ID: 962239887

View in Genome Browser
Species Human (GRCh38)
Location 3:133743458-133743480
Sequence TCCTTGGCCCCTGCATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962239881_962239887 5 Left 962239881 3:133743430-133743452 CCCTCTCTCGGTGTGACCCCAGA No data
Right 962239887 3:133743458-133743480 TCCTTGGCCCCTGCATGTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 329
962239882_962239887 4 Left 962239882 3:133743431-133743453 CCTCTCTCGGTGTGACCCCAGAT No data
Right 962239887 3:133743458-133743480 TCCTTGGCCCCTGCATGTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962239887 Original CRISPR TCCTTGGCCCCTGCATGTCC TGG Intergenic
900365766 1:2311376-2311398 TCCTGGGCACGTGCATGTTCTGG + Intergenic
901655348 1:10766104-10766126 TCAGTGGCCCCTGCATTTTCTGG - Intronic
903511011 1:23874918-23874940 TTCCTGGCACCTGCCTGTCCTGG + Exonic
903947435 1:26972604-26972626 TCCTTCCCCCCAGCATGTCTGGG + Intergenic
904031760 1:27537463-27537485 GTCTTGGCCCCAGCATGTGCTGG - Intronic
904671907 1:32172293-32172315 TCCTTGCTCCCTTCAGGTCCTGG - Exonic
905246060 1:36614673-36614695 GCCATGGCCCCTCCCTGTCCTGG - Intergenic
906719685 1:47996525-47996547 TCCTTCGCTCCTGCCTGTCCCGG - Intronic
911152360 1:94607933-94607955 TTCTTGACCACTGCATGTCCAGG + Intergenic
912149199 1:106836297-106836319 TCCTTGGCCTCTCAAAGTCCTGG - Intergenic
914970236 1:152303306-152303328 TCCCTGGCGCCTGCTTCTCCTGG + Exonic
914970395 1:152304278-152304300 TCCCTGGTTCCTGCTTGTCCTGG + Exonic
914970557 1:152305250-152305272 TCCCTGGCGCCTGCTTCTCCTGG + Exonic
914970709 1:152306222-152306244 TCCCTGGCGCCTGCTTCTCCTGG + Exonic
914971182 1:152309141-152309163 TCCCTGGTTCCTGCTTGTCCTGG + Exonic
914971342 1:152310113-152310135 TCCCTGGCGCCTGCTTGTCTTGG + Exonic
914971492 1:152311085-152311107 TCCCTGGTGCCTGCTTGTCCTGG + Exonic
914971652 1:152312057-152312079 TCCCTGGCGCCTGCTTGTCCTGG + Exonic
915576428 1:156781534-156781556 TCCTTGGCACCTTCAAGTCAAGG - Intronic
916944110 1:169707415-169707437 TCCATGGCCACTGCATGACCAGG + Exonic
919648931 1:200126095-200126117 TCCTTGGCCTCTCCAAGTGCTGG + Intronic
919727691 1:200894771-200894793 TCCTGGGCCTCTGCACTTCCGGG - Intronic
919808679 1:201396013-201396035 CCCTGGGCCCCAGCCTGTCCTGG - Intronic
920441993 1:205986898-205986920 TCTGTGGCTCCTGCAGGTCCTGG + Intronic
920649302 1:207824872-207824894 TCATTGGCCACTTCAGGTCCAGG - Intergenic
920668347 1:207983180-207983202 TCCCTGGTCCCAGCATGCCCAGG - Intergenic
921971607 1:221155131-221155153 TCCTTGGTGTCTGCATGGCCTGG + Intergenic
923191986 1:231627934-231627956 TCATAGTCTCCTGCATGTCCAGG - Intronic
923615473 1:235533663-235533685 TTCTAGGTCCCTGCATGACCTGG + Intergenic
924702457 1:246467909-246467931 ACCTTGGCCTCTGCAAGTACTGG - Intronic
1063087622 10:2833778-2833800 TTGTGGGCCACTGCATGTCCTGG + Intergenic
1065429298 10:25637564-25637586 TCCCTCACCCCTGCGTGTCCAGG - Intergenic
1067782557 10:49219477-49219499 TTCTTGGCCACAGCCTGTCCTGG + Intergenic
1068887107 10:62109097-62109119 TCCTGGGGTCCTGCAGGTCCTGG - Intergenic
1069900196 10:71702517-71702539 TCCTTGGCCCCTTCTCGCCCTGG + Intronic
1070059892 10:72971739-72971761 GCCTTGGTCTCTGAATGTCCTGG + Intergenic
