Intronic
905210450 1:36370348-36370370 TGTCACCAGTGTGAAGGGACAGG - Intronic
905345785 1:37310053-37310075 TGCCTACTGTGTGCCAGGAATGG - Intergenic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
906730326 1:48075235-48075257 GGTCAACTGTGTTCAAGGAAGGG + Intergenic
908178946 1:61585140-61585162 GTGCAACTGTGTGGAGGGAAAGG - Intergenic
908823689 1:68113773-68113795 GGTGAACTGTCCGCAGGGAAAGG + Intronic
915072860 1:153286786-153286808 TGTCAGCTCTGTGGAGGGTAGGG - Intergenic
916575992 1:166066938-166066960 TGTAAACTGCATGCAGCGAAGGG + Intronic
916933415 1:169603189-169603211 TAGCAAAGGTGTGCAGGGAATGG + Exonic
916951323 1:169783254-169783276 TGCCAACTGTAGGCAGGCAATGG - Intronic
918042834 1:180923650-180923672 CTGCAAGTGTGTGCAGGGAAAGG + Intronic
920455996 1:206101550-206101572 TTCCACCTGTCTGCAGGGAATGG - Intronic
920495707 1:206453547-206453569 TCTCCACTGAGTGCAGGGAGTGG - Intronic
921152025 1:212410315-212410337 TGACACCAGGGTGCAGGGAAGGG + Intronic
921549944 1:216523157-216523179 TGTCAGCGATATGCAGGGAATGG - Intronic
922398654 1:225227922-225227944 TGTGACCTGAGTGCAGGGACAGG + Intronic
923040678 1:230317966-230317988 TGTGAACTGTGTTCCGGGGAGGG - Intergenic
924907887 1:248475828-248475850 TGTCAAGTGTGTGTAGGAAATGG - Intergenic
924916222 1:248572254-248572276 TGTCAAGTGTGTGTAGGAAATGG + Intergenic
1062824225 10:556619-556641 TGGCAACATTGTGGAGGGAAAGG - Intronic
1065860943 10:29871977-29871999 TGCCAGATCTGTGCAGGGAAGGG - Intergenic
1067375187 10:45721202-45721224 TGCCCACTGTGGGCAGGGCAGGG - Intergenic
1068643870 10:59443688-59443710 AGTTAACTGTGTGCAGAGATTGG + Intergenic
1068735334 10:60407955-60407977 TATCCACTGTGTGCAGAGTATGG - Intronic
1069742302 10:70692535-70692557 TGTAAACTTTGTTTAGGGAATGG + Intronic
1070333255 10:75432595-75432617 TCTCCAGGGTGTGCAGGGAAAGG - Intronic
1070745117 10:78929016-78929038 TCCCAACTGTGTGGAGGTAAGGG + Intergenic
1071120140 10:82267376-82267398 TGTGAACTGTCTGCAAGGATGGG - Intronic
1071426163 10:85555250-85555272 TGTTAACTGTGTGCAGGGTATGG + Intergenic
1073184877 10:101609836-101609858 TGTAAACAGGTTGCAGGGAAAGG - Intergenic
1073701213 10:105928899-105928921 TTTCAACTGTATGCATGTAAAGG - Intergenic
1074086489 10:110211736-110211758 TGTCTGCTGTGTGCAAGGCAGGG + Intronic
1074876062 10:117614294-117614316 TGTAAACCCTGTGCAGGGTAGGG - Intergenic
1075195003 10:120348665-120348687 TGTCAACTGGGAGCTGGGACTGG - Intergenic
1075531087 10:123230382-123230404 TGGCAGCTGTGTGCAGGAACAGG + Intergenic
1075614922 10:123883881-123883903 TGGAAACAGTGTGCAGAGAAGGG + Intronic
1075638136 10:124044363-124044385 TGCCAGCTGTGTGCAGGACACGG - Intronic
