ID: 962240201

View in Genome Browser
Species Human (GRCh38)
Location 3:133745818-133745840
Sequence GAGGGAGCAGCTCCTCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962240193_962240201 6 Left 962240193 3:133745789-133745811 CCAGGAGCCTGAGCTCAGCGGGG 0: 1
1: 0
2: 1
3: 43
4: 511
Right 962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 190
962240191_962240201 7 Left 962240191 3:133745788-133745810 CCCAGGAGCCTGAGCTCAGCGGG 0: 1
1: 0
2: 1
3: 24
4: 358
Right 962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 190
962240196_962240201 -1 Left 962240196 3:133745796-133745818 CCTGAGCTCAGCGGGGCAGGAAG 0: 1
1: 0
2: 10
3: 29
4: 301
Right 962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 190
962240189_962240201 11 Left 962240189 3:133745784-133745806 CCAGCCCAGGAGCCTGAGCTCAG 0: 1
1: 2
2: 4
3: 65
4: 541
Right 962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 21
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962240201 Original CRISPR GAGGGAGCAGCTCCTCCGTG GGG Intergenic
900169821 1:1261427-1261449 GAGGGGGCAGCCCCTGGGTGTGG - Intronic
900482508 1:2905911-2905933 GAGGGAGGAGCCCAGCCGTGCGG + Intergenic
900704579 1:4072268-4072290 GAGGGAGCAGCTGCTGTCTGGGG + Intergenic
901402042 1:9021341-9021363 GAGGGAGCACCTCCACCTGGAGG - Intronic
901532693 1:9863532-9863554 GCTGGAGCAGCTCCTCCTTGGGG - Intronic
901847945 1:11996403-11996425 GAGGGGGCAGCACCACCCTGTGG + Intronic
901873576 1:12152972-12152994 GGGGCAGCAGCTGCTCCGTCTGG + Intergenic
902702740 1:18183772-18183794 GAGGGAGCAGCAGCTCCCTCGGG + Intronic
904263381 1:29303943-29303965 CAGGGTGCAGCTGCCCCGTGTGG - Exonic
904264501 1:29310625-29310647 GAGGGAGCAGTTCCCTGGTGGGG + Intronic
904567056 1:31434416-31434438 GAAGAGGCAGCTCCACCGTGTGG - Exonic
904807335 1:33141176-33141198 GGGGCTGCAGCTCCTCCGAGAGG - Intergenic
905901068 1:41582273-41582295 GAGTGAGCAGAGCGTCCGTGTGG + Exonic
906214515 1:44031002-44031024 GTGGGGGGAGCTCCTGCGTGGGG - Intronic
906294695 1:44642396-44642418 TAGAGAGCAGCTGCTCTGTGTGG + Intronic
915895751 1:159809463-159809485 CATGGTGCAGCTCCTCTGTGAGG + Exonic
917429475 1:174951085-174951107 GAGGGAGAAGCACCTCAGTGAGG - Intronic
919917412 1:202147281-202147303 GAAGGAGCAGCTCCTCCATAAGG + Exonic
921584498 1:216931412-216931434 GAAGGAGCAGTTTCTCAGTGTGG - Intronic
922025084 1:221742361-221742383 TAGAGAGCAGCTGCTCCGCGCGG - Intergenic
924789513 1:247231816-247231838 GAGGGAGGAGCTCCACCATCAGG - Intergenic
1062934593 10:1376528-1376550 GAAGGAGAAGCTCCTACGTGGGG + Intronic
1063418258 10:5890377-5890399 GTGGGAGGGGCTCCGCCGTGTGG + Intronic
1063476103 10:6330378-6330400 GAGGGAGCAGCTGCTCAGGCGGG + Intergenic