1070603220 10:77880063-77880085 CCCTTAGCCCCTGCATGCTCAGG - Intronic
1070695802 10:78562216-78562238 TCCATGTACCCAGCATGTCCAGG + Intergenic
1070789712 10:79181824-79181846 GACTTGGCGGCTGCATGTCCCGG + Intronic
1070794116 10:79207140-79207162 TCCTAGGCCCCTCCCTGCCCTGG + Intronic
1071544983 10:86522040-86522062 TCCGTGGCACCTGCGTCTCCCGG - Intergenic
1075327584 10:121546973-121546995 TCCTTGGCCTCTGCGAGTGCTGG - Intronic
1076048377 10:127312999-127313021 TCCCTGGCCCCTCCCAGTCCTGG + Intronic
1076139402 10:128067870-128067892 TGCTTGGGCCCTGCCTGACCTGG + Intronic
1076150526 10:128158754-128158776 TTCTTCGCTCCTTCATGTCCTGG + Intergenic
1076216858 10:128701838-128701860 ACCCTGAGCCCTGCATGTCCAGG + Intergenic
1076707453 10:132309354-132309376 TCCTAGGCGGGTGCATGTCCAGG - Intronic
1077211525 11:1372909-1372931 TCCTTGGCCTCTGAAAGTGCTGG - Intergenic
1078118734 11:8483249-8483271 TTCTGGGCCCTTGCATGTGCTGG - Intronic
1079000676 11:16752772-16752794 TCTTCTTCCCCTGCATGTCCAGG - Exonic
1079172693 11:18111391-18111413 TTCTAGGCCCCTCTATGTCCAGG - Intergenic
1081765989 11:45610493-45610515 TCCCTGGCCCATGCTCGTCCAGG + Intergenic
1082943222 11:58730223-58730245 TCCTTGGCCTCTGAAAGTGCTGG - Intronic
1083202763 11:61130480-61130502 TCCTTGGCCCCAGCAGCCCCGGG + Exonic
1083270932 11:61572152-61572174 TCCTTGGCACCTGCCAGCCCTGG - Intronic
1084781215 11:71409716-71409738 TCCTCCATCCCTGCATGTCCAGG - Intergenic
1085217118 11:74843009-74843031 TCCTTGGCCCAGGCATGACCTGG - Exonic
1085485294 11:76858735-76858757 TCCTTGGCCTCCGAAAGTCCTGG - Intergenic
1085807580 11:79650335-79650357 TGCTTGGCCCCAGGAAGTCCAGG + Intergenic
1086416056 11:86589879-86589901 TACTTGGCACCTGCATGTCCTGG + Intronic
1087916821 11:103820734-103820756 TCCCTGACCCCTGCACTTCCTGG + Intergenic
1089307967 11:117538641-117538663 TCCATGGCTCCTGCAGCTCCAGG - Intronic
1089485329 11:118841199-118841221 TCCTTGGCCTCTGAAAGTGCTGG - Intergenic
1090280087 11:125448389-125448411 TCCCTGGCCCCTGCCTGGTCTGG + Intronic
1091174068 11:133544217-133544239 CCCTTGGCACCTGCAGATCCTGG - Intergenic
1091237921 11:134034065-134034087 TCCTTGAGCCCTGCAGGTGCCGG + Intergenic
1091829903 12:3542245-3542267 TCCTCCTCCCCTGCAGGTCCAGG - Intronic
1092126073 12:6075780-6075802 GCCTTGGACTCTGCATTTCCAGG - Intronic
1092712245 12:11351544-11351566 TCACTGCCCCCTGCATCTCCTGG - Intergenic
1097307098 12:58081404-58081426 TCCTTGGCACCTGGTTGTCATGG + Intergenic
1097880749 12:64684331-64684353 TCCTTGGCCTCTCAAAGTCCTGG + Intronic
1098577804 12:72063531-72063553 TCCTTGTGCCCTCAATGTCCTGG - Intronic
1101344509 12:103873754-103873776 AACTTGGCCCCTGCATGCCTGGG - Intergenic
1102733359 12:115134795-115134817 TCCTTGACCCCAGGATGGCCTGG - Intergenic
1103128784 12:118448444-118448466 ACCTTGGCCCCTGCTAGCCCTGG - Intergenic
1103592372 12:122001303-122001325 ACCTTGGCCTCTGCAAGTGCTGG + Intronic
1103884674 12:124191548-124191570 TCCCACGCCCCTGCATGCCCAGG + Intronic
1104329764 12:127833785-127833807 TCCCTGACCCCTTCAGGTCCCGG + Intergenic
1104574855 12:129957654-129957676 ACCTTGGCCTCTGAATGTGCTGG - Intergenic
1105014505 12:132777889-132777911 TCCCGGCCCCGTGCATGTCCTGG + Intronic
