ID: 962240691

View in Genome Browser
Species Human (GRCh38)
Location 3:133748401-133748423
Sequence CTCTCCCCCAGGGCTGTGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 388}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962240686_962240691 -10 Left 962240686 3:133748388-133748410 CCACCTCTGGCCTCTCTCCCCCA 0: 1
1: 0
2: 8
3: 114
4: 1131
Right 962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG 0: 1
1: 0
2: 6
3: 49
4: 388
962240685_962240691 -6 Left 962240685 3:133748384-133748406 CCTTCCACCTCTGGCCTCTCTCC 0: 1
1: 0
2: 13
3: 129
4: 1072
Right 962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG 0: 1
1: 0
2: 6
3: 49
4: 388
962240684_962240691 -5 Left 962240684 3:133748383-133748405 CCCTTCCACCTCTGGCCTCTCTC 0: 1
1: 1
2: 10
3: 108
4: 717
Right 962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG 0: 1
1: 0
2: 6
3: 49
4: 388
962240681_962240691 15 Left 962240681 3:133748363-133748385 CCCTCAGCATAGGGAGTGGGCCC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG 0: 1
1: 0
2: 6
3: 49
4: 388
962240682_962240691 14 Left 962240682 3:133748364-133748386 CCTCAGCATAGGGAGTGGGCCCT 0: 1
1: 0
2: 2
3: 10
4: 190
Right 962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG 0: 1
1: 0
2: 6
3: 49
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962240691 Original CRISPR CTCTCCCCCAGGGCTGTGTC TGG Exonic
900117383 1:1034395-1034417 GGCACCCCCAGGGCTGTGACTGG + Intronic
900325700 1:2107787-2107809 ATTTCCCCCAGGGCAGTGTCGGG + Intronic
900325738 1:2107893-2107915 ATTCCCCCCAGGGCAGTGTCGGG + Intronic
900466728 1:2829235-2829257 CTCACCTCCCTGGCTGTGTCAGG - Intergenic
900487873 1:2932031-2932053 CTCTCCCTCAAGGCTGAGTGTGG + Intergenic
900565390 1:3329429-3329451 CTCTCCCTCCTGGCTCTGTCCGG - Intronic
900717883 1:4156842-4156864 CCCTACCCAAGGGCTCTGTCTGG + Intergenic
901228959 1:7631340-7631362 CACTGCCCCAGGGCTCTGTGGGG - Intronic
901325674 1:8363932-8363954 CTCCCCTCCAGGACTTTGTCTGG + Intronic
901628751 1:10638341-10638363 TGCTCCCCCAGGCCTGGGTCGGG - Exonic
901937385 1:12636178-12636200 CCCACCCCAGGGGCTGTGTCTGG - Intergenic
902331429 1:15732866-15732888 CTCACCCCCGGGGCTGAGGCAGG - Intronic
902897086 1:19486022-19486044 CGCTCCCCCAGTGCTGGGTTGGG - Intergenic
902984904 1:20149311-20149333 CTCTCTCCCTGGGCTGTGGATGG + Exonic
903213543 1:21831314-21831336 CTCACCTCCCAGGCTGTGTCCGG - Exonic
903767344 1:25743317-25743339 CGCTTCCCTAGGGCTGTGGCTGG - Intronic
904577273 1:31513070-31513092 CTCTCTCCCAGGTCACTGTCAGG + Intergenic
905224303 1:36469094-36469116 CTCTCTCCCAAGGCTCTGCCTGG - Intronic
905297167 1:36961544-36961566 GGCTCCCCCAGGGCTGTGCCTGG - Intronic
906071349 1:43018968-43018990 CTCTGCCCCAGGGCTTTCTTTGG - Intergenic
907243080 1:53091370-53091392 CTCTCCCCCGGGCCTCTGCCTGG + Intronic
907409080 1:54272288-54272310 CTGACCCCCAGGGCAGTGCCTGG + Intronic
907500019 1:54872095-54872117 CGCTCTCCCTGGGCTCTGTCGGG - Intronic
907579465 1:55558599-55558621 ATCTCAAGCAGGGCTGTGTCAGG - Intergenic
912498583 1:110106967-110106989 CCTTGCCACAGGGCTGTGTCTGG + Intergenic
912518573 1:110230582-110230604 CCCTCCCACAGGGCTGGGTCTGG + Intronic
912747100 1:112253998-112254020 CTCTTCCCCAGTCCTGTGTCTGG + Intergenic
913085756 1:115435086-115435108 CAAACCTCCAGGGCTGTGTCAGG + Intergenic
913115208 1:115690711-115690733 CTCAGGGCCAGGGCTGTGTCGGG - Intronic
916197934 1:162242429-162242451 CTCTCCAGCATGGCTATGTCAGG - Intronic
918112239 1:181466967-181466989 ATCTTCCCCTGTGCTGTGTCCGG - Intronic
919792296 1:201300064-201300086 CTATCTCCCAGGGCTGGGTGGGG - Intronic
922450928 1:225736649-225736671 CTCCCCACCAGGGCTGTAGCCGG - Intergenic
922706467 1:227793259-227793281 CTCCACCTCAGGGCTGTGCCAGG + Intergenic
923087143 1:230710429-230710451 CTCTCCCCAACGGCTGTCTTTGG - Exonic
924205463 1:241707198-241707220 CTATCCCCTAGGGCAGTGTTGGG + Intronic
1062943299 10:1439995-1440017 GTCTCCCCCAGGACTGAGGCAGG + Intronic
1069452716 10:68530029-68530051 GTCTACCCCACTGCTGTGTCCGG + Intergenic
1069616658 10:69810828-69810850 CCCACACCCAGGGCTGTGGCTGG - Intronic
