ID: 962241769

View in Genome Browser
Species Human (GRCh38)
Location 3:133756244-133756266
Sequence ACATCAGCAGGGCTCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962241769_962241775 7 Left 962241769 3:133756244-133756266 CCCTGCAGGAGCCCTGCTGATGT 0: 1
1: 0
2: 2
3: 23
4: 166
Right 962241775 3:133756274-133756296 TGACCCAGGTGTCTGAAGGATGG 0: 1
1: 0
2: 0
3: 22
4: 197
962241769_962241778 13 Left 962241769 3:133756244-133756266 CCCTGCAGGAGCCCTGCTGATGT 0: 1
1: 0
2: 2
3: 23
4: 166
Right 962241778 3:133756280-133756302 AGGTGTCTGAAGGATGGTGCTGG 0: 1
1: 0
2: 3
3: 26
4: 281
962241769_962241781 21 Left 962241769 3:133756244-133756266 CCCTGCAGGAGCCCTGCTGATGT 0: 1
1: 0
2: 2
3: 23
4: 166
Right 962241781 3:133756288-133756310 GAAGGATGGTGCTGGGGATGTGG 0: 1
1: 0
2: 11
3: 97
4: 838
962241769_962241780 15 Left 962241769 3:133756244-133756266 CCCTGCAGGAGCCCTGCTGATGT 0: 1
1: 0
2: 2
3: 23
4: 166
Right 962241780 3:133756282-133756304 GTGTCTGAAGGATGGTGCTGGGG 0: 1
1: 0
2: 4
3: 26
4: 276
962241769_962241773 -7 Left 962241769 3:133756244-133756266 CCCTGCAGGAGCCCTGCTGATGT 0: 1
1: 0
2: 2
3: 23
4: 166
Right 962241773 3:133756260-133756282 CTGATGTGTTTCTTTGACCCAGG 0: 1
1: 0
2: 1
3: 11
4: 179
962241769_962241779 14 Left 962241769 3:133756244-133756266 CCCTGCAGGAGCCCTGCTGATGT 0: 1
1: 0
2: 2
3: 23
4: 166
Right 962241779 3:133756281-133756303 GGTGTCTGAAGGATGGTGCTGGG 0: 1
1: 0
2: 2
3: 23
4: 229
962241769_962241774 3 Left 962241769 3:133756244-133756266 CCCTGCAGGAGCCCTGCTGATGT 0: 1
1: 0
2: 2
3: 23
4: 166
Right 962241774 3:133756270-133756292 TCTTTGACCCAGGTGTCTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962241769 Original CRISPR ACATCAGCAGGGCTCCTGCA GGG (reversed) Intronic
900358049 1:2274181-2274203 ACATGAGCAGAGCTCCTCAAAGG - Intronic
900987234 1:6080292-6080314 CCAGCACCAGGGCTCCAGCACGG - Intronic
901129079 1:6950922-6950944 GCCTGAGCTGGGCTCCTGCAGGG + Intronic
901459350 1:9382457-9382479 ACAGCAGCAGCTCCCCTGCAAGG - Intergenic
901549364 1:9984015-9984037 CCCTTACCAGGGCTCCTGCAAGG - Exonic
901878183 1:12179005-12179027 ACATCAGCAGGCCCCTTGGAGGG + Intronic
906046219 1:42832894-42832916 ACACCAGCAGGGCCTCTGCCAGG - Intronic
910875199 1:91872147-91872169 ACATCGGCATGGTTCCTACAGGG - Intronic
910951569 1:92653715-92653737 AGAGCAGCAGCGTTCCTGCAAGG + Intronic
915691404 1:157694815-157694837 ACAGCAGCAGGCCTCTTTCATGG - Intronic
916479142 1:165199508-165199530 ACATAAGCAATGCTCCTGCTTGG - Intergenic
918202674 1:182281815-182281837 GCATCATCAGCGCTCATGCAGGG + Intergenic
922738080 1:228000334-228000356 ATATCACCAGGCCACCTGCAAGG + Intergenic