1106271920 13:28162727-28162749 TCCTTGGCCCCTCAAAGTACTGG - Intronic
1106335160 13:28777132-28777154 TCCCTGACCCCTGCACTTCCCGG + Intergenic
1107083975 13:36405687-36405709 TCCTTGGTCCCTGAATAACCAGG - Intergenic
1107394659 13:40003065-40003087 TCCTTGGCCCTTCCTTTTCCAGG + Intergenic
1108001892 13:45911452-45911474 TCCTTTGACCCTGCCTGCCCAGG - Intergenic
1111937974 13:94576851-94576873 TCCTTGGCCTCTGAAAGTGCTGG - Intronic
1113423908 13:110192257-110192279 CCCTTGGCCCCTGGCTGCCCTGG + Exonic
1113604466 13:111595558-111595580 TCCTTAGAGGCTGCATGTCCAGG + Intronic
1113708714 13:112450310-112450332 TCCTGCACCCCTGCAAGTCCAGG + Intergenic
1114037409 14:18642960-18642982 TCCTTGGCCTCTCAATGTGCTGG + Intergenic
1114121228 14:19672083-19672105 TCCTTGGCCTCTCAATGTGCTGG - Intergenic
1114734887 14:25034072-25034094 TCCTTGTCCGTTTCATGTCCAGG - Intronic
1116513729 14:45780564-45780586 GCCTCGGCCCCTGAAAGTCCTGG + Intergenic
1118380510 14:65214081-65214103 TCCATGGCCCCTGAATGACCAGG - Intergenic
1118702902 14:68451612-68451634 TCCTTTGCCCTTGCATTTGCTGG + Intronic
1119520373 14:75280184-75280206 TACTGGGCTCCTGCATCTCCGGG - Intronic
1121022396 14:90588233-90588255 TCCTTGGCCCTGGCCTGGCCTGG - Intronic
1121336013 14:93077860-93077882 GCCTCGGTCCCTGCAGGTCCTGG - Intronic
1121575518 14:94981862-94981884 TCCTTGGCTACGGCCTGTCCTGG + Intergenic
1122504109 14:102220841-102220863 TCATTGCACCCTGCATCTCCTGG + Intronic
1122981406 14:105193815-105193837 TCCCTGGCCTCCCCATGTCCAGG - Intergenic
1122992037 14:105241057-105241079 CCGTTGGCCTCTGCGTGTCCTGG - Intronic
1123001274 14:105295827-105295849 GCCTTGGCCCCTGAAAGTTCTGG - Intronic
1123026565 14:105427037-105427059 CCCGTGGTCCCTGCCTGTCCGGG - Intronic
1124182802 15:27492779-27492801 GCCTTAGGCCCTGCATTTCCTGG + Intronic
1124993246 15:34696638-34696660 TCCTAAACCCCTGCATTTCCTGG + Intergenic
1125037737 15:35145664-35145686 TAATTGTCCACTGCATGTCCAGG - Intergenic
1125804205 15:42478759-42478781 TCCTTGGCCTCTGAAAGTGCTGG + Intronic
1128539924 15:68519207-68519229 TCCTTAGCCCTTGTCTGTCCTGG - Intergenic
1128711051 15:69872281-69872303 ATCCTGGCCCCTGCATGCCCTGG + Intergenic
1129605779 15:77024345-77024367 TCCTTGGCCTCTGCTTCCCCAGG + Intronic
1130320411 15:82836499-82836521 TCCCTGCACCCTTCATGTCCTGG + Intergenic
1130909639 15:88262272-88262294 TCCCTGGCCTCTGAGTGTCCTGG + Intergenic
1132146975 15:99434934-99434956 CCCCTGGTCCCTGCAGGTCCGGG - Intergenic
1132556432 16:574773-574795 TCTTTGCCACCTGCCTGTCCCGG - Intronic
1132694588 16:1196188-1196210 TCCGTGGGCCTTGCATGTCAGGG + Intronic
1133223570 16:4329342-4329364 CCCCTGGCCCATGCATGGCCTGG + Intronic
1133245061 16:4443170-4443192 TGCTTGGGCCCGCCATGTCCAGG + Intronic
1134657908 16:15961093-15961115 ACCTTGGCCCTTCCATGTGCTGG + Intronic
1135241318 16:20808850-20808872 ACCTTGGCCTCTGCAAGTTCTGG + Intronic
1136029149 16:27490093-27490115 ACCTTGGCCCCAGCATCTCCCGG - Intronic
1136153372 16:28366296-28366318 CCCTCTTCCCCTGCATGTCCAGG - Intergenic
1136209714 16:28748971-28748993 CCCTCTTCCCCTGCATGTCCAGG + Intergenic
1136309401 16:29397627-29397649 TCCACCGCCCCCGCATGTCCTGG + Intronic