1065102008 10:22340727-22340749 GGGGCAGCCGCTCCTCCGGGAGG + Intergenic
1067750837 10:48969944-48969966 GGAGGAGGAGCTCCTGCGTGGGG + Intronic
1070262151 10:74867762-74867784 CAGTGAGCAGCTGCTCCATGTGG + Intronic
1073585991 10:104710620-104710642 GAGGGAACAGCACATCCATGAGG + Intronic
1076182200 10:128418995-128419017 GAGGGAGCAGGTTGTCAGTGTGG + Intergenic
1076276550 10:129204341-129204363 GAGGGCTCAGGTCCTCCTTGGGG - Intergenic
1076631773 10:131856072-131856094 GAGGGAGGAGCCACTCCCTGGGG - Intergenic
1076706495 10:132304871-132304893 CAGGAAGTAGCTCCTCCCTGAGG - Intronic
1076761418 10:132607772-132607794 GCGGGTGGAGCTCCTCCATGCGG + Intronic
1076900289 10:133334646-133334668 GAGGTGGCAGCTTCTGCGTGGGG + Intronic
1076990144 11:268428-268450 GAGGGGGCAGGTCCGCGGTGGGG - Intergenic
1077182290 11:1222234-1222256 GAGGAAGCAGCTGCTCCGGGGGG - Intergenic
1077320593 11:1939167-1939189 GCGGGAGCGGCTCCTGCGTGAGG + Intergenic
1081485924 11:43528854-43528876 GAGGCAGCAACTCCTCTGGGAGG + Intergenic
1084557746 11:69884947-69884969 GAGGGGGCAGCTGGTCCCTGCGG - Intergenic
1085385711 11:76157084-76157106 GGGTGAGCACCTCATCCGTGGGG + Intergenic
1088696157 11:112367617-112367639 GAGGGAGCAGCTTCTGAGAGAGG + Intergenic
1089667803 11:120031440-120031462 GGGGGAGTAGCTCCTCCCTAGGG + Intergenic
1090472764 11:126995181-126995203 GTGGGAGCAGCTGCTCTGGGGGG - Intronic
1091141581 11:133239670-133239692 GAAGGAGTTTCTCCTCCGTGGGG - Intronic
1091756606 12:3056508-3056530 GAGGGAGCAGCCCCAGCCTGTGG + Intergenic
1096518146 12:52169736-52169758 AAGGGAGCAAATCCTCAGTGGGG - Exonic
1096535606 12:52270785-52270807 GTGTGAGCAGCTCCTTGGTGGGG + Intronic
1096717480 12:53499913-53499935 GAGAGAGCAGCCCCTCAGTTGGG + Intronic
1097234052 12:57527930-57527952 GGGGCTGCAGCTCCTCCCTGGGG + Exonic
1100682775 12:96947317-96947339 AAGGGAGCAGTTCTTCTGTGGGG + Intronic
1103855340 12:123965026-123965048 GACCCAGCAGCTCATCCGTGGGG - Intronic
1104581834 12:130016410-130016432 GAAGGAGCAGCCACTCCCTGGGG - Intergenic
1104898704 12:132176453-132176475 GCAGGAGCAGCTCCTCCAGGAGG - Intergenic
1105217136 13:18294557-18294579 TAGAGAGCAGCATCTCCGTGGGG - Intergenic
1105446356 13:20460985-20461007 GAGGGAGGATCCCCACCGTGAGG - Intronic
1105502831 13:20988141-20988163 CATGGAGCAGAGCCTCCGTGCGG - Exonic
1106519009 13:30480648-30480670 AAGGGAGCAGGTCCTCACTGAGG - Intronic
1113789816 13:113022356-113022378 GAGGGAGAAGCTGCTCCTTGGGG - Intronic
1113801674 13:113089885-113089907 GAGGGAGGGGCTCTTCTGTGGGG - Intronic
1114710934 14:24777539-24777561 GAGTGAGCAGGTCCTCAGTGAGG + Intergenic
1116593034 14:46804440-46804462 GAGGCAGCAGCTTCTCCATATGG + Intergenic