1070354772 10:75629143-75629165 CTCTGCCCCAGGGCAGTATCTGG - Intronic
1073688709 10:105784119-105784141 ATCAACCCCAGGGCTGTGTATGG - Intergenic
1075067355 10:119298363-119298385 CTGCCCACCAGGGCTGTGACTGG - Intronic
1075510953 10:123072815-123072837 GCCTCCTCCAGGGCTGTGGCCGG - Intergenic
1076073569 10:127513777-127513799 CAGTCACCCAGGGCTGTGTGTGG - Intergenic
1076230588 10:128817146-128817168 GTCTCCCCAAGGGCTGGGTTGGG + Intergenic
1077228554 11:1448764-1448786 CCCTGCCCCTTGGCTGTGTCTGG + Intronic
1077353392 11:2103437-2103459 CTCTCCCACAGAGCTGTCCCTGG + Intergenic
1081110928 11:39132217-39132239 CCCTACCACAGGCCTGTGTCTGG + Intergenic
1081691513 11:45081360-45081382 ATCTCCCACAGGGCTGTCCCAGG - Intergenic
1083720728 11:64602283-64602305 CTCTGGCCCAGCGCTGTGTGGGG - Exonic
1083766251 11:64842978-64843000 CTCTTTCCCAGGTCTGTGTGTGG + Intronic
1083893272 11:65607519-65607541 CTCTCCACCATCGCTGTCTCGGG - Intronic
1084063207 11:66688949-66688971 CACTGCCCCAGAGCTGTGCCAGG + Intronic
1084170863 11:67400452-67400474 CTTTCCCCCAGGGCCCTGCCTGG - Intronic
1084381605 11:68816450-68816472 CTCTCCCCAGGGGCTGTGCTTGG - Intronic
1084476975 11:69394639-69394661 CAGTCCCCCAGGGCTCTGCCTGG + Intergenic
1084565548 11:69926471-69926493 CCCAGCCCCAGGGCTGTTTCAGG + Intergenic
1084620382 11:70265992-70266014 CTGTCACCCAAGGCTCTGTCAGG - Intergenic
1084661659 11:70549933-70549955 CTCTCCTGCTGGGCTCTGTCAGG + Intronic
1084681399 11:70668513-70668535 CTGGCCTCCAGGGCTGTGACAGG + Intronic
1084750016 11:71198513-71198535 CTCTTCCCCAGGACCCTGTCAGG + Intronic
1085312235 11:75523750-75523772 CTCTACCCCAGACCTCTGTCTGG - Intronic
1086136962 11:83451403-83451425 CTCTCCCCCAGGGATGGGGTGGG + Intergenic
1087123378 11:94598420-94598442 CTCTCCCCAAGTACTATGTCTGG - Intronic
1088300223 11:108350318-108350340 CTCTACCCCTGGGCTGAGTTAGG + Intronic
1089601912 11:119621561-119621583 CTGGCCCCCAGTGCTGTGTGCGG - Intergenic
1090875855 11:130788309-130788331 TTGTCTCCCAGGGCTATGTCTGG - Intergenic
1091285309 11:134405502-134405524 ACCTTCCCCAGGGCTCTGTCAGG + Intronic
1092262161 12:6958588-6958610 CTGGCCCCCAGGGCTGTGTGGGG + Intronic
1093494896 12:19745190-19745212 CTCTCCCTCAGTGTTATGTCGGG + Intergenic
1094458961 12:30672450-30672472 CTCTCCCCCACTGTTGTGTAGGG - Intronic
1094845309 12:34358917-34358939 CTCTCCACCAGGCATGTGTGGGG - Intergenic
1095741890 12:45616466-45616488 CTCACCCCCAGGGCTGTGCAGGG - Intergenic
1096512477 12:52138805-52138827 TTCTCCTCCAGGGCTGTTTGTGG + Intergenic
1096542733 12:52317342-52317364 CTCTGGCCCAGGGCTTTCTCTGG - Intronic
1096695220 12:53344659-53344681 ATCTCCCCCACAGCTGTGGCTGG - Intronic
1096747034 12:53735791-53735813 CCCTCCCCCAGTGCTGTTCCTGG + Intergenic
1101641229 12:106586859-106586881 TCCTTCCCCAGGGCTGTGCCTGG - Intronic
1102486359 12:113260404-113260426 CTCACCCCCAGAGCTGAGACTGG - Exonic
1102679150 12:114678844-114678866 CCCTCCCCCAGGCCTGAATCTGG - Intronic
1103374712 12:120446646-120446668 CCCTCCTCCAGGGCAGTGGCCGG + Exonic
1103736393 12:123063552-123063574 CTCTCCCCCAGGGCTCTCTTTGG + Intronic
1103859254 12:123998893-123998915 CTCTCTTCCAAGTCTGTGTCAGG + Intronic
1103967975 12:124652252-124652274 CTCTCCCCCAGGTCTGGGATGGG - Intergenic
1104910670 12:132238703-132238725 CTCCTCCCCAGGGCTGTGGGAGG + Intronic
1105620246 13:22059663-22059685 CTCTCCCTCAGGCCTCTGCCTGG - Intergenic
1105704020 13:22957759-22957781 TTCTACCCCAGGGCTGGGCCTGG - Intergenic
1105856973 13:24382843-24382865 TTCTACCCCAGGGCTGGGCCTGG - Intergenic
1105874734 13:24541547-24541569 CTCTGGCCCCGGGCTGTGTGGGG + Intergenic
1105948558 13:25210029-25210051 CTGTCCCTCAGGTCTGGGTCTGG + Intergenic
1106029245 13:25984868-25984890 CTCTCATGCAGGGCTGTGTTAGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107692702 13:42967922-42967944 CTCTAACCCAGGCCTGTTTCAGG - Intronic
1108093890 13:46880357-46880379 CTCTGCCCTTGGGCTGCGTCAGG - Intronic
1111068410 13:83129134-83129156 TTCTACCCCAGGACAGTGTCTGG - Intergenic
1111116495 13:83785445-83785467 CTCTCCATCATGGCTATGTCTGG - Intergenic
1113586136 13:111467500-111467522 TTCTCCTCCAGGGATGTGGCTGG + Intergenic