1137813029 16:51371111-51371133 GCCTTGGCCTCTGCAAGTGCTGG - Intergenic
1139043095 16:63023552-63023574 TGCTTGGCTGCTGCATGTCTGGG + Intergenic
1139652235 16:68368258-68368280 CCCCTGGCCCCTGCTTGTCTTGG - Intronic
1141238454 16:82242464-82242486 TCTTTGGCCTCTGAATGTACTGG - Intergenic
1141634207 16:85305082-85305104 TCCTGGGCCGCAGCTTGTCCTGG + Intergenic
1141870292 16:86780660-86780682 TCCTTGGCCTCTGAAAGTGCTGG - Intergenic
1141898864 16:86977170-86977192 CAGTTGGCCCCTTCATGTCCTGG - Intergenic
1144452225 17:15390622-15390644 TCCCTGGACCCTGCTTGGCCTGG - Intergenic
1145002707 17:19316517-19316539 TCTGTGGCCCTGGCATGTCCTGG + Intronic
1145207955 17:20994676-20994698 TCGTTGGCCCATTCATGTGCAGG - Intergenic
1145737346 17:27242140-27242162 ACCTTGGCCCCTGAAAGTGCTGG - Intergenic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1146091053 17:29878176-29878198 TCCTTGGCCTCTGAAAGTGCTGG - Intronic
1147362303 17:39938734-39938756 TCCTTGGCCTCTGAAAGTGCTGG - Intergenic
1147732811 17:42614439-42614461 TCCTCTACCCCTGCAGGTCCAGG - Intronic
1147740068 17:42666266-42666288 TCCTCTACCCCTGCAGGTCCAGG - Intronic
1148045709 17:44742938-44742960 TCCTTGGCCCCAGGAACTCCAGG - Intronic
1148543652 17:48500520-48500542 TCCTTAGAGCCTGCATGGCCAGG + Intergenic
1148740020 17:49887493-49887515 TCCTTGGACCCTGCTGGCCCTGG - Intergenic
1149375328 17:56038259-56038281 TCCCTGTCCTCTGCAGGTCCTGG + Intergenic
1149942011 17:60880535-60880557 TCCTTGGCCTCCGAAAGTCCTGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150341717 17:64373916-64373938 TCCTAGAGCCCTGTATGTCCTGG + Intronic
1150775172 17:68075536-68075558 ACCTTGGCCTCTGCAAGTGCTGG - Intergenic
1151410649 17:73925366-73925388 TGCTTGGCCCCAGGATGTCAAGG + Intergenic
1151563345 17:74882802-74882824 TCCTCAAACCCTGCATGTCCAGG + Intronic
1151807730 17:76416997-76417019 TCTGTGGCCCCTGCAGGACCTGG - Intronic
1152144718 17:78561375-78561397 TCCCCGGCCCCTGGCTGTCCAGG + Intronic
1152184711 17:78847732-78847754 TCCTTGGCCCCTCAAAGTGCTGG + Intergenic
1152464231 17:80456747-80456769 TCCTTGGCGCCTGCAGAGCCGGG + Intergenic
1152576568 17:81143797-81143819 ACCTTGGGCCCTGCCTGCCCGGG + Intronic
1152749502 17:82056152-82056174 TGCTTCGGCCTTGCATGTCCTGG + Intronic
1153085203 18:1278329-1278351 TTCCTGGCCCCAGCAGGTCCTGG + Intergenic
1153944482 18:10007130-10007152 TCCTTGGCACCTGCCTGTCTGGG - Intergenic
1154002553 18:10494702-10494724 TCCTTTGCCCCTTCAGGTCTTGG + Intergenic
1154111488 18:11572152-11572174 TCCTGAGCCCCTGCATATTCTGG - Intergenic
1156478771 18:37423250-37423272 TCCTTGGCTCATCCACGTCCAGG + Intronic
1157582619 18:48782308-48782330 TCCAGGGCCCCTGCCTGGCCTGG + Intronic
1158531380 18:58265412-58265434 TCCTTGTCCTCAGCATGGCCTGG - Intronic
1159581248 18:70236601-70236623 TCCCTGACCCCTGCACTTCCCGG - Intergenic
1161226461 19:3148784-3148806 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161226469 19:3148801-3148823 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161272293 19:3396704-3396726 ACCTTGGCCTCTGCAAGTGCTGG - Intronic
1161903119 19:7134515-7134537 GCCTTGGCCCCTGAAAGTGCTGG - Intronic
1163337448 19:16682534-16682556 TCCATGCCTCCTGTATGTCCGGG + Intronic