1116955152 14:50915869-50915891 GAGGGAGCAGCTTCTCCACCAGG + Exonic
1116955858 14:50922589-50922611 GAGGGAGCAAGTCCTCTTTGAGG - Intronic
1118693071 14:68359024-68359046 GTGGCAGCTGCTCCTCTGTGGGG - Intronic
1121419761 14:93804840-93804862 GAGCAAGCAGCGCCCCCGTGAGG - Intergenic
1122931365 14:104934111-104934133 GAGGGGACAGGTCCTGCGTGCGG + Exonic
1123168425 14:106348451-106348473 GAGGGAGAAGCAGCTCCCTGAGG - Intergenic
1127851011 15:62911710-62911732 GAAGGAGCACCTTCTCCGTTGGG + Intergenic
1128703746 15:69822861-69822883 GAGGGCGCAGGACCTCAGTGTGG + Intergenic
1131015900 15:89057681-89057703 GAGGGAGCAGCGCCACCCTGAGG - Intergenic
1131232173 15:90667232-90667254 GAGGGGGCAGCTGCCCCGTGGGG - Intergenic
1132149865 15:99451803-99451825 CTGGGAGCAGCCCCTCTGTGAGG - Intergenic
1132321130 15:100926448-100926470 GAGGGAGCAGCGCCTCCTGTGGG - Intronic
1132486863 16:197731-197753 GAGTGAGCAGCTCTTTCCTGGGG + Intronic
1132738042 16:1397183-1397205 GATGGAACTGCTGCTCCGTGCGG + Intronic
1133393313 16:5426674-5426696 GAGGGAACAGCTGCTTCTTGTGG + Intergenic
1134231763 16:12435411-12435433 AAGGGAGCAGCTCCTCCTTAGGG + Intronic
1136711489 16:32240583-32240605 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136756421 16:32688822-32688844 GCGGGAGCTGCTGCTCCGCGAGG + Intergenic
1136811690 16:33181551-33181573 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136818166 16:33291631-33291653 GCGGGAGCTGCTGCTCCGGGAGG - Intronic
1136824730 16:33348160-33348182 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136829796 16:33446931-33446953 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1138590061 16:57994961-57994983 GAAGGACCAGCCCCTCCCTGTGG + Exonic
1139612068 16:68066506-68066528 GAGGCAGCAGCTGCTCCTTCTGG + Intronic
1140221733 16:73048524-73048546 GAGGGGTCAGCGCCTCCGGGAGG - Intronic
1141495482 16:84406764-84406786 GAGGGAGGAGCTCCCCTCTGCGG + Intronic
1202990268 16_KI270728v1_random:4520-4542 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1203058565 16_KI270728v1_random:949176-949198 GCGGGAGCTGCTGCTCCGGGAGG + Intergenic
1142904639 17:3033754-3033776 GTGGGAGCAGAGCCTCGGTGAGG + Exonic
1143402010 17:6652075-6652097 GAGGGAGCCGCTTCCCCGAGGGG - Exonic
1143732076 17:8886979-8887001 GAGGGCCCAGGTCCTCCATGGGG + Intronic
1147121568 17:38338160-38338182 AAGGAAGCTGCTCCTCCGTGGGG - Intronic
1148749976 17:49940098-49940120 GAGGGGGCAGGGCCTCTGTGTGG + Intergenic
1148830124 17:50425897-50425919 GAGCCAGCAGCACATCCGTGAGG - Intergenic
1148862844 17:50613504-50613526 GTGGGAGCAGCTGCTCCGTTTGG + Intronic
1148984735 17:51611753-51611775 GAGGAAGCAGCTGCTCTCTGAGG + Intergenic