1113723512 13:112579580-112579602 CTCTCCCACACTGCTGTGTGCGG + Intronic
1113723534 13:112579672-112579694 CTCTCCCACACTGCTGTGTGCGG + Intronic
1115853077 14:37602735-37602757 CTCTCCCCCACCGCGGTGACTGG - Intronic
1116845463 14:49861163-49861185 ATCTCCCCCATGGCTGCTTCTGG - Intergenic
1118955553 14:70477572-70477594 CTCTGCCCCACCGCCGTGTCTGG + Intergenic
1119360749 14:74047251-74047273 CTCTCCTCCAGGGATGATTCAGG + Intronic
1120140069 14:80920286-80920308 CTCTCCATCAGTCCTGTGTCTGG - Intronic
1120575580 14:86176477-86176499 CTGTACCCCAGGCATGTGTCAGG - Intergenic
1121013510 14:90535102-90535124 CTCACCCTCAGGGCTGCGTGGGG - Exonic
1121124972 14:91400069-91400091 CTGCTCCCCAGGCCTGTGTCTGG + Intronic
1121266830 14:92609289-92609311 CTCACCCTCAAGGCTGTGTCAGG - Intronic
1121293322 14:92794896-92794918 CTCTGCCCCTGGGCAGTGTCTGG + Intronic
1121737343 14:96227863-96227885 CTCTCCCCCAGGGCTCTGATGGG - Intronic
1122121213 14:99554435-99554457 GGCTCCTGCAGGGCTGTGTCTGG + Intronic
1122141250 14:99664251-99664273 AGAGCCCCCAGGGCTGTGTCTGG + Intronic
1122824073 14:104361173-104361195 CACTCCCCCAGGAATGAGTCAGG - Intergenic
1122845731 14:104497089-104497111 TTCTACCCCAGGGCTGGGCCTGG - Intronic
1123135290 14:106022201-106022223 CCCTCCACCTGTGCTGTGTCTGG - Intergenic
1123180587 14:106466668-106466690 CTCTTGTCCAGGGCTGTGTTTGG + Intergenic
1123397917 15:19955531-19955553 CCCTCCACCTGTGCTGTGTCTGG - Intergenic
1123585831 15:21760061-21760083 CCCTCCACCTGTGCTGTGTCTGG - Intergenic
1123622473 15:22202649-22202671 CCCTCCACCTGTGCTGTGTCTGG - Intergenic
1124027804 15:25982931-25982953 CTCTCACCCAGTCCCGTGTCTGG + Intergenic
1126339569 15:47624236-47624258 TTATCCCCCAAGGCTGTGTTAGG + Intronic
1127877231 15:63121975-63121997 CTCTCGGCCACGGCTGGGTCGGG + Exonic
1129108069 15:73322719-73322741 CTCTTCCCCAGGGCTGGGGGTGG - Exonic
1129171786 15:73812377-73812399 CTCTTTCCCAGGGCTGGGGCAGG - Intergenic
1129220265 15:74128319-74128341 CTTTCCCCCAGGGCAGCCTCCGG + Exonic
1129239791 15:74244537-74244559 CCCTACCCCAGGGCTGGGTATGG - Intronic
1129701230 15:77769660-77769682 CTGTCCCCCAGGGGTGGGTGGGG - Intronic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1131234412 15:90683553-90683575 CCCTCCCCCATGGGTGTGGCTGG + Intergenic
1132061101 15:98693073-98693095 CCCTAACCCAGGGCTGTGTGGGG + Intronic
1132232341 15:100193416-100193438 GTCTCCCCCAGTGCTGAGCCCGG - Intronic
1132696378 16:1203999-1204021 CTCTCCCGCAGGACTGGGCCAGG + Exonic
1132932884 16:2467847-2467869 CTCGCCCCCCGGGCCGGGTCTGG + Intergenic
1132945188 16:2528441-2528463 TTCTCCCCCAGGGCTGGTGCTGG + Exonic
1133058204 16:3158058-3158080 CTCTCTCTTAGGGCTGTGTGAGG + Intergenic
1133580859 16:7143317-7143339 CTCTCCCTGAGAGCTGGGTCGGG - Intronic
1133802842 16:9098039-9098061 TGCTCCCCCAGGGCTGGGGCGGG + Intronic
1134305344 16:13027039-13027061 CCCTCCCCCACTGCTGTATCTGG + Intronic
1134828695 16:17305868-17305890 CTCCCCACCACGGCGGTGTCAGG - Intronic
1135348576 16:21709996-21710018 CTCTCCCCCGAGGCTGTGCACGG + Exonic
1135414242 16:22256926-22256948 CTCACCCCAAGGGCTGTGGTGGG - Intronic
1136061230 16:27728111-27728133 CTCTGCCCCATGGCAGGGTCTGG + Intronic
1136069885 16:27781332-27781354 CTCCACCCCAGGGCTCTGGCAGG - Intergenic
1136146161 16:28317772-28317794 CTTTCCCCCTGGGCTGCCTCAGG - Intronic
1136483373 16:30556253-30556275 CTCTCCCTCCCGGCTCTGTCTGG - Intronic
1137654982 16:50152574-50152596 GTCTCCCCCAGGGCTATGCATGG + Intergenic
1138344568 16:56312035-56312057 GTCTCCCCGAGGGCAGGGTCAGG - Intronic
1139591463 16:67935575-67935597 CGCTCACCCAGGGCTGTGAAGGG + Exonic
1139778054 16:69329637-69329659 CTAGCCCCCTGGGCTGGGTCAGG + Intronic
1139846796 16:69927210-69927232 GGCTGCCCCAGGGCTGTGGCTGG + Intronic
1139966709 16:70749794-70749816 GTCACCCCCTGGGCTGAGTCAGG - Intronic
1141518066 16:84559580-84559602 CTCTGCCCCAGGGCTGGCCCTGG - Intergenic
1141609866 16:85175264-85175286 TCCTTCGCCAGGGCTGTGTCTGG + Intronic
1141621332 16:85238125-85238147 CCCACCCCCAGGCCTGTGTTGGG - Intergenic
1141650501 16:85390398-85390420 GTGCCCCCCAGGGCTGTGCCTGG + Intergenic