1075724672 10:124605189-124605211 TGTCAGCCGAATGCAGGGAACGG - Intronic
1077029260 11:456540-456562 TGTCACCTGTATGGAGGAAAGGG + Intronic
1077100736 11:821238-821260 TGTGACCTGTGTGCCGGGATGGG + Intronic
1079560177 11:21811745-21811767 TGTTAACTTTGTGGAGGCAATGG + Intergenic
1080542881 11:33285750-33285772 TGTCAAATGTGTACAGTTAAAGG + Intronic
1081088847 11:38836043-38836065 TTTCTACTGTGGGCAGGGAGTGG + Intergenic
1082909039 11:58349017-58349039 TTTCATCTGTGTCCATGGAATGG + Intergenic
1083904343 11:65660366-65660388 TGTCAGCTGAGTGAAGGGACAGG - Intronic
1084283721 11:68117922-68117944 TTACAACTGTGTGCAGAGGAGGG + Intronic
1084693089 11:70738297-70738319 CATCAACAATGTGCAGGGAAAGG + Intronic
1085316866 11:75550628-75550650 TGTGCACTGAGGGCAGGGAAGGG + Intergenic
1087140747 11:94763348-94763370 TGCCAACAGTTTGCAGGGCAGGG + Intronic
1087324809 11:96708688-96708710 TGCCAGCTGTGAGGAGGGAAAGG - Intergenic
1088930850 11:114349288-114349310 TGTCCACCATATGCAGGGAAAGG - Intergenic
1090465652 11:126930820-126930842 GGTCAGCTGTGTGCAGGGGTAGG - Intronic
1091346356 11:134856888-134856910 AGTCTACTGTGTGCAGGGCCTGG + Intergenic
1091466881 12:692414-692436 TGTAAAATGTGTGCAAGGATTGG + Intergenic
1091846862 12:3663015-3663037 TGTCATCTGAGTTCAGAGAAGGG - Intronic
1092077222 12:5684002-5684024 TGGCAGATGTGTGCAGGGACAGG + Intronic
1092446074 12:8558814-8558836 TGTGACCTGAGTGCAGGGACAGG - Intergenic
1093850882 12:24036584-24036606 TGTCAACTGTGTGAGGGGCACGG - Intergenic
1097688614 12:62713632-62713654 TGATAACTGTGGACAGGGAATGG - Intronic
1098752769 12:74316955-74316977 TGTCTGCTGTCTGCAGGGGAGGG - Intergenic
1099694998 12:86007139-86007161 TTTCAACTGTGTTCAATGAATGG + Intronic
1102052432 12:109872418-109872440 TGTCCACGGTGTTCAGGGCATGG + Intronic
1102922085 12:116799204-116799226 TGGCAACTGTGTACAAGGACTGG - Intronic
1103146338 12:118598334-118598356 TCTCAGCTGTGGGCAGGGTATGG - Intergenic
1103251932 12:119507300-119507322 TGTCAACAGGGGGCTGGGAAAGG + Intronic
1104076654 12:125395954-125395976 AATCAACTGTGGCCAGGGAATGG + Intronic
1104717116 12:131023416-131023438 TGGGAACAGGGTGCAGGGAATGG - Intronic
1104762314 12:131304884-131304906 TGTCAAATGTGTTCAGAGATGGG + Intergenic
1104817462 12:131655912-131655934 TGTCAAATGTGTTCAGAGATGGG - Intergenic
1105074815 13:16000883-16000905 TTTCAACTCTGTGAAGTGAATGG - Intergenic
1105978239 13:25492654-25492676 TTCCTACTGTGTGAAGGGAAGGG + Intronic
1106127319 13:26911170-26911192 GGTCATCTGTGAGAAGGGAAGGG - Intergenic
1106964456 13:35044573-35044595 AGCCTGCTGTGTGCAGGGAAAGG - Intronic