1163664197 19:18595344-18595366 TCCTGGGCCCCTCCAGGTTCAGG - Intronic
1163819252 19:19486854-19486876 TCCATGGCTCCTGCATGGCAGGG - Intronic
1164679070 19:30121961-30121983 TCCTTGGCCCTGCCTTGTCCAGG + Intergenic
1164928693 19:32154158-32154180 ACCTTGGCCTCTGCAAGTGCTGG + Intergenic
1165422299 19:35728220-35728242 AGCGTGGCCCCTGCATGCCCTGG - Intronic
1165475448 19:36027571-36027593 ACCTTGGAGTCTGCATGTCCAGG + Intronic
1166516756 19:43452936-43452958 TCCTTGGCCTCTGAAAGTTCTGG - Intergenic
1167254586 19:48419569-48419591 TCCTGGCCCCCTGCAGGCCCTGG + Exonic
1167384056 19:49153820-49153842 TCCTTGACCACTGTGTGTCCTGG + Exonic
1167561491 19:50228638-50228660 TCCATGGTACCTGCATATCCAGG + Intronic
1168110256 19:54188340-54188362 TCCCTTCCCCCTGCAGGTCCTGG - Exonic
926215958 2:10905523-10905545 TGCCTAGCACCTGCATGTCCAGG + Intergenic
928081432 2:28315969-28315991 TCTTTGCCGCCTCCATGTCCAGG + Intronic
931267561 2:60674057-60674079 TCCTTGGCCTCTGAAAGTGCTGG - Intergenic
932593984 2:73083015-73083037 TCCTTGGCTCCTGCCTGTCCAGG + Intronic
933721219 2:85398776-85398798 GCCCTGGCCCCTGCAGGTCCTGG - Exonic
933729428 2:85445956-85445978 TCCTCAGCCCCTCCATTTCCAGG - Intergenic
934950157 2:98570596-98570618 CCCATGGCCCCTGCAGCTCCAGG - Intronic
935649191 2:105367533-105367555 CCCTTGGCCCTTGCACGTTCTGG - Intronic
936113706 2:109685588-109685610 CCCTTGCCCCCTGCACGGCCTGG + Intergenic
936368625 2:111883987-111884009 TCCTCGGCCCCTGCGCCTCCGGG - Exonic
936514554 2:113173706-113173728 TCCCAGGCCCCTGCATGGCAGGG + Intronic
937407622 2:121645113-121645135 TCCATGGCCCCTGCACTTCAGGG - Intronic
937997850 2:127708628-127708650 CCATCGGCCCCTGCATCTCCTGG + Intronic
939966288 2:148613550-148613572 GCCTTGGCCTCTGAATGTGCCGG - Intergenic
940879144 2:158929119-158929141 TCATGGGCCCCTGGATTTCCAGG + Intergenic
942075586 2:172354513-172354535 TCCCTGTCCCCCGCCTGTCCTGG + Intergenic
945405732 2:209446570-209446592 TCCTTGGCTCATTCATGTCTAGG - Intronic
945470430 2:210222785-210222807 TCAAGGTCCCCTGCATGTCCTGG - Intronic
947736070 2:232456193-232456215 CCCAGGGCCCCTGCATGTCTTGG - Exonic
948107513 2:235427444-235427466 TCCTTGGCCCCCGCCTGTGAGGG - Intergenic
948393272 2:237627425-237627447 TCCCTGGCCCCTGCAGTCCCTGG + Intergenic
948535714 2:238645021-238645043 TTCTTGGACTCTGCCTGTCCCGG - Intergenic
948536850 2:238652974-238652996 TTCGTGGTCCCTGCAGGTCCCGG + Intergenic
948567339 2:238895521-238895543 TACCTGGGCCCTGCAAGTCCAGG - Intronic
948922017 2:241070271-241070293 TCCCAGGCCCCTGCAGGGCCAGG - Intronic
1171300947 20:24059781-24059803 TCCTTGGCCCCTGCCTTCTCAGG - Intergenic
1172168822 20:32916506-32916528 TCCTTGGCCCCTCAAAGTGCTGG + Intronic
1172997837 20:39083888-39083910 CCCTTGGCCCCTGGCTGGCCTGG + Intergenic
1173580322 20:44142508-44142530 TCCCTGGCCCCTCCCTCTCCCGG + Intronic
1174190528 20:48737378-48737400 TCCTTCTCCCCTGAATCTCCTGG + Intronic
1174854394 20:54029130-54029152 TCCTTGGACCCTGCTTTTCTTGG + Intronic
1175115702 20:56680234-56680256 GCCCTGGTCCCTGCATGTCTCGG - Intergenic
1176360465 21:5992052-5992074 TGCTTGGCCCCAGCAGGTCAAGG - Intergenic
1176866301 21:14056731-14056753 GCCTTGGCCCATCCCTGTCCTGG - Intergenic