1141930651 16:87200259-87200281 CCATCCCCCAGTGCTGGGTCTGG + Intronic
1141962375 16:87417731-87417753 CTGTCCCACAGGCCTGTGTGTGG - Exonic
1142105046 16:88298141-88298163 CTCACCCCATGGGCTGTGGCAGG - Intergenic
1143940311 17:10534098-10534120 ATCTCTCCCAGGTCTGGGTCAGG - Intronic
1144388254 17:14770197-14770219 CTGTTCCCCAGGGCAGTGGCTGG + Intergenic
1144685906 17:17226191-17226213 TTGTCCGCCAGGCCTGTGTCCGG - Exonic
1144739929 17:17576142-17576164 CGCTCTCCCAAGGCTGTCTCTGG - Intronic
1144968484 17:19092581-19092603 CCCACCCCCAGGGCTGTGCCGGG - Intergenic
1144979433 17:19159482-19159504 CCCACCCCCAGGGCTGTGCCGGG + Intergenic
1144988789 17:19218750-19218772 CCCACCCCCAGGGCTGTGCCGGG - Intronic
1145063384 17:19746050-19746072 CTCTGCACCAGGGGTGTCTCAGG + Intronic
1145201705 17:20951380-20951402 GTTTGCCCCAGGTCTGTGTCTGG + Intergenic
1146642878 17:34554436-34554458 CTCCTCCCCTGGTCTGTGTCAGG + Intergenic
1147133410 17:38421753-38421775 CTCCCACCCAGGGCTGGCTCAGG + Intergenic
1147637481 17:41972995-41973017 CTGTCCTCCAGGGCGCTGTCTGG + Intronic
1148031944 17:44627843-44627865 CCCTCCCACAGGGCTGAGGCTGG + Intergenic
1148355236 17:46971443-46971465 CTCTCCTCCAGTGCTGGGTTAGG + Intronic
1149261397 17:54884113-54884135 CTCCCGCCCAGGGATGAGTCAGG + Intergenic
1151231173 17:72686239-72686261 CTGTCCCCCAGGTCTGTTGCTGG + Intronic
1151548229 17:74806361-74806383 TTCTCCCCGACGGCTGTGCCTGG - Intronic
1151699135 17:75733445-75733467 CTTTCCTCCTGGGCTGTTTCGGG + Intronic
1151774905 17:76193913-76193935 GTGTCCCCCAGGGCTGTCTGTGG - Intronic
1152494889 17:80664065-80664087 GCCTCCTCCAGGGCTGCGTCTGG + Intronic
1152538814 17:80964696-80964718 CTCTCCGCCAGGGCTCTGTCGGG - Exonic
1152573840 17:81131710-81131732 CCCTCACCCCGGGCTGTGCCTGG + Intronic
1152614041 17:81329782-81329804 CCCTCCCCGAGGCCTGTGTGGGG - Intronic
1152900754 17:82939736-82939758 CTGTACCACAAGGCTGTGTCTGG + Intronic
1152962154 18:86426-86448 GTCTGCCCCAGAGCTGGGTCAGG - Intergenic
1154173425 18:12067149-12067171 CCCCCCTCCAGGGCGGTGTCAGG - Intergenic
1156427404 18:37029139-37029161 ATCTTCCCCAGGGCTTTTTCTGG + Intronic
1157280752 18:46344991-46345013 CCCTCCCTAAGGGCTGGGTCAGG + Intronic
1158251832 18:55498189-55498211 CTCCCTGCCAGGGCTGGGTCCGG + Intronic
1158446723 18:57528565-57528587 CTATCACCCAGGGCTGGATCAGG + Intergenic
1160631991 18:80253386-80253408 CTCTCCTCCAGGCATGTGTCAGG + Intergenic
1160738092 19:673929-673951 GTCTCCCCCAGGCCCGGGTCAGG + Intergenic
1160867704 19:1263001-1263023 CTCTCCCCCAGGGCTGAGTGTGG - Intronic
1160981873 19:1819942-1819964 CTGGCCCCCAGCGCTGTGCCCGG - Exonic
1161090903 19:2359833-2359855 CTCGCCCCCAGGGCTGTCCTGGG + Intergenic
1161686327 19:5704417-5704439 CTCTCCCCCAGGGCCCTGAGAGG - Intronic
1161733068 19:5974037-5974059 CACTCCCCAGGGGCTGTGTCAGG + Intronic
1162760233 19:12884693-12884715 GGCTCCCCCAGGGCTGTCTATGG + Exonic
1163886187 19:19966671-19966693 CTCAGCTCCAGGGTTGTGTCAGG + Intergenic
1163888277 19:19988807-19988829 CTCAGCTCCAGGGTTGTGTCAGG - Intergenic
1163949720 19:20572244-20572266 CTCAGCTCCAGGGCTGTGTCAGG + Intronic
1163968360 19:20769659-20769681 CTCAGCTCCAGGGTTGTGTCAGG - Intronic
1164728001 19:30479731-30479753 CTCTCACCCTGGGATGTGGCAGG - Intronic
1164931509 19:32179376-32179398 CTCTCCCCCTGGGGTGAGGCTGG - Intergenic
1165074149 19:33271458-33271480 CTCTGCTCCAGCGCTGTTTCCGG - Intergenic
1165403009 19:35613718-35613740 CTGTCCCCACAGGCTGTGTCTGG + Exonic
1165882433 19:39053406-39053428 CTCTCCCACAGGCCTTTGTATGG - Intergenic
1166503944 19:43360032-43360054 CGTTCCCCCAGGGCTGTGAGAGG + Intronic
1167421247 19:49404613-49404635 TTCTCACCCAGGGCTGTGTCTGG + Intronic
1167422643 19:49413225-49413247 CCCTCCCCCAAGGCAGGGTCAGG - Intronic
1167439645 19:49500797-49500819 CTGTCCCCCAGGCCTGTACCAGG + Intergenic
1167587632 19:50384002-50384024 CTCTCGCCCGGGGCCGTGTAGGG - Intergenic
1167594146 19:50418531-50418553 CTCTCCCCGGGGGATGTGTGAGG - Intronic
1167751888 19:51385817-51385839 CTCTCTCTCAGGGCTGGCTCCGG + Intronic