1107246914 13:38307717-38307739 TCTAAAGTGTGTACAGGGAAAGG + Intergenic
1108611247 13:52085856-52085878 TTTCAACTCTCTGCAGGGTAAGG - Intronic
1108788721 13:53940235-53940257 TGACAAATGTGTCCAGGGACTGG - Intergenic
1112696350 13:101953311-101953333 TGACAACTGTGTGCAGGTGGTGG - Intronic
1113965730 13:114152529-114152551 GGTAAACTGTGAGCGGGGAATGG - Intergenic
1114636113 14:24187836-24187858 TGGCCACTGTGTGCAGAGGAAGG - Intronic
1115721568 14:36167312-36167334 TTTCACCAGTGTGCAGAGAAAGG - Intergenic
1118612661 14:67553752-67553774 TGGCAACTGTGTGAAGGTCAAGG + Intronic
1120726100 14:87943231-87943253 GTTCATCTGTGTGCAGGGAAAGG + Intronic
1120816470 14:88864597-88864619 AGTCAACTTAGAGCAGGGAAAGG - Intronic
1121581852 14:95037641-95037663 TGTGAACTGAGCCCAGGGAAAGG + Intergenic
1126448773 15:48781980-48782002 TGCCAACTGTGTGAAGGAGATGG + Intronic
1127614405 15:60669433-60669455 TGTCACCTGGGTTCAGAGAAGGG + Intronic
1127762965 15:62157739-62157761 TTTTAAATGTGGGCAGGGAAAGG + Intergenic
1128538516 15:68508675-68508697 TGTCACCTGTGGGGAGTGAAAGG - Intergenic
1128908527 15:71491178-71491200 TGTCAAGGGTGTGGAGGAAAAGG - Intronic
1131819907 15:96261904-96261926 TGACATTTGTGTGCAGGGAAAGG + Intergenic
1132011217 15:98278060-98278082 TGTGAACTCTCTGCAGGTAAGGG + Intergenic
1132615991 16:841348-841370 TGTCAATTGTGTGAATGGAAAGG - Intergenic
1132668426 16:1092242-1092264 TGCCGACTGTGTGCAGGGACTGG - Intronic
1132668444 16:1092382-1092404 CGCCGACTGTGTGCAGGGATTGG - Intronic
1132668452 16:1092494-1092516 CGCCGACTGTGTGCAGGGATTGG - Intronic
1132668461 16:1092578-1092600 CGCCGACTGTGTGCAGGGATTGG - Intronic
1132668470 16:1092690-1092712 CGCCGACTGTGTGCAGGGATTGG - Intronic
1132668480 16:1092802-1092824 CGCCGACTGTGTGCAGGGATTGG - Intronic
1132668489 16:1092886-1092908 CGCCGACTGTGTGCAGGGATTGG - Intronic
1132668496 16:1092970-1092992 CGCCGACTGTGTGCAGGGATTGG - Intronic
1132668503 16:1093026-1093048 CGCCGACTGTGTGCAGGGATTGG - Intronic
1132668523 16:1093250-1093272 CGCCGACTGTGTGCAGGGATTGG - Intronic
1133677967 16:8093371-8093393 TGTCATCTATGTGCATGTAAGGG - Intergenic
1133716699 16:8457190-8457212 TGTCAAATGTCCCCAGGGAATGG - Intergenic
1135975750 16:27108188-27108210 TGGGAACTGTGGCCAGGGAAGGG + Intergenic
1136270594 16:29146141-29146163 TGAGACCTGTGTGCAGGGCATGG - Intergenic
1137924029 16:52522607-52522629 TGTCCTCTGTGTGCAGGACAGGG + Intronic
1139897898 16:70302887-70302909 TGACAATACTGTGCAGGGAAGGG - Intronic
1140946974 16:79777625-79777647 TGAAAACTGTGTGCAGGGGGAGG - Intergenic
1141755773 16:85989615-85989637 TGTCAAGAGTGTGCTGGGCAGGG - Intergenic