1149863302 17:60136392-60136414 GAGAGTACAGCTCCTCCCTGGGG - Intergenic
1151309660 17:73285571-73285593 GAGGGAGCTGCTGTCCCGTGTGG + Exonic
1152031406 17:77845695-77845717 GTGGGGGCAGCTCCTCTCTGGGG + Intergenic
1152915989 17:83036263-83036285 AAGGGAGCAGCTGCTGGGTGGGG + Intronic
1153919027 18:9772216-9772238 GAGGGTGCATCTTCTCGGTGGGG - Intronic
1160436673 18:78857203-78857225 GAGGAGGCAGCTCCTCAGTGTGG + Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160863138 19:1245972-1245994 GAGTGAGCAGCTCCTCCCGCTGG - Intergenic
1160898305 19:1413218-1413240 GAGCCAGCAGCTCCTCCTTTTGG + Intronic
1160970455 19:1765590-1765612 CAGGGAGCAGCTGCTGCGTGAGG - Intronic
1162080053 19:8212358-8212380 GAGGGAGCAGCTGCTCATGGGGG + Intronic
1162493726 19:11011021-11011043 GAGGTAGCAGGTCCTGTGTGAGG + Intronic
1163284149 19:16335741-16335763 GAGGGACCAGCTCCTCCTGTGGG - Intergenic
1163648418 19:18503253-18503275 GAGGGAGCACCCCCACCCTGGGG + Intronic
1166853963 19:45773212-45773234 AAGGGGACAGCTCCTCCCTGGGG + Intronic
1167172129 19:47840131-47840153 GAGGGAGGAGCCTCTCCCTGTGG - Exonic
1168617463 19:57850133-57850155 GAGGGAGCGGCTCCTGCTCGTGG + Intronic
925847168 2:8044444-8044466 CAGGGAGCTGCTCCTCCATGGGG - Intergenic
926058874 2:9792860-9792882 GAGGAAGCAGGTCCGCAGTGCGG - Intergenic
926245024 2:11116735-11116757 GAGTGAGCACCTGCTCCTTGTGG - Intergenic
927644993 2:24872015-24872037 GAGGGAGGAGCTCCCCTGAGTGG + Intronic
927943133 2:27118432-27118454 GAGGGACCAGCTCCCGGGTGTGG - Intronic
929532468 2:42761669-42761691 GACTGAGCAGCTCCTTCGGGTGG - Intergenic
929549444 2:42880157-42880179 CAGGGAGCAGGTCCTCCTGGGGG + Intergenic
929796009 2:45058801-45058823 CAGGGGGCAACTCCTCAGTGGGG - Intergenic
931401812 2:61938238-61938260 CAGGAAGCTGCTCCTCCGTGGGG - Intronic
935710382 2:105893208-105893230 GGGCGGGCAGCTCCACCGTGGGG - Exonic
939956872 2:148534562-148534584 GGGGGAGCTGCTTCTCCGTCAGG - Intergenic
942277576 2:174334313-174334335 GAAGGGACAGCTCCTCCGAGAGG - Intergenic
944809891 2:203317606-203317628 CTGGGAGCAGCTCCTCTGGGTGG - Intergenic
945019652 2:205557969-205557991 GAGGAAGCAGCACCTGCATGGGG + Intronic
948120336 2:235524586-235524608 GAGGGAGCAACTCATCCATGTGG - Intronic
948174875 2:235935276-235935298 GAGGGATCCAATCCTCCGTGCGG - Intronic
948607932 2:239147660-239147682 GTGGGAGCAACTCTTCCATGAGG - Intronic
1169367312 20:5001617-5001639 CAGGGAGCAGCCCCTCCCCGGGG - Intronic
1169425985 20:5497770-5497792 GAGGGAGCAGCCCCGCCTGGAGG + Intergenic
1169660644 20:7974941-7974963 GAGAGAGCAGCTGCTCCCTTAGG - Intergenic
1172020634 20:31911376-31911398 GAGGGAGCAGCCCTTTCCTGTGG + Intronic
1175818557 20:61896286-61896308 GAGGGAGACGCTCCTCCCGGTGG + Intronic