1168087465 19:54058721-54058743 TTCTCTTCCAGGGCTGTGTCTGG - Exonic
1168116281 19:54222771-54222793 CTCTCTTCCAGGGCTGAGTCTGG - Exonic
1168119265 19:54242543-54242565 TTCTCTTCCAGGGCTGAGTCTGG - Exonic
1168122048 19:54256985-54257007 CTCTCTTCCAGGGCTGAGTGTGG - Exonic
1168125492 19:54280288-54280310 CTCTCTTCCAGGGCTGAGTCTGG - Exonic
1168130097 19:54312359-54312381 CTCTCTTCCAGGGCTGAGTCTGG - Exonic
1168134124 19:54338890-54338912 CTCTCTTCCAGGGCTGAGCCTGG - Exonic
1168168988 19:54574065-54574087 CTCTCTTCCAGGGCTGAGTCTGG + Exonic
1168171760 19:54594430-54594452 CTCTCTTCCAGGGCTGAGTCTGG + Exonic
1168173674 19:54607859-54607881 CTCTCTTCCAGGGCTGAGTCTGG + Intronic
1168176482 19:54631260-54631282 CTCTCTTCCAGGGCTGAGTCTGG + Exonic
1168181075 19:54663521-54663543 CTCTCTTCCAGGGCTGAGTCTGG + Exonic
1168185307 19:54696593-54696615 TTCTCTTCCAGGGCTGAGTCTGG + Intronic
1168187289 19:54708392-54708414 CTCTTCTCCATGGCTGAGTCTGG + Intergenic
1168209001 19:54875319-54875341 CTCTCTTCCAGTGCTCTGTCTGG + Exonic
1168421317 19:56205954-56205976 CTCTGACCCAGGGCTGTTGCAGG - Exonic
926104913 2:10144000-10144022 GTCTCCACCAAGGCTGTCTCTGG + Intronic
926455466 2:13062132-13062154 CTCTCCGCCAGCTCTGTGTAAGG - Intergenic
927153170 2:20207144-20207166 CTCTGCCCCAGGGCTGCCTCAGG - Intronic
927191539 2:20520266-20520288 CTCTCCCACAGGGATGGGGCAGG + Intergenic
927556647 2:24039132-24039154 TCCTTCCCCAGGGCTGTGTGTGG - Exonic
927879784 2:26682242-26682264 CCCTCCCCCAGGGCAGTGTCAGG + Intergenic
927954795 2:27200846-27200868 CTGTCCCACACGGCTGTCTCAGG - Intronic
928556009 2:32425912-32425934 CTTTCCCCCACAGCTGTGTCAGG + Intronic
929382635 2:41370302-41370324 CACTCTCCCAAGGCTGAGTCAGG + Intergenic
929760455 2:44802095-44802117 CTATCCCCCAGGACTGGGCCCGG - Intergenic
932098860 2:68878122-68878144 ATCACCCCCAGGACAGTGTCTGG + Intergenic
934520533 2:95017516-95017538 CTCTCTCCCAGGGCTGTCTGTGG - Intergenic
935696035 2:105771919-105771941 CTCCCTCCCAGGGCTGTTCCAGG + Intronic
936150991 2:110022436-110022458 CTCTCCACCAGGCGAGTGTCAGG - Intergenic
936193685 2:110348933-110348955 CTCTCCACCAGGCGAGTGTCAGG + Intergenic
937105334 2:119307106-119307128 CCCTCCCTCAGTGCCGTGTCTGG - Intronic
937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG + Intergenic
937854520 2:126662732-126662754 CTCTACCTCAGGGCTTTGTTCGG + Intronic
939486908 2:142826033-142826055 CTCTCCCACAGCTCTATGTCTGG - Intergenic
940353947 2:152718402-152718424 CTCGACCCCAGGGCTGTAGCCGG - Exonic
941925284 2:170888228-170888250 CTTTCCCCCAGGGCTGGGGGTGG + Intergenic
942419615 2:175794740-175794762 CTTCCCCCCAGGCCTGTGGCAGG + Intergenic
944636697 2:201681870-201681892 CTCTCCCCAGGGCCTGTGTGAGG - Intronic
944672774 2:202009242-202009264 ATTTCCCCCAGGGCCTTGTCTGG - Intergenic
946399529 2:219461165-219461187 CCCTCCCCCAAGGCTGACTCTGG + Intronic
946403900 2:219483013-219483035 CTCTTCCCCAGGGCTGAGGTGGG + Intronic
946707332 2:222471282-222471304 CTTTCCCTCAGGGCTATGTTGGG + Intronic
947571788 2:231241523-231241545 CTGACCCACAGGGCTGTCTCAGG - Intronic
947637748 2:231688690-231688712 CCCTCCCTCAGGGGTGTTTCTGG + Intergenic
948609117 2:239155580-239155602 CTCTGCTCCAGGGATGTGGCTGG + Intronic
948692431 2:239715180-239715202 GTCTCCCCCAGGTCGTTGTCAGG + Intergenic
948727704 2:239944969-239944991 GTCACCCCCATGGCTGTGTCTGG - Intronic
1169471252 20:5887555-5887577 CTTTGCCCGAGGGCTTTGTCTGG - Intergenic
1170909381 20:20549508-20549530 CCCTCCCCCAGTGCTGTCTTTGG - Intronic
1172116592 20:32576813-32576835 GTCTCCCACAAGGCTGGGTCTGG + Intronic
1172174100 20:32961783-32961805 TTCTGCCCCAGGGCTCTGTGCGG - Intergenic
1172479896 20:35264972-35264994 CTGTCCTCCAGGGCTCTGGCTGG - Intronic
1172554882 20:35832213-35832235 CTCTTCCCCAGGGTTGTCTTGGG + Intronic
1173155109 20:40602030-40602052 CTCTCACCCTGGTCTGTGTCTGG - Intergenic
1174364764 20:50049921-50049943 CCCTCCCCCAGGTCTGGGCCTGG + Intergenic
1174550701 20:51359416-51359438 TTCTCCCCCAGAGCAGTTTCAGG - Intergenic
1174619087 20:51860235-51860257 CCCTCCACCAGGGCTCTGCCAGG + Intergenic
1175166275 20:57047000-57047022 CGCTCGCCCAGGGCTTTGTCTGG - Intergenic