1177016307 21:15792850-15792872 TCCTTAGCATCTTCATGTCCTGG - Intronic
1178335359 21:31737655-31737677 TCCTTGGCCTCTCAATGTACTGG + Intergenic
1179154361 21:38836947-38836969 TCCTTTGCTCCTGCTTCTCCAGG + Intergenic
1179570661 21:42276879-42276901 TCCTTGTCCCCTGCAGGTGTCGG + Exonic
1179763053 21:43546498-43546520 TGCTTGGCCCCAGCAGGTCAAGG + Intronic
1179793753 21:43770496-43770518 TCCTGGGCTCCTGCACGTTCTGG + Intergenic
1179921066 21:44507866-44507888 TCCGTGGCCCCTGCGTGGCCTGG - Intronic
1180461534 22:15570008-15570030 TCCTTGGCCTCTCAATGTGCTGG + Intergenic
1181045416 22:20211910-20211932 TGCTCGGCCCCTGCCTGTCTGGG + Intergenic
1181422938 22:22814335-22814357 TACTTGGCCCCTGCCTACCCTGG + Intronic
1181627031 22:24129183-24129205 TCCATGGGCCCTGCATGTAGTGG - Intronic
1181830339 22:25555473-25555495 TCCTTGGCCCCTGGAGGGCCTGG + Intergenic
1181862685 22:25831342-25831364 TCCTTGTCCACAGCATTTCCTGG + Intronic
1182244541 22:28945440-28945462 TCCTTGGCCTCTCCAAGTGCTGG - Intronic
1182591096 22:31380644-31380666 ACCTTGGCCCCTCCAAGTGCTGG + Intergenic
1183410332 22:37651281-37651303 ACCTTGGCCCCTGAAAGTGCTGG + Intronic
1184127213 22:42496054-42496076 TCCTTGGCCCCTCAAAGTACTGG - Intergenic
1184239194 22:43202990-43203012 TGCTGGGCCCCTGCACCTCCTGG + Exonic
1184472425 22:44703155-44703177 TCCCAGGCCCCTGCTTGTCTGGG - Intronic
1184656064 22:45942580-45942602 ACCTTGGCCCCGGCTGGTCCAGG - Intronic
1184879052 22:47293531-47293553 TCCCTGTCCCCTTCATCTCCGGG + Intergenic
1184973038 22:48041082-48041104 ACCTTGGCCCCTCAATGTGCTGG + Intergenic
1184974177 22:48049281-48049303 TCCTTGCCCCCTGGACGTCCCGG - Intergenic
949683345 3:6540949-6540971 TCCCTGACCCCTGTATATCCTGG - Intergenic
952795137 3:37232657-37232679 TCCTTGGCCTCTCAATGTGCTGG + Intergenic
953328677 3:42034103-42034125 TCCTTGCCCCATCCATGTTCTGG + Intronic
953368868 3:42370335-42370357 CCCTTGGCCAGGGCATGTCCTGG - Intergenic
953758301 3:45666425-45666447 TGCTTGGTCCCAGCATGTGCAGG + Intronic
954225971 3:49181399-49181421 TCCTTGGCCTCTCAAAGTCCTGG - Intronic
954371731 3:50172509-50172531 GCCTTGGCCCCTCCAACTCCAGG - Intronic
956762953 3:72459604-72459626 TTCATGGCCCCTTCAAGTCCAGG - Intergenic
959289576 3:104456763-104456785 ACTTTGGCCTCTGCATGTCAAGG - Intergenic
961525740 3:127496315-127496337 TGCTTGGCCTCTGCCTCTCCTGG + Intergenic
962239887 3:133743458-133743480 TCCTTGGCCCCTGCATGTCCTGG + Intergenic
962384817 3:134923990-134924012 TCCTAGTCCCCTGCATTCCCAGG - Intronic
964008750 3:151863724-151863746 TTCTTTGTCCCTGTATGTCCAGG - Intergenic
967448818 3:189598750-189598772 TCCTTTGACCTTGCATATCCTGG - Intergenic
968711766 4:2124702-2124724 TCCCTGGGCCCTGCCTGTCCCGG - Intronic
968833103 4:2943286-2943308 TGCTAAGCGCCTGCATGTCCAGG - Intronic
968844900 4:3035536-3035558 TCCTAGGGCCCTGCTCGTCCTGG - Intronic
968960357 4:3740145-3740167 TCCTTGGGCCCTCCAGGACCTGG + Intergenic
969137339 4:5040639-5040661 TCCTTGGCCTCTGAAAGTGCTGG + Intergenic
969243549 4:5917881-5917903 GCCTGGGCCCCTGCTTGGCCTGG - Intronic
969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG + Intronic
969718468 4:8879941-8879963 TCCTTGGCTCCTGCAGCCCCCGG + Intergenic