924691521 1:246355970-246355992 ACATCAGCTGTGGTCCTACAGGG - Intronic
1064026433 10:11852493-11852515 TCTTCAGCAGCGCTCCTGCCTGG - Intronic
1064243977 10:13654882-13654904 ACCTGAGCAGGGCTCATACAGGG + Intronic
1067879927 10:50034473-50034495 GGCTCAGCAGGGTTCCTGCAAGG - Intergenic
1067891957 10:50144907-50144929 GGCTCAGCAGGGTTCCTGCAAGG + Intergenic
1070808683 10:79286348-79286370 ACATCAGCAGGGCTGCTGTGGGG + Intronic
1071057284 10:81526737-81526759 ACTTCAGCAGGGCTCCACAAAGG + Intergenic
1073005213 10:100318456-100318478 ACATCAGCAGTACTCCAGCCTGG + Intronic
1074297953 10:112208598-112208620 ATATCCCAAGGGCTCCTGCATGG + Intronic
1075328680 10:121556032-121556054 ACAACAGTAGGGCACCTGGAGGG + Intronic
1075581198 10:123619919-123619941 ACCTTAGCAGGCCTTCTGCAAGG - Intergenic
1076187754 10:128462198-128462220 GCATAAGCTGAGCTCCTGCAGGG + Intergenic
1076477223 10:130761310-130761332 AGGTCAGCAGGGCTCATGCTAGG + Intergenic
1077557569 11:3233115-3233137 ACATCAGCAGGCATCCCCCAGGG + Intergenic
1078333061 11:10441931-10441953 ACATCAGCAGGACTCCCTCCTGG - Intronic
1080645591 11:34185391-34185413 ACATCACAAGGGCAGCTGCAGGG + Intronic
1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG + Intergenic
1082810835 11:57477887-57477909 ACAAGAGCAGTTCTCCTGCAAGG + Intergenic
1083059066 11:59850575-59850597 ACAGCACCAGGGATCCTGGAAGG + Intergenic
1084663153 11:70558850-70558872 ACAGCAGCACAGCTGCTGCATGG + Intronic
1087139610 11:94752486-94752508 TCATAAGCAGGGGTCCTGTAAGG - Intronic
1090788758 11:130070984-130071006 GCCACAGCAGGGCTCCTCCAAGG - Intronic
1092173583 12:6388390-6388412 GCATCAGCATGGTTCCTGCCAGG - Exonic
1092856080 12:12675027-12675049 TCAGCAGCAGGGGTCCTGGAGGG - Intronic
1095506667 12:42905874-42905896 CCATCAGCAGGGAACCTACAAGG + Intergenic
1096510470 12:52125204-52125226 CCCACAGCAGGGCTCTTGCAGGG - Intergenic
1098069515 12:66657211-66657233 TCATCAGCAAGGGTCCTGAAAGG + Intronic
1102292872 12:111715270-111715292 ACCTCAGCCAGGATCCTGCAAGG + Intronic
1104736477 12:131138605-131138627 ACCTGAGCAGGGCTCCAGCAGGG - Intronic
1104858426 12:131912676-131912698 CCATCAGCATGGCTTCTGCGGGG + Intronic
1105578106 13:21671387-21671409 ACATCAGCATGAATCCTTCAAGG - Exonic
1107420669 13:40243315-40243337 GCATCAGAAGGGCTGCAGCAAGG + Intergenic
1108158859 13:47617353-47617375 ACTTAAGCAGGACTCATGCAGGG + Intergenic
1110556720 13:76868471-76868493 ACAACAGCTGGGCCCCTGGATGG - Intergenic
1113963024 13:114135816-114135838 ACGTCAGCAGGGCTGGAGCAGGG + Intergenic
1114497949 14:23146891-23146913 CCAGCAGCAGGGCTCCTGACCGG - Intronic
1115811640 14:37115426-37115448 ACATGAGGACGGCCCCTGCATGG + Intronic
1117471410 14:56050146-56050168 ACATTAGCTGGCCTCCTGAAAGG + Intergenic