1175888904 20:62307431-62307453 CAGGGAGCAGCTCCTCCTCCAGG + Exonic
1176219321 20:63962572-63962594 GGGGGGGCAGCTCACCCGTGCGG + Exonic
1178351505 21:31875056-31875078 GGGGGACCAGCTCCTTTGTGTGG + Intronic
1181634282 22:24167133-24167155 GGGAGAGCGGCTCCTCCGGGTGG - Exonic
1182104405 22:27679076-27679098 GAGAGGGCAGCTCCTGGGTGGGG - Intergenic
1184521431 22:44996511-44996533 GAGGGAGCAGCCCTTTCATGGGG - Intronic
1184773327 22:46610550-46610572 CAGGGAGCGGCTCCTAGGTGGGG - Intronic
1184803247 22:46775195-46775217 GGGGTGGCAGCTCCTCCGCGAGG + Intronic
950958218 3:17077870-17077892 GAGGTAGCTGCTCCTCTCTGTGG + Intronic
953263321 3:41361120-41361142 GAGGGGCCAACTCCTCCCTGAGG - Intronic
954115578 3:48465359-48465381 GAGGGAGCAGGGCCTGGGTGTGG + Intronic
954626351 3:52023986-52024008 GAGGAAGCATCCCCTCCCTGGGG - Intergenic
960880207 3:122336503-122336525 GAGGGAACAGCTCTTCCTTATGG + Intronic
960960614 3:123067747-123067769 GTAGGAGCAGCTCCTCCGCCGGG - Intronic
961458229 3:127034666-127034688 GAGGGAGCAGAGCCTCTCTGGGG - Exonic
962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG + Intergenic
963567550 3:146948350-146948372 GAGGGAGGGGCTCCTGGGTGAGG + Intergenic
965652781 3:170951067-170951089 GAGGGAGCAGCAACTGTGTGTGG + Intergenic
965838141 3:172873722-172873744 TAGAGAGCAGATCCTCCCTGGGG + Intergenic
967042856 3:185709744-185709766 GAGGGAGGAGTTCCTCTTTGAGG - Intronic
968298799 3:197597825-197597847 AAGGGACTAGGTCCTCCGTGGGG - Intergenic
968810867 4:2799179-2799201 CTGGGAGCAGCTCCTCCGGTGGG - Intronic
968869197 4:3232949-3232971 CAGGGAGCCCCTCCTCAGTGAGG + Intronic
969584336 4:8083400-8083422 GAGGGAGCAGGCCACCCGTGAGG - Intronic
970430806 4:15987243-15987265 GAAGGAGCAGCTCCTGTCTGGGG - Intronic
972041710 4:34609111-34609133 GAGGCAGCAACTCCTCAGGGAGG + Intergenic
979440870 4:120748660-120748682 GAGGGAGCAGGTCCTCTTTTGGG - Intronic
980582585 4:134773492-134773514 GTGGGAGCAGCACCCCCCTGTGG - Intergenic
982485060 4:155956564-155956586 GAGGGAGCAGCTTATCTGGGTGG + Intergenic
985717396 5:1470311-1470333 CAGGGAGCAGCGACTCCCTGTGG + Intronic
986604993 5:9514015-9514037 GAGGGAGCAGGGCCTCGCTGAGG - Intronic
996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG + Intergenic
997998993 5:138609366-138609388 GCATGAGCAGCTCCTCCTTGAGG - Intergenic
998171447 5:139874136-139874158 GTGAGCGCAGCTCTTCCGTGTGG - Intronic
999859953 5:155634052-155634074 GAGGGAGTAGCTCCTCTCTGCGG - Intergenic
1001595839 5:172898287-172898309 GAGGGGGCAGCTCCCTCCTGAGG - Intronic
1003111065 6:3252627-3252649 AAGGGAGGAGCTGCTCAGTGTGG + Intronic
1003302651 6:4898269-4898291 GAGGTAGCAGCTATTCCCTGGGG + Intronic