972675627 4:41257272-41257294 TCCTGGGCCCCTGCATTTAGCGG + Intronic
974073295 4:57145381-57145403 TCCTTGGCCCCCCAATGTGCTGG + Intergenic
975524180 4:75331182-75331204 TCCCTGACCCCTGCACTTCCCGG - Intergenic
977191734 4:94009423-94009445 TCCTTTGCCCCTGCAGGGCAAGG - Intergenic
980902017 4:138914100-138914122 TCCTTGGCCCCTGAAAGTGCTGG - Intergenic
982087780 4:151853896-151853918 CCCTTGGCCCCATCAGGTCCAGG - Intergenic
985235462 4:187868668-187868690 TCCTTGGCCCCTCAAAGTGCTGG + Intergenic
985702591 5:1382516-1382538 TCCCAGGCCTCTGCATGACCGGG - Intergenic
991449730 5:66739337-66739359 TCCTTGACCTCTGTATTTCCTGG + Intronic
992798298 5:80272736-80272758 ACCTTGGCCTCTGAATGTGCTGG - Intergenic
995042807 5:107608545-107608567 CCTTTGTCCCCTGCATGTCATGG + Intronic
997241628 5:132312228-132312250 TCCTCGGCTCCTTCGTGTCCGGG + Exonic
997603664 5:135157274-135157296 GCCTTTGTTCCTGCATGTCCAGG - Intronic
997647822 5:135492578-135492600 TACTTGGTACCTGTATGTCCTGG + Intergenic
998424239 5:142013174-142013196 TCCCTGGCCCCGGCAGGCCCTGG + Intergenic
999323175 5:150627074-150627096 TCCAGGGCCCCTGCCTGGCCTGG + Intronic
999552344 5:152703041-152703063 TCCTTCTCCTCTGCATGCCCTGG - Intergenic
999716169 5:154362044-154362066 TCTTTTGCCACAGCATGTCCAGG + Intronic
1000065167 5:157687914-157687936 GCCTTGGCCTCTGAATGTGCTGG - Intergenic
1001402270 5:171452501-171452523 TCCCCAGCCCCTGCATGTTCAGG + Intronic
1001596480 5:172902105-172902127 TCCCTGGCCCCAGCATTTCAGGG + Intronic
1003362425 6:5440994-5441016 TCCTTGCAACCTGCATCTCCCGG + Intronic
1004135865 6:12965979-12966001 TCCTTGCCACCGCCATGTCCGGG - Intronic
1006036874 6:31220834-31220856 TCCTTGGCCTCTGAAAGTGCTGG + Intergenic
1006815782 6:36848916-36848938 TCCTTGGCACCTGCCTCCCCTGG + Intergenic
1006963075 6:37953699-37953721 TCCTTGACCCCACAATGTCCTGG + Intronic
1007471285 6:42092191-42092213 TTCTGAGCCCCTGCATGCCCAGG - Intergenic
1014384622 6:120785727-120785749 TCCTGGGCCCCTGAAAGTGCAGG - Intergenic
1016912787 6:149215480-149215502 TACTGAGCCCCTACATGTCCAGG + Intergenic
1017510726 6:155112494-155112516 TCCTTGACCCCTTAATGTCAAGG + Intronic
1017672148 6:156778398-156778420 TCCTTGGCGCCTCCATGTTGCGG - Exonic
1018329551 6:162712486-162712508 TCCTTTGCCCCTGAATCTCACGG - Intronic
1018711604 6:166501419-166501441 GCCTTGGCCCCCGCTTGTGCAGG - Intronic
1018921500 6:168179157-168179179 TCCTGGGCCCCTGCAGTACCTGG + Intergenic
1018976987 6:168573659-168573681 TCCGTGGCCCCTGCGTGCCCTGG + Intronic
1020124665 7:5526780-5526802 TGGTTGGCACCTGCATTTCCTGG - Intergenic
1021726955 7:23556649-23556671 TCCTTGGCCTCTGAAAGTGCTGG + Intergenic
1023706870 7:42950234-42950256 TCCTTGGGGCCTGACTGTCCAGG - Intergenic
1023838482 7:44082244-44082266 TCCTTGACGCCTGCAGGTGCGGG - Exonic
1025093672 7:56082046-56082068 CCCTGGGCCCTCGCATGTCCAGG - Exonic
1027859379 7:83556508-83556530 TCCCTGGCCCCTCAATGTCTAGG - Intronic
1028774000 7:94657985-94658007 TCCTTAGCGCCTGCCTGCCCAGG + Intronic
1031122739 7:117739805-117739827 TCCTTGGGCCCTGCATTCCTGGG - Intronic
1033163920 7:139022292-139022314 GCCTTGGCCTCTGAATGTGCTGG - Intergenic