1120151140 14:81035390-81035412 CCATTATCAGGTCTCCTGCAAGG - Intronic
1120746260 14:88154678-88154700 ACAGCAGCTGTGCTTCTGCAAGG + Intergenic
1124162922 15:27290480-27290502 ACATCAGCAGGGCTAAATCATGG + Intronic
1127543676 15:59968683-59968705 TTATTACCAGGGCTCCTGCAAGG - Intergenic
1128378186 15:67092143-67092165 AGATCAGGAGGCCTCCAGCAGGG - Intronic
1128749071 15:70135587-70135609 ACAGGAGCAAGGCTCCAGCATGG - Intergenic
1128894040 15:71356691-71356713 AAATCCTCAGGGCTCATGCAGGG + Intronic
1130878652 15:88035675-88035697 ACTTCAGCAAAGCTCCGGCATGG + Intronic
1131065104 15:89429665-89429687 CCAACAGCAGGGCTCTTTCAAGG - Intergenic
1131225884 15:90624130-90624152 ACATCAGCAGAGCACCTCCCAGG - Intronic
1132666210 16:1082415-1082437 ACACCTGCAGGGCACCAGCATGG + Intergenic
1133335504 16:5004393-5004415 ACATCAGCCGGGGTCCTGGCTGG + Intronic
1134025680 16:10951253-10951275 GCATCTGCAGAGCTCCTGCTGGG + Intronic
1134814577 16:17195256-17195278 ACATCAGCAGTGCCACTGCTAGG + Intronic
1135956213 16:26958511-26958533 ACAGCAGCTGGTCTCCTGCTAGG + Intergenic
1136395687 16:29991391-29991413 GCAGCAGCAGGGCTCCGCCACGG - Intronic
1138489759 16:57369929-57369951 ACATCAGCAGGACTCCACCACGG - Intergenic
1140332350 16:74070257-74070279 CGATCAGAAGTGCTCCTGCAAGG + Intergenic
1141644088 16:85358175-85358197 ACATCCTAAGGGCTTCTGCATGG + Intronic
1142979699 17:3664448-3664470 CCATCAGCAGGGCCGGTGCATGG - Intronic
1147949247 17:44097825-44097847 CTCTCTGCAGGGCTCCTGCAAGG - Intronic
1147953213 17:44118514-44118536 GCCTCAGCAGGGCTACTGCTGGG - Intronic
1149479899 17:56994811-56994833 ACATCAGCCCGCCTCCTGCATGG + Intronic
1149689792 17:58565792-58565814 ACAGCAGCAGGGCTCATCCACGG - Exonic
1154318746 18:13327152-13327174 CTATCTGCAGGGCTTCTGCATGG + Intronic
1157393170 18:47319996-47320018 GCATTAGCCTGGCTCCTGCAAGG + Intergenic
1160912645 19:1481974-1481996 CCAGCAGCAGGGCTCCTGCATGG - Exonic
1164450578 19:28359692-28359714 ATATCACAAGGGCTCCTGAAAGG + Intergenic
1164576686 19:29409280-29409302 CCCTGAGCTGGGCTCCTGCAGGG + Intergenic
1164840746 19:31390445-31390467 ACATCTCCAGAGTTCCTGCAAGG + Intergenic
1165579781 19:36851883-36851905 ACATCCACAAGGCACCTGCAAGG + Exonic
1166177972 19:41088229-41088251 ACTTCAGGAGGGTTGCTGCAGGG - Intergenic
1166360760 19:42252117-42252139 AGATCACAAGGTCTCCTGCAAGG + Intronic
1168689053 19:58366127-58366149 ACACCAGGAGGGCTGCTGCTTGG + Intergenic
927600925 2:24440053-24440075 ACAGCAATAGGGCTCCTGTATGG + Intergenic
930243145 2:48956601-48956623 ACATCATCAAGGCTTCAGCATGG + Intergenic
931443373 2:62306911-62306933 CCAGCAGCAGGCTTCCTGCAGGG + Intergenic
935217208 2:100983636-100983658 AGAGCAGCAGGGCTCTGGCATGG - Intronic