1143119019 17:4595923-4595945 TGTCTGCTGTGTGCAGGGTGTGG + Intronic
1143119025 17:4595963-4595985 TGTCTGCTGTGTGCAGGGTGTGG + Intronic
1143119038 17:4596043-4596065 TGTCTGCTGTGTGCAGGGTGTGG + Intronic
1143119051 17:4596123-4596145 TGTCTGCTGTGTGCAGGGTGTGG + Intronic
1143777744 17:9210353-9210375 TGCCAACTGTGTGCATGGTAAGG - Intronic
1147597951 17:41728619-41728641 TGTCAAGGGTGTACAGGGCAGGG + Intronic
1148106175 17:45120179-45120201 TGTTGCCTTTGTGCAGGGAAAGG + Intronic
1148998653 17:51734635-51734657 TGCCATCTGGGGGCAGGGAAGGG + Intronic
1150073399 17:62171664-62171686 TGTCAGCTGTGAGGAAGGAAGGG + Intergenic
1150381581 17:64724475-64724497 AATCAGCTGGGTGCAGGGAAGGG - Intergenic
1150456186 17:65308684-65308706 TTTGAACTGTGTGCATGAAAGGG - Intergenic
1151434783 17:74088332-74088354 TGTGATGTGTGTGCAGGGGATGG - Intergenic
1151615258 17:75205900-75205922 TGGCAACTGAGTCGAGGGAAGGG - Intronic
1151814316 17:76463774-76463796 TGTCCACTGTTAGCAGGGAAAGG - Intronic
1152862119 17:82702671-82702693 TGTCTCCTGTGAGCTGGGAAGGG + Intergenic
1157171392 18:45409646-45409668 TGTAAACTGTCTTCTGGGAAAGG - Intronic
1159682544 18:71372672-71372694 TGGCAAGTGTGTCCAAGGAATGG - Intergenic
1162323039 19:9980993-9981015 GGTCATCTGTGGGCAGGGAAAGG - Intronic
1162530313 19:11232150-11232172 TGTCACATGAGTGCAGGGACAGG + Intronic
1163997495 19:21064930-21064952 TGTCAATTATGATCAGGGAAAGG - Intergenic
1167096380 19:47376879-47376901 TGGCACCCGTGTGCATGGAAGGG + Intronic
925085815 2:1106600-1106622 TGTCACTTGGGTGCAGGGTATGG + Intronic
925182791 2:1827765-1827787 TGCCAATTGTGTGGAGGGGAGGG - Intronic
925502657 2:4523030-4523052 TGTCACCTGTGGGCAGGGCGAGG + Intergenic
926012169 2:9417081-9417103 TGGCCACTGTGAGCAGGGAAAGG - Intronic
926653821 2:15376588-15376610 TATCACCTGTGTGGGGGGAATGG + Intronic
928093273 2:28389568-28389590 TGTCAAGTGAGGGAAGGGAAGGG - Intergenic
928102610 2:28448191-28448213 TGCCTACTGTGTGCAGGAACTGG - Intergenic
928291183 2:30038639-30038661 TGTGAGCTGTTTGAAGGGAAGGG + Intergenic
929978987 2:46661499-46661521 TGGGAACTGTGGGCTGGGAACGG - Intergenic
932892983 2:75612008-75612030 TCCCAACTCTGTGCAGGGACAGG - Intergenic
933974707 2:87499105-87499127 TCTTAATTGTGTGGAGGGAAAGG - Intergenic
934163855 2:89276400-89276422 TGTCGTCTGTTTGCAGGGAATGG - Intergenic
934203417 2:89906124-89906146 TGTCGTCTGTTTGCAGGGAATGG + Intergenic
936319119 2:111451709-111451731 TCTTAATTGTGTGGAGGGAAAGG + Intergenic
936906587 2:117542415-117542437 TGTAAAATATGTACAGGGAAGGG + Intergenic
937036289 2:118785369-118785391 AGTGAAGTGTGTGCAGGGGATGG - Intergenic
