ID: 962235249

View in Genome Browser
Species Human (GRCh38)
Location 3:133701510-133701532
Sequence CTGTGTTAGACGTGGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962235243_962235249 11 Left 962235243 3:133701476-133701498 CCAGTAGGTATTTGCATCTACAG No data
Right 962235249 3:133701510-133701532 CTGTGTTAGACGTGGGCATATGG No data
962235242_962235249 23 Left 962235242 3:133701464-133701486 CCATTTAGTCAACCAGTAGGTAT No data
Right 962235249 3:133701510-133701532 CTGTGTTAGACGTGGGCATATGG No data
962235239_962235249 27 Left 962235239 3:133701460-133701482 CCCTCCATTTAGTCAACCAGTAG No data
Right 962235249 3:133701510-133701532 CTGTGTTAGACGTGGGCATATGG No data
962235240_962235249 26 Left 962235240 3:133701461-133701483 CCTCCATTTAGTCAACCAGTAGG No data
Right 962235249 3:133701510-133701532 CTGTGTTAGACGTGGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962235249 Original CRISPR CTGTGTTAGACGTGGGCATA TGG Intergenic
No off target data available for this crispr