935707278 2:105868100-105868122 GCATCTGTAGGGCTCCTGCATGG + Intronic
938289955 2:130143831-130143853 GCTTCAGGAGGGCTCCAGCAAGG - Intronic
938339440 2:130525823-130525845 ACAAAAGCATGGCTGCTGCAGGG + Intronic
938350398 2:130594929-130594951 ACAAAAGCATGGCTGCTGCAGGG - Intronic
938466568 2:131529106-131529128 GCTTCAGGAGGGCTCCAGCAAGG + Intronic
939857750 2:147381017-147381039 ACATCAGTAGGCCTCATTCATGG - Intergenic
943360512 2:186913312-186913334 AGCTCAGAAGGGCTCTTGCAGGG - Intergenic
943441353 2:187931837-187931859 GAATCACCAGGGCTCCTGGAGGG + Intergenic
944608978 2:201380808-201380830 ACATCAGGAGGGTTCCGGGAGGG + Exonic
945320929 2:208422855-208422877 ACATCAGAAGGGATCCTTCTGGG - Intronic
947324464 2:228959388-228959410 GCATCAGCAGGGCTGAAGCATGG - Intronic
1170609874 20:17903804-17903826 AGATTAGCATGGCCCCTGCAAGG + Intergenic
1174187339 20:48716151-48716173 CCATCAGCCTGGCTCCTGGAGGG - Intronic
1174227528 20:49014220-49014242 AGTTCAGCAGGGCTCCTGACTGG + Intronic
1174278995 20:49424871-49424893 ACAGGAGCAGGCCCCCTGCACGG + Intronic
1175171454 20:57084345-57084367 ACATGTGCTGGGCTCCAGCAAGG - Intergenic
1175881768 20:62263358-62263380 ACAACAGCAGGGCCACTGCGGGG + Intronic
1176690719 21:9904954-9904976 GCATCTGCTGGGCTTCTGCAGGG + Intergenic
1178597569 21:33968482-33968504 ACATGACCATGGCTACTGCAAGG + Intergenic
1178846370 21:36177178-36177200 ACATCATCAGAGCCCCAGCATGG - Intronic
1179013543 21:37574972-37574994 GCATCTGCAGGGGTCCTGCTGGG - Intergenic
1179985472 21:44918423-44918445 ACTTCCCCAGGGCTCCTGCCAGG - Intronic
1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG + Intergenic
1180825685 22:18859291-18859313 TCATCAGCAGGGCTCATGTGGGG + Intronic
1181596428 22:23917924-23917946 ACAGCATGAGGGTTCCTGCAGGG - Intergenic
1183080450 22:35452445-35452467 ACATCTGCCGGGCACCTGCCCGG - Intergenic
1184111391 22:42397648-42397670 ACACGTGCAGGGCTCCTGGAAGG - Intronic
1184378847 22:44132349-44132371 ACATCACCACTTCTCCTGCAGGG - Intronic
1185078610 22:48696625-48696647 ACACCTGCAGGGATCCTTCAGGG - Intronic
1203214802 22_KI270731v1_random:195-217 TCATCAGCAGGGCTCATGTGGGG - Intergenic
952927945 3:38335512-38335534 ACAGCTGCCGGGCTCCTGCAGGG - Intergenic
954671329 3:52292790-52292812 ACAGCTGCAGGGCTCGGGCAGGG + Exonic
960535366 3:118809407-118809429 CCATCATCAGGGTTCCAGCATGG + Intergenic
961388296 3:126536777-126536799 ACTTCAGCTGGGGGCCTGCAGGG + Intronic
961810387 3:129518636-129518658 AGGCCAGCAGGGGTCCTGCAGGG - Intronic
962222506 3:133574821-133574843 ACTTCCGCTGGGTTCCTGCATGG - Intronic
962241769 3:133756244-133756266 ACATCAGCAGGGCTCCTGCAGGG - Intronic