937987382 2:127644138-127644160 CATCAGCTGTGTGCAGGGCAAGG + Intronic
938120673 2:128631119-128631141 TGCTCACTGTGTGCAGGGGACGG + Intergenic
938206507 2:129428776-129428798 TGTCAACAGTGGGCTGGGCAAGG - Intergenic
938367171 2:130744033-130744055 TGTCAACAGTGTGTAGAGCATGG - Intergenic
940366833 2:152857716-152857738 TGATATCTGTGTGGAGGGAAAGG + Intergenic
940366984 2:152859118-152859140 TGATATCTGTGTGGAGGGAAAGG + Intergenic
941268145 2:163389990-163390012 GGACAACTCTGGGCAGGGAATGG - Intergenic
943619874 2:190137164-190137186 TGTCAATTTTGTGCAGAAAATGG + Intronic
946072659 2:217047742-217047764 TGTAAACAGTGTGGTGGGAAGGG - Intergenic
947741493 2:232486943-232486965 CCTCAAGTGTGTGCAGGGAGGGG - Intronic
947781139 2:232764484-232764506 TGGGAACTGTGTGAAGGAAATGG + Intronic
948564093 2:238872514-238872536 GGCCAACGCTGTGCAGGGAAGGG + Intronic
948612293 2:239177543-239177565 TGTTGACTGTCTACAGGGAAGGG + Intronic
1171286770 20:23946101-23946123 TGTCCAGGGTGTCCAGGGAAGGG + Intergenic
1171766338 20:29283939-29283961 GTTCAACTTTGTGCAAGGAATGG + Intergenic
1172035282 20:32006324-32006346 GGTCACTTGTGTACAGGGAAAGG - Intergenic
1173025402 20:39303056-39303078 TCTCACCTGTGTTCAGGGCATGG + Intergenic
1173914517 20:46696994-46697016 TGTCAGCCATGTGCAGTGAAGGG + Intergenic
1174048945 20:47754076-47754098 AGTCAAATGCGTGCAGGGAAAGG + Intronic
1174308673 20:49633334-49633356 TGATTGCTGTGTGCAGGGAAAGG - Exonic
1175392889 20:58638117-58638139 GGACTACTGTGCGCAGGGAACGG - Intergenic
1176761021 21:10790257-10790279 TTTCAACTCTGTGAAGTGAATGG - Intergenic
1177964853 21:27715161-27715183 TGAGAACTTGGTGCAGGGAAAGG + Intergenic
1179172298 21:38981877-38981899 TTTTAACTGTGTTCAGGGATTGG - Intergenic
1181078401 22:20396872-20396894 TGTCATCATTCTGCAGGGAAAGG - Intronic
1181845808 22:25707904-25707926 TGGCATTTGTGGGCAGGGAAGGG - Intronic
1182134506 22:27888758-27888780 TGTCAACTTTGGACAGAGAAAGG + Intronic
1183302358 22:37064539-37064561 TGGCACCAGTGTGCAGGGAGCGG - Intergenic
1183369437 22:37424184-37424206 TGACAACCGTGTGCAGGGCTGGG - Intronic
1183939906 22:41288092-41288114 TCTCATCTCTGTGCTGGGAAGGG - Intergenic
950151280 3:10689343-10689365 TCTCAACTGTGTGACGGGAAAGG + Intronic
950947206 3:16961574-16961596 TGAAGACTGTGTGAAGGGAATGG + Intronic
951504145 3:23422824-23422846 TGTCAAAAGTGTCTAGGGAAGGG + Intronic
951537916 3:23756384-23756406 TGTCAGCTGTGTGTAGGGGTGGG - Intergenic
952191837 3:31031065-31031087 GGGAAACTGTGTGCAGGGGAAGG - Intergenic
952557281 3:34547120-34547142 TGTGTACTATGTGCAGGGCATGG + Intergenic
953451402 3:43009485-43009507 TGGCTCCTGTGTGCTGGGAAGGG + Intronic
