ID: 962237431

View in Genome Browser
Species Human (GRCh38)
Location 3:133718460-133718482
Sequence CTGTGTTTTCTCTGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962237428_962237431 -9 Left 962237428 3:133718446-133718468 CCACATAATGAATTCTGTGTTTT No data
Right 962237431 3:133718460-133718482 CTGTGTTTTCTCTGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962237431 Original CRISPR CTGTGTTTTCTCTGGGAAGC AGG Intergenic
No off target data available for this crispr