1175220621 20:57414526-57414548 CTGCCTCCCAGGGCTGTGGCCGG + Intergenic
1175290067 20:57869747-57869769 CTGACCCCCAGGGCTGGGACAGG - Intergenic
1175293891 20:57895745-57895767 CTGACCCCCAGGGCTGGGGCAGG - Intergenic
1175395990 20:58662068-58662090 CTCTTACCCAGGGAAGTGTCTGG + Intronic
1175838911 20:62014442-62014464 CTCACTCCCATGGCTGTGCCTGG + Intronic
1176170718 20:63695260-63695282 CTCACTCCCAGGGCTGCGTGCGG - Intronic
1177027021 21:15932860-15932882 CTATCCCCCAGGATTGTGGCAGG + Intergenic
1178704183 21:34859354-34859376 CTTTCCCCCAGGGGGATGTCAGG - Intronic
1178818811 21:35956300-35956322 CTCTTCCCAAGGGCAGAGTCAGG + Intronic
1178917885 21:36719153-36719175 CTCCCGCCCAGGGGTGTGGCTGG - Intronic
1180841410 22:18960555-18960577 CTCTCCTGCATGGCTGTGGCTGG - Intergenic
1181051593 22:20240617-20240639 CTCCCCGCCAGGGCAGTGGCTGG - Intergenic
1181110664 22:20600918-20600940 CTCAGCCCCAGGGCAGCGTCTGG - Intergenic
1181499098 22:23305711-23305733 CTCTCCCCCTGGACTGGGTAAGG - Intronic
1181661259 22:24350899-24350921 CTCTCCTCCTGGGCTTTCTCAGG - Intronic
1181880387 22:25974854-25974876 GTCTGTCCCAGGGCAGTGTCTGG + Intronic
1182367635 22:29789548-29789570 CTCTACCCTAGGGCTTTGCCTGG + Intronic
1182472713 22:30558456-30558478 CCCTCCCCCAGGCCTGGGCCAGG + Intronic
1183098852 22:35571028-35571050 GGCACCCCCAGGGCTGTGTTCGG + Intergenic
1183381107 22:37491005-37491027 CTCACCCCCAAGGCTGTCTCTGG - Exonic
1184072027 22:42152488-42152510 CCCGCCCCCAGGGGTGTTTCTGG - Intergenic
1184098037 22:42327162-42327184 GTTTACCCCAGGGCTGAGTCTGG + Intronic
1184574068 22:45347968-45347990 CCCTTCCCCTGGGCAGTGTCGGG + Intronic
1184858139 22:47157740-47157762 CTCTTCCCAAGGGCTGGGTAGGG + Intronic
1185271191 22:49929885-49929907 GACTCCCCCAGGGCTATGGCAGG - Intergenic
1185295150 22:50049542-50049564 CACCTCCCCAGGGCTGTGACAGG + Intronic
950162750 3:10772398-10772420 GCCTCCCCCAGGGCTATTTCTGG - Intergenic
950688966 3:14640613-14640635 CCCTCCCTCAGGTCTGTGTTTGG - Intergenic
952974718 3:38683855-38683877 CTCTCATCCAGAGCTCTGTCAGG + Intergenic
953850147 3:46459808-46459830 CTCTCTCCCAGGACTGTGTCTGG - Exonic
954782912 3:53073814-53073836 GTCTCCCGCAGGGCTGGGTAGGG - Intronic
959086219 3:101853270-101853292 CTCCCCCGCAGAGCAGTGTCAGG + Exonic
961633977 3:128321487-128321509 CACTCCCCCAGGACAGTCTCTGG + Intronic
962233579 3:133688181-133688203 CTCTCTCCTAGGGCTGTGCCTGG + Intergenic
962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG + Exonic
962250544 3:133833496-133833518 CTTCCCTCCAGGCCTGTGTCAGG + Intronic
963103377 3:141625477-141625499 CTGTCCCCCTGGGCTCTGGCTGG - Intergenic
964503718 3:157376042-157376064 CTCTGCCCCAGGCCTGTGTCAGG + Intronic
964670476 3:159219869-159219891 CACTCACCCAGGGCCTTGTCCGG - Intronic
966133340 3:176669748-176669770 CTATCCCCCAGAGCTGTATCTGG + Intergenic
966733801 3:183172733-183172755 CTCACCCCCAGGTCTATGCCAGG + Intergenic
967637432 3:191819817-191819839 TTCTGACCCAGGGCTGTCTCTGG + Intergenic
967935791 3:194726376-194726398 CCCTCCCCCAGGACAGTGTCTGG + Intergenic
968607599 4:1542847-1542869 CTGGCCCCCAGGCCTGTGCCCGG - Intergenic
968919638 4:3515799-3515821 CCCTCCCCCCAGGCTGTGGCTGG + Intronic
970205920 4:13655268-13655290 CTCTGCCCAAGGGCTTTTTCTGG - Intergenic
970747937 4:19321906-19321928 TTCATTCCCAGGGCTGTGTCAGG + Intergenic
972555457 4:40176721-40176743 CTCTCCCACATGGCTGTCTCAGG - Intergenic
974366445 4:60955724-60955746 CTCTGCCCAAGGGCTGACTCTGG - Intergenic
976269187 4:83213743-83213765 CTCTTCCCCAGGTCTCTGCCTGG - Intergenic
981404849 4:144356062-144356084 CTCTCTCACAGGGCAGTGTGTGG + Intergenic
981660269 4:147158329-147158351 CTCTGCCCCAGAGCTGTGCCTGG + Intergenic
984768677 4:183419328-183419350 CTCTCCCTCGGGGCTGCCTCAGG - Intergenic
984856638 4:184201133-184201155 CTCTGCCCCAGGTCTCTGCCTGG + Intronic
985219679 4:187690936-187690958 CACTGCCCCAGGGGAGTGTCAGG + Intergenic
990336099 5:54774351-54774373 CTCTCCCCCAGGTCTGAGCTGGG + Intergenic
990948687 5:61275573-61275595 CTGGCCCACAGGGCTGTGTGAGG + Intergenic