953849545 3:46455355-46455377 TGTCGCCTGTGTGCGGGGACAGG - Exonic
954641739 3:52104543-52104565 TGTCAACTGTGTCCTGTGATGGG - Intronic
959378778 3:105617070-105617092 ATTCAACTGTATTCAGGGAATGG + Intergenic
961757017 3:129134243-129134265 TTTCAACACTATGCAGGGAAAGG + Intronic
962234301 3:133694281-133694303 TGTCAACTGTGTGCAGGGAAAGG + Intergenic
962241638 3:133755428-133755450 TGTCAACTGTGTCCAGGGTGTGG + Exonic
962307878 3:134304646-134304668 TGTCAAATAGGTGAAGGGAAGGG + Intergenic
962750546 3:138432003-138432025 TCTCAAATGTGTTCAGGCAAAGG + Intergenic
964195126 3:154055484-154055506 GGTCACCTGTGTGATGGGAATGG - Intergenic
964506832 3:157408812-157408834 AGTAAAGGGTGTGCAGGGAAGGG + Intronic
965446738 3:168782325-168782347 TGTCAACTGTGTGAACTGTAAGG + Intergenic
965503722 3:169487370-169487392 TGTAAACTGGGGGCAGGGGAGGG + Intronic
968377393 4:54519-54541 TGGCAGCAGGGTGCAGGGAAGGG - Intronic
968401711 4:304243-304265 TGGCAGCAGGGTGCAGGGAAGGG + Intronic
968405953 4:339030-339052 TGGCAGCAGGGTGCAGGGAAGGG - Intronic
969674495 4:8607436-8607458 TGTCGGGTGTGTGCAGGGGAGGG + Intronic
970908522 4:21246207-21246229 TGCCACCTGTGTGTAGGGAAAGG - Intronic
971021426 4:22540362-22540384 AGTCAACCATGTGCTGGGAATGG + Intergenic
974665998 4:64962363-64962385 TCTCATCTTTGTTCAGGGAAAGG - Intergenic
980629185 4:135411125-135411147 TGTGACCTGGGTGCAGGGACAGG + Intergenic
981777125 4:148382004-148382026 TGTCTATTGGGTGGAGGGAATGG - Intronic
981896912 4:149812835-149812857 TGTCACCTGGGTGTAGGGGAGGG - Intergenic
984876985 4:184377973-184377995 TGTAAGCTGTGTGCAGAGAGTGG - Intergenic
985131362 4:186741543-186741565 TGTCAAATGTGGGGAGGGTATGG - Intergenic
985712872 5:1439825-1439847 TGTGACCTGCGTGCAGGGATTGG + Intronic
986986721 5:13508499-13508521 TCTCAGCTGAATGCAGGGAAAGG - Intergenic
987395675 5:17420880-17420902 TGTCCTCAGTGTGCAGGGACTGG - Intergenic
987671381 5:21014486-21014508 TTTAAGCTTTGTGCAGGGAAGGG - Intergenic
988656638 5:33219037-33219059 TGCCTACTGTGTTCATGGAATGG - Intergenic
991511159 5:67377786-67377808 TGCCGCCTGCGTGCAGGGAATGG + Intergenic
992417544 5:76566351-76566373 AGTCACCTGTGTGCAGTCAAGGG + Intronic
995259616 5:110087057-110087079 TGTAGAATGTGTGCAGAGAAAGG - Intergenic
997353726 5:133248949-133248971 AGACAGCTGTGTGCAGGGAAGGG - Intronic
999284072 5:150383575-150383597 TGTTAACTGTGAGAAGGGCAGGG + Intronic
999550078 5:152677074-152677096 TGTCATCAGGCTGCAGGGAAAGG - Intergenic
1001949647 5:175807408-175807430 GGCCACCTGTGTGCAGGGACAGG - Intronic
1002861542 6:1084077-1084099 TGCCTCCTGTGTGCAGGGACTGG + Intergenic