1033627832 7:143128303-143128325 CCCTTGGCCCCTACATCACCAGG + Intergenic
1034219995 7:149436656-149436678 TCTCTGGCTCCTGCATGTCCAGG + Exonic
1034337345 7:150332102-150332124 ACCCTTGCCCCTGCTTGTCCTGG + Exonic
1034937883 7:155211441-155211463 TCCTTGGCCTTTGCAGGTCATGG - Intergenic
1036657777 8:10688876-10688898 TCTGTGGCTCCTGCCTGTCCCGG - Intronic
1037369397 8:18158741-18158763 ACCTTGGCCCCTGAAAGTGCTGG - Intergenic
1038049419 8:23795055-23795077 TCCTTGGCCTCTGAAAGTGCTGG + Intergenic
1039190184 8:34964797-34964819 TCTCTGGCCCCTGCACCTCCTGG + Intergenic
1039908617 8:41806463-41806485 TCCTTGGCCTCTGAAAGTGCTGG - Intronic
1042625002 8:70748313-70748335 TCCTGGGCCCCTGCGAGTGCAGG - Intronic
1043075464 8:75693337-75693359 TCCTTGGCCCCTCAAAGTGCTGG - Intergenic
1046676117 8:117110558-117110580 TCATGTGCCCCTGCATGCCCTGG - Intronic
1046949856 8:120009361-120009383 GCCTTGGCCTCTGAATGTGCTGG - Intronic
1047140042 8:122128083-122128105 TTCCTGGCCCCTGGATGTACTGG - Intergenic
1047959599 8:130001301-130001323 TCCTTGCTCCCTGGACGTCCAGG + Intronic
1050381968 9:5040925-5040947 TCCTTGGCTCCGCCATGGCCAGG - Intronic
1051511001 9:17877856-17877878 TCCTTGGAGCCTGACTGTCCTGG - Intergenic
1053101712 9:35376933-35376955 TCCTTCACCCCTGCTTTTCCTGG - Intronic
1053286041 9:36850134-36850156 AACGTGGCCCCTGCATGGCCAGG + Intronic
1056882516 9:90410771-90410793 TCCTTGGCCCCTCAAAGTGCTGG - Intergenic
1057082987 9:92186796-92186818 TACTGGGCAGCTGCATGTCCCGG + Intergenic
1057305243 9:93908492-93908514 TCCTTGGCCTCTGCATATGTGGG - Intergenic
1059157776 9:112005162-112005184 GCCTTGGCCCCTGAAAGTGCTGG - Intergenic
1060143181 9:121227921-121227943 TTCCTGGCCCCGGGATGTCCAGG - Intronic
1060163326 9:121387374-121387396 TCCTTGGCCCCTCAAAGTGCTGG - Intergenic
1060184887 9:121558289-121558311 TCTGTGGCCCCTGCTTGCCCTGG + Intergenic
1060463021 9:123876477-123876499 CCCTTCACCCCTGCATATCCAGG - Intronic
1061012125 9:127961891-127961913 TCCCTGGCCCATGCCTGCCCCGG - Intronic
1061041975 9:128145604-128145626 TCCTTGGTCACGGCAGGTCCGGG - Intergenic
1061410069 9:130415769-130415791 TCCGTGGCTCCTTCATTTCCAGG + Intronic
1061502469 9:131011801-131011823 TCCTTGGCCCCTGGGTTCCCAGG - Intronic
1061660475 9:132126857-132126879 TCCTCTGCCCCTGGCTGTCCTGG + Intergenic
1061680159 9:132239000-132239022 TCCTCCGTCCCTGCATGACCTGG + Intronic
1062005372 9:134236094-134236116 CCCAGGGCCCCAGCATGTCCTGG - Intergenic
1203777392 EBV:81474-81496 CCCTTGCCCCCTGTATCTCCAGG + Intergenic
1186140202 X:6563883-6563905 TCCTTGGCTCTTGACTGTCCTGG - Intergenic
1186342840 X:8661731-8661753 TCCTTGCCCCCTGATGGTCCTGG + Intronic
1187916370 X:24156144-24156166 TCCTTGGCCTCTGAAAGTGCTGG + Intronic
1189822683 X:44885619-44885641 GCCTTGGCCCCTGAAAGTGCTGG - Intronic
1192265397 X:69534029-69534051 TCCTGGGCCCCTACAAGTGCTGG + Intergenic
1197422815 X:126258919-126258941 TTCCTGGCCCCTGCAGCTCCTGG - Intergenic
1198713751 X:139533886-139533908 TCCATGGCCCTTAAATGTCCAGG - Intronic
1199950036 X:152699701-152699723 ACCTTGGGCCCTGCAGATCCTGG - Intronic
1199959638 X:152768760-152768782 ACCTTGGGCCCTGCAGATCCTGG + Intronic
1200376868 X:155791342-155791364 TCTTTGTCCCTTGCATTTCCAGG - Intergenic