994080370 5:95702389-95702411 CTCTCTCCCAGAGTTGTGCCTGG - Intergenic
995490781 5:112689663-112689685 ATCTGCCCCAGGTCTGTGTGTGG + Intergenic
996089675 5:119338493-119338515 CTCTCCAGCAGGGCCATGTCTGG - Intronic
997282651 5:132658491-132658513 CTCTCCCTCATGGCTGGGCCGGG - Intronic
997454618 5:134007513-134007535 CTCTCCCTCAGGGTTGTGGTGGG - Intergenic
997588910 5:135061135-135061157 CCCTGCCCCAGGGCTGGGACAGG - Intronic
997694153 5:135848304-135848326 CACTCTCCCAGGGCTGTCCCTGG - Intronic
997718249 5:136058019-136058041 CTGTCCCCCAGGGGTGCCTCAGG - Intronic
997755192 5:136389583-136389605 CTTTCTCACAGGGCTGTGTGAGG - Intronic
997899970 5:137754879-137754901 CTCCCGCCCAGGGCTTTGCCGGG + Intergenic
997979222 5:138458731-138458753 CTCTCTCCCAGGCCTGAGGCTGG - Intergenic
998184643 5:139968862-139968884 CTCTCCTCCTGGGCTGAGGCTGG - Intronic
998993874 5:147849412-147849434 CTCTCCCTGAGGGCTTTCTCAGG + Intergenic
999242055 5:150133432-150133454 CTATACCCCGGGGCTGTGACAGG + Intronic
1000378040 5:160602535-160602557 CTCTCACCCAGGGCTTTGGCAGG - Intronic
1001023818 5:168206516-168206538 CTCCACCCCAGGCCTGTCTCTGG - Intronic
1001251995 5:170153586-170153608 CACTGCTCCAGGGCTGTGCCTGG + Intergenic
1001931856 5:175678811-175678833 GGCTCCCACAGGGCTGTGTCTGG + Intronic
1002666828 5:180831352-180831374 CTCTTCTCCCGGCCTGTGTCCGG - Intergenic
1002685480 5:181005913-181005935 CACTCTCCCTTGGCTGTGTCTGG - Exonic
1002823846 6:754909-754931 CTCTCCATCTGGGCTGTGTTGGG - Intergenic
1003292244 6:4789397-4789419 CTCTCCCCTAGTGGTGTCTCTGG + Intronic
1004044551 6:12012032-12012054 CTCTCCCCCGGGGCAGAGTAGGG - Intronic
1004382988 6:15148555-15148577 CTCTCCCACAGGGCCCCGTCAGG + Intergenic
1006057397 6:31395696-31395718 CTCTCCCTCAGCGCTGGCTCTGG - Intergenic
1006069819 6:31490352-31490374 CTCTCCCTCAGTGCTGGCTCTGG - Intergenic
1006079735 6:31558367-31558389 CCCTCCCCCAGGGCAGGGCCAGG - Exonic
1006265112 6:32914386-32914408 CTCTCTACCAGGGCTGGATCTGG + Intergenic
1006641832 6:35493381-35493403 GACACCCCCAGGGCTGTGCCAGG - Intronic
1006797067 6:36738619-36738641 CTCACCCCCCAGGCTGTGGCTGG - Intergenic
1007395253 6:41574072-41574094 TTCTCACCCAGGGCTGTGTTTGG + Intronic
1007582837 6:42969444-42969466 CTGTCCTCCAGGGCTGGCTCTGG - Intronic
1007801842 6:44401190-44401212 TTCTTCCCCAGGGCTCTGACAGG + Intronic
1008459225 6:51748538-51748560 CTCTGCACCAGAGCTGTGGCGGG - Exonic
1011398666 6:86937138-86937160 TTCTCCGCCAGGGCTGTGGCCGG + Intergenic
1013514748 6:110875431-110875453 CCCTCCCCCAGGGCAATGCCAGG - Intronic
1013839716 6:114376996-114377018 CTCTCCCGCACTGCTGTGTTGGG + Intergenic
1015627594 6:135196887-135196909 CTCTCTCTCAGTGCTGTTTCAGG + Intronic
1016324547 6:142885238-142885260 CCCTCCTCCATGGCTGTGTGTGG - Intronic
1018379700 6:163247302-163247324 CGCTCCTCCAGGGCTGTGGCAGG - Intronic
1018817312 6:167343198-167343220 CCGAGCCCCAGGGCTGTGTCAGG + Intronic
1018862821 6:167723216-167723238 GGCTCCCCCAGCGCTGTGGCTGG + Intergenic
1019519726 7:1455176-1455198 ATCTGCCCGAGGGCTGTGCCTGG + Intronic
1019623494 7:2003733-2003755 GCCTCCCCCAGGGCAGTGTGAGG - Intronic
1019682971 7:2362952-2362974 CCCGCCCCCAGGGCTGTGACTGG - Intronic
1020007406 7:4789948-4789970 CACCCGCCCAGGGCTGTGGCAGG - Intronic
1022691179 7:32656778-32656800 CTGTCCCCCAGGTCTGGGTAGGG + Intergenic
1022799227 7:33759784-33759806 TCCTTCCCCAGAGCTGTGTCTGG + Intergenic
1023793581 7:43772485-43772507 CCCTGCCCCAGGGCTGGGTGTGG + Intronic
1023843178 7:44107904-44107926 CTCTCCTCCGGGGCTGGGGCCGG - Exonic
1024131529 7:46357542-46357564 CTCTCTCTCAGGGCTCAGTCTGG - Intergenic
1026456129 7:70574158-70574180 CATTCCCCAAGGGCTGTGTAAGG + Intronic
1029839531 7:103347554-103347576 CGTTTCCCCAGGGCTCTGTCCGG + Exonic
1031976365 7:128096178-128096200 CTGTCTGCTAGGGCTGTGTCAGG + Intergenic
1035017944 7:155782628-155782650 CTCTCCCCCAGGGTCCTGCCGGG - Intergenic
1035209014 7:157314118-157314140 CCCGCTCCCAGGGCTGGGTCGGG - Intergenic
1035352851 7:158258611-158258633 ATCTCCCCCAAAGCTGTGACTGG - Intronic
1035642026 8:1191043-1191065 CTCTCCCCGTGGGATGTGGCAGG - Intergenic