1003803434 6:9698018-9698040 TGTCGAGTGTGTGCATGTAAAGG - Intronic
1004414654 6:15414623-15414645 TGTCTGCTGTGTTCACGGAAAGG + Intronic
1004680896 6:17893248-17893270 TGTCAGCTGTGCTCAGGTAAGGG - Intronic
1004773888 6:18820591-18820613 TAACCACTGTGTTCAGGGAAAGG - Intergenic
1004802528 6:19166034-19166056 TGGAAACTGTGTGCAGGAGAGGG + Intergenic
1006003099 6:30982035-30982057 GGTCAGCGGTGTGCTGGGAAAGG - Intergenic
1006511218 6:34522343-34522365 TGCCTACTGTGTGCTGGGTACGG - Intronic
1006813030 6:36832866-36832888 GGTGAACTGTGAGCTGGGAAAGG + Intronic
1007737625 6:43991366-43991388 TGTCCATTGTGTGCATGGGAAGG + Intergenic
1010626291 6:78139363-78139385 TGTGACCTGAGTGCAGGGACAGG + Intergenic
1011993745 6:93558180-93558202 TGTCAAATGTGGGCAGGAATAGG - Intergenic
1014216445 6:118756604-118756626 AGACAGCTTTGTGCAGGGAATGG - Intergenic
1018346597 6:162905286-162905308 TGTCATCTGTGTGAATGGAGTGG + Intronic
1018785759 6:167106667-167106689 AGTCATCTGTGTCCATGGAAAGG - Intergenic
1020215684 7:6188421-6188443 TGACAACTGTTTGCATGGCAGGG - Intronic
1021278742 7:18689828-18689850 TGTCAACTGTATCTAGGGAGAGG + Intronic
1029255731 7:99268308-99268330 TGTCAAGGGTGGGTAGGGAAAGG - Intergenic
1029954316 7:104621577-104621599 TGTCAACTCCCTGGAGGGAAAGG - Intronic
1031218923 7:118937913-118937935 AGTCAACAGTGTCAAGGGAAAGG + Intergenic
1031832710 7:126646920-126646942 TGGCCACTGTATGCAGGAAATGG - Intronic
1032547077 7:132752871-132752893 TCTCGACTTTGTGAAGGGAATGG + Intergenic
1032959556 7:137015678-137015700 TGAAAACTGTGTTCAGGGAGAGG + Exonic
1033139141 7:138809382-138809404 TGTGGACTGTGGGCAGGGGAGGG - Intronic
1036700554 8:11010931-11010953 TGTCAACTGTGCCCAGGGCCAGG + Intronic
1037036644 8:14177279-14177301 TGGCTACTGAGAGCAGGGAAGGG + Intronic
1038114525 8:24538401-24538423 TGTAAACTATGTGAAGGTAAGGG + Intergenic
1038503199 8:28062660-28062682 TGTCAACAGTGGGCAGAGAATGG + Intronic
1042785620 8:72543763-72543785 TGTCAAGTGTTTGAAGGGCAAGG - Intronic
1043783681 8:84369171-84369193 TCTCCACTGTGTCCAGGGGAGGG - Intronic
1046045563 8:108960292-108960314 TTTCATCTCTATGCAGGGAAAGG - Intergenic
1047096308 8:121629847-121629869 TCTCAGCTGGCTGCAGGGAAAGG - Intronic
1048725160 8:137375004-137375026 TTTCTACTGGGAGCAGGGAATGG - Intergenic
1049301669 8:141873911-141873933 TGGGAACTGTGTGTAGGGGAGGG + Intergenic
1049301683 8:141873966-141873988 TGGGAACTGTGTGTAGGGGAGGG + Intergenic
1049301697 8:141874021-141874043 TGGGAACTGTGTGTAGGGGAGGG + Intergenic
1049301711 8:141874076-141874098 TGGGAACTGTGTGTAGGGGAGGG + Intergenic