1006271767 6:32970956-32970978 GATGGACCAGCCGCTCCGTGGGG + Exonic
1012817854 6:104046951-104046973 GAGGGAGCAGCAGCTCAGTAAGG + Intergenic
1014797129 6:125738471-125738493 GAAGGAGCAGCTGCTTCATGAGG + Intergenic
1018029324 6:159829824-159829846 GAGGAAGCAGCTTCTCTCTGAGG - Intergenic
1018031703 6:159846341-159846363 GAGAGGGCTGCTCCTCCGAGCGG - Intergenic
1018454759 6:163941779-163941801 GTGAGAGCCGCACCTCCGTGGGG - Intergenic
1019039740 6:169093978-169094000 GAGCCAGCAGCCCCTCCCTGGGG - Intergenic
1019275108 7:172137-172159 GAGGGCTCAGCTCCCGCGTGAGG + Intergenic
1019280317 7:196491-196513 GTGGGAGCAGCTGCTCCCCGGGG + Intronic
1019447620 7:1079646-1079668 GGGGCAGCAGCTCCTCTGAGGGG + Intronic
1019618879 7:1979866-1979888 AAGGGAGCAGGTCCTCCATCAGG - Intronic
1022827785 7:34034107-34034129 AAGGGAGTAGCACCTCAGTGAGG - Intronic
1023844289 7:44112351-44112373 GAGGGAGCAGCTGGACCCTGGGG + Intronic
1025712634 7:63926725-63926747 GAGGGAGGAGCTGGGCCGTGTGG + Intergenic
1029692042 7:102188960-102188982 GAGGGAGCAGCATCTCGGTCAGG + Intronic
1034345865 7:150384778-150384800 GAGGGAGGAGCTGCTCTGGGAGG + Intronic
1035203456 7:157280440-157280462 GGGGGAGCAGCTCCTCCCTCCGG - Intergenic
1036645456 8:10609294-10609316 GCAGGAGCAGCTCCCCGGTGAGG + Exonic
1041470050 8:58198244-58198266 GAGGGAGCAGCTGCACGATGCGG + Intronic
1044741168 8:95327893-95327915 GAGGGAGCAGCTCCTTTGGTGGG + Intergenic
1046739232 8:117811027-117811049 CAGGAAGCAGCTCCTCCCTTTGG - Intronic
1047349554 8:124060577-124060599 GAAGGTGCAGCTCCTCTCTGTGG + Exonic
1049200283 8:141336739-141336761 CATGGAGTAGCTCCTCTGTGGGG + Intergenic
1056708551 9:88971662-88971684 GAGGAAGCACCTCCTCACTGTGG + Intergenic
1057146064 9:92760287-92760309 GATGGAGCAGCTCGTCTTTGGGG - Intronic
1058644211 9:107115663-107115685 GAGGGACCAGTGCCTCCATGTGG - Intergenic
1059709589 9:116855322-116855344 GAGGGAGTAGCTCCTCAATCAGG - Intronic
1061224557 9:129273222-129273244 CAGGGAGCAGTTCCTCCGCTGGG + Intergenic
1062286671 9:135776158-135776180 GAGTTAGCAGCTTCTCTGTGGGG + Intronic
1062461605 9:136664728-136664750 GCAGGAGCTGCTCCTCCGGGTGG - Exonic
1194380333 X:93182118-93182140 GAGAGGGTAGCTCCTCCGTGTGG - Intergenic
1195093258 X:101483871-101483893 GAGGGAGGGGCTCCACTGTGAGG - Intronic
1195108097 X:101619536-101619558 GAGGGAGGGGCTCCCCAGTGAGG + Intergenic
1197792370 X:130268702-130268724 GAGGCAGCAGCTCTCCCGCGCGG - Intronic
1199435082 X:147804133-147804155 GAGATAGCAGCTCCCCCATGAGG + Intergenic
1199819724 X:151432753-151432775 AAGAGAGAAGCTCTTCCGTGTGG + Intergenic
1199844201 X:151679006-151679028 CAGGGAGGAGCTCCTCGATGAGG + Intergenic
1202191061 Y:22245380-22245402 GAGGGGGCAGCTCCTCTCTATGG - Intergenic