1035647750 8:1241416-1241438 CTCTCACATAGTGCTGTGTCTGG + Intergenic
1035743447 8:1945517-1945539 ATCTCCCACATGGCCGTGTCCGG + Exonic
1036227833 8:6974778-6974800 TTCTCCCCCAGGGCTGTGCATGG - Intergenic
1036230286 8:6993895-6993917 TTCTCCCCCAGGGCTGTGCATGG - Intergenic
1036232738 8:7012998-7013020 TTCTCCCCCAGGGCTGTGCATGG - Intronic
1037358964 8:18053454-18053476 CTCTGCAGCAGGGCTGTGTGCGG + Intergenic
1037371530 8:18184319-18184341 CTCTCTATCAGGGCTGTCTCAGG - Intronic
1037407440 8:18558044-18558066 CTCTCCCCTAGGGCTGTGGATGG - Intronic
1037587943 8:20290866-20290888 TTCTCCCCAAGGGCAGTGGCTGG - Intronic
1037880859 8:22572761-22572783 CTCTCCCCCAGGGCTGCTCGAGG - Intronic
1037982701 8:23266063-23266085 CCGTCCCCCAGGGCAGTATCTGG - Intergenic
1040000791 8:42575026-42575048 TTCTCACCCAGGTCTGTCTCTGG - Intergenic
1040325878 8:46341265-46341287 GAATCCCCCAGGGCTGTTTCAGG + Intergenic
1040417394 8:47207429-47207451 CTCTCTCCCAGGGCTGCTCCAGG + Intergenic
1040603752 8:48909920-48909942 CACTTCCCCATCGCTGTGTCAGG - Intergenic
1041476832 8:58276822-58276844 CTCTGCCTCCTGGCTGTGTCAGG + Intergenic
1042210516 8:66376089-66376111 CACTTCCACAGGGCAGTGTCTGG - Intergenic
1042210561 8:66376433-66376455 CACTTCCACAGGGCAGTGTCTGG - Intergenic
1042210584 8:66376602-66376624 CACTTCCACAGGGCAGTGTCTGG - Intergenic
1042210672 8:66377318-66377340 CACTTCCACAGGGCAGTGTCTGG - Intergenic
1042210700 8:66377545-66377567 CACTTCCACAGGGCAGTGTCTGG - Intergenic
1042210718 8:66377686-66377708 CACTTCCACAGGGCAGTGTCTGG - Intergenic
1042210737 8:66377829-66377851 CACTTCCACAGGGCAGTGTCTGG - Intergenic
1043745588 8:83869760-83869782 CTCTCCCCGGTGGCTGAGTCAGG - Intergenic
1044010965 8:86994164-86994186 CATTGCCCCAGGGCTGTGACAGG - Intronic
1044580375 8:93820180-93820202 CTTTCCCCCATGGCTGTGCATGG + Intergenic
1049161514 8:141101293-141101315 TTCTGCCTGAGGGCTGTGTCTGG + Intergenic
1049661796 8:143822885-143822907 CTGTCCCTCAAGGCTGTGTCTGG - Intronic
1049683022 8:143928094-143928116 CTGACCCCCAGGGTTGGGTCTGG - Intronic
1049724889 8:144141194-144141216 CTCTTCCTCAGTGCTGTGCCAGG - Intergenic
1055569531 9:77602510-77602532 GTCTCTCCCAGGGGTGGGTCGGG - Intronic
1057704715 9:97388520-97388542 CCCTCCCCCAGGGCAGAGCCAGG + Intergenic
1060157671 9:121331377-121331399 CTCACCTCCAGGTCTTTGTCTGG + Exonic
1060191014 9:121592772-121592794 CCTTCCCCAAGGGATGTGTCTGG - Intronic
1060530972 9:124346827-124346849 CGCTCCCCCGTGGCTGTGGCCGG + Intronic
1061678521 9:132231424-132231446 CCCTCCACCAGGGCTCTGTGGGG + Intronic
1061849798 9:133407715-133407737 ACCTCCCCCATGTCTGTGTCAGG + Intronic
1061899410 9:133665386-133665408 CATGGCCCCAGGGCTGTGTCAGG + Intronic
1062394633 9:136347885-136347907 GTCTCTGCCAGGGCTGTGTTGGG + Intronic
1062595616 9:137297785-137297807 CTGCCCCCTAGGGCTGTGCCTGG + Intergenic
1062595625 9:137297827-137297849 CTGCCCCCTAGGGCTGTGCCTGG + Intergenic
1062595634 9:137297869-137297891 CTGCCCCCTAGGGCTGTGCCTGG + Intergenic
1062595664 9:137298035-137298057 CTGCCCCCTAGGGCTGTGCCTGG + Intergenic
1062595680 9:137298117-137298139 CTGCCCCCTAGGGCTGTGCCTGG + Intergenic
1062735986 9:138137691-138137713 GTCTGCCCCAGAGCTGGGTCAGG + Intergenic
1185619846 X:1447137-1447159 TTCCCCTCCAGGGCTGTGTTTGG + Intronic
1186410145 X:9339656-9339678 GGCTCCCCCAGGGCTTTGCCAGG + Intergenic
1187244109 X:17538602-17538624 CTCTCCCTGAGGGCTTTCTCTGG - Intronic
1190157890 X:48008365-48008387 CCCTGCCCCAGGGCTGTGCATGG + Exonic
1190173662 X:48131250-48131272 CCCTGCCCCAGGGCTGTGCATGG + Exonic
1194403032 X:93461609-93461631 CTCTTCGCCAGGGCTGGGACTGG - Intergenic
1195331624 X:103807727-103807749 CTCCCCCAAAGGGCTGTGACAGG + Intergenic
1197472898 X:126884103-126884125 CTGTCCCCCAGGGCTGAGCAAGG + Intergenic
1197858624 X:130946446-130946468 CTCTCCTCCAGCTCTGTGTATGG + Intergenic
1198320304 X:135513364-135513386 CTCTCCTGCAGGGCAGTGCCCGG + Intergenic
1199585593 X:149412867-149412889 CTCTGCCCCATGGCTTTGTAGGG - Intergenic
1200081215 X:153577408-153577430 CTTGACCCCAGGGCTGTGTGGGG - Intronic
1200107914 X:153724802-153724824 CTCTTCCCCAGGGGCGAGTCGGG - Intergenic