1049301726 8:141874157-141874179 TGGGAACTGTGTGTAGGGGAGGG + Intergenic
1049301740 8:141874212-141874234 TGGGAACTGTGTGTAGGGGAGGG + Intergenic
1049301764 8:141874343-141874365 TGGGAACTGTGTGTAGGGGACGG + Intergenic
1049301777 8:141874398-141874420 TGGGAACTGTGTGTAGGGGAGGG + Intergenic
1049301785 8:141874427-141874449 TGGGAACTGTGTGTAGGGGAGGG + Intergenic
1049389322 8:142359991-142360013 AGTGAGCTGGGTGCAGGGAAGGG + Intronic
1049963968 9:761943-761965 TGTCAAATGTGGGAAGGAAAGGG + Intergenic
1049995377 9:1029242-1029264 TGGTTGCTGTGTGCAGGGAAGGG + Intergenic
1050717769 9:8549055-8549077 TGTCAAGGGAGTGCAGTGAAGGG + Intronic
1051101423 9:13526716-13526738 TTTTATATGTGTGCAGGGAATGG + Intergenic
1051383014 9:16477997-16478019 TGTCATCTGTTTGCAGGATATGG - Intronic
1053558923 9:39169222-39169244 TGCAAAGTGTGTACAGGGAAGGG + Intronic
1054138188 9:61449721-61449743 TGCAAAGTGTGTACAGGGAAGGG - Intergenic
1056363154 9:85879173-85879195 GGGCAACTGTGTGCAGAGATTGG - Intergenic
1057863897 9:98664061-98664083 TGTCAAATGTGTGATTGGAAAGG + Intronic
1058527264 9:105872351-105872373 TGTCTGCTATGTGCAGGGACTGG - Intergenic
1059335202 9:113564769-113564791 ATTCAGCTGTGTGCTGGGAAGGG + Intronic
1059838662 9:118186898-118186920 TGTATACTGTGAGCATGGAAAGG - Intergenic
1062633834 9:137479425-137479447 CGTCCACTGTGTGCTGGGCAAGG + Intronic
1062675463 9:137740532-137740554 TTCCAGCTGTGTCCAGGGAAGGG - Intronic
1203571843 Un_KI270744v1:139727-139749 TGGCAGCAGGGTGCAGGGAAGGG + Intergenic
1185722416 X:2393475-2393497 TGTCATGTGTGTGCAGGAGATGG - Intronic
1186652517 X:11576467-11576489 TGTAAGCTCTATGCAGGGAAGGG + Intronic
1188417737 X:29956458-29956480 TGTAAACTCTGTGCAGGGGTGGG + Exonic
1188859397 X:35239034-35239056 TGTCTGCTGTGTGCAGACAAGGG + Intergenic
1188960923 X:36490619-36490641 TGTCAACTCTGTGCCAGGCATGG - Intergenic
1189180510 X:39000177-39000199 TGACAACTGGGAGCAGGGAGGGG + Intergenic
1190333083 X:49247753-49247775 CGTCAGCTTTGTGCAGGTAAGGG + Exonic
1190559193 X:51670648-51670670 TCTAAACTATGTGCAGGCAACGG - Intergenic
1190565098 X:51722673-51722695 TCTAAACTATGTGCAGGCAACGG + Intergenic
1190741673 X:53292850-53292872 TGTTCACTGCGTGCAGGGAAGGG + Intronic
1191927253 X:66326898-66326920 TGTACACTGTGTGCATGCAAAGG - Intergenic
1192425776 X:71074960-71074982 TTTCTACAGTGTGCAGAGAATGG + Intergenic
1192717472 X:73659625-73659647 TGTGACCTGAGTGCAGGGACAGG - Intronic
1198027952 X:132727309-132727331 TGTCTCCTATGTGCTGGGAATGG + Intronic
1199594347 X:149494649-149494671 TGTCCACTGTGTGTAAGGAGGGG + Intronic
1199853638 X:151742444-151742466 TGTTCACTGTGTGCAGGGCTTGG - Intronic