964558232 3:157964352-157964374 TCATCAGCATGGCTGCTGCAGGG + Intergenic
965296617 3:166955458-166955480 ACATCAGCTGTGGTCCTACAGGG + Intergenic
967007741 3:185400181-185400203 ACATCAGCAGGGCTGGTGAGAGG - Intronic
969701234 4:8768872-8768894 ACAACAGCTGGGCTCCTGGTGGG + Intergenic
969957856 4:10910467-10910489 ACATCAGCTGTTCTCCTTCAGGG + Intergenic
972391828 4:38621336-38621358 AGTTCAGCAGGCCTCCTGTAAGG + Intergenic
975974671 4:80081379-80081401 AAATCAGGAGGACTTCTGCATGG + Intronic
976350083 4:84051208-84051230 ACATCAGCAGGGCTTCTTTGAGG + Intergenic
977322725 4:95539261-95539283 ACAACAGCAGTTCTCCTCCACGG + Intronic
985490418 5:175570-175592 ACACGACCAGGGCTCCTGCACGG + Intronic
985490434 5:175628-175650 ACACGACCAGGGCTCCTGCACGG + Intronic
985490451 5:175687-175709 ACACGACCAGGGCTCCTGCACGG + Intronic
985490468 5:175746-175768 ACACGACCAGGGCTCCTGCACGG + Intronic
985490485 5:175805-175827 ACACGACCAGGGCTCCTGCACGG + Intronic
985490502 5:175864-175886 ACACGACCAGGGCTCCTGCACGG + Intronic
985490518 5:175922-175944 ACACGACCAGGGCTCCTGCACGG + Intronic
985490534 5:175980-176002 ACACGACCAGGGCTCCTGCACGG + Intronic
986892193 5:12322104-12322126 ACATCTGGAGGGCTCCTCCATGG - Intergenic
988724198 5:33909531-33909553 ACATCAGCAGTGTGCCTGCAGGG + Intergenic
989355432 5:40539130-40539152 ACATCAGCTGTGGTCCTACAGGG + Intergenic
989528016 5:42475399-42475421 ACATTAGCAGGGTTCCTTCCAGG - Intronic
989606151 5:43246163-43246185 ACCTCAGCAGAGCCCCTGCAAGG + Intronic
990447248 5:55904391-55904413 ACATCTCCAAGGCTCCAGCAGGG + Intronic
994294336 5:98071246-98071268 AGTTCCTCAGGGCTCCTGCAAGG - Intergenic
995076249 5:107987582-107987604 GCATGAGCAGGGCTCATGCCAGG - Intronic
996499000 5:124195518-124195540 ACATCCACAGTGCTCCTGCAAGG - Intergenic
998774880 5:145588066-145588088 ACATCAGTGGGGCTGCTGGAAGG - Intronic
1001118405 5:168958721-168958743 AGATCAGAAGGTCACCTGCAAGG + Intronic
1001989418 5:176104003-176104025 ACATGAGCAGGCCCCTTGCACGG - Intronic
1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG + Intronic
1003350911 6:5317049-5317071 ACATCAGTTAGGCTCTTGCATGG + Intronic
1003549154 6:7086402-7086424 ACCTCACCAGGCCTCCTTCAAGG + Intergenic
1011255618 6:85417988-85418010 AAATCAGTGTGGCTCCTGCAGGG - Intergenic
1017694274 6:156998962-156998984 AAATCAGCAGAGCTACTGGAAGG + Intronic
1019436894 7:1027016-1027038 ACATCTTCCAGGCTCCTGCACGG - Intronic
1019738466 7:2661624-2661646 GCATCAGCAGGGCCCCTGCATGG - Intronic
1019921798 7:4167950-4167972 GCATCAGCAGGGCGGCTCCATGG - Intronic
1023225748 7:37967088-37967110 ACAAAGGCAGGGCTCCAGCAGGG + Intronic
1024004088 7:45212563-45212585 ACCCCAGCAGGTCTCCTGTAGGG - Intergenic
1025233187 7:57216629-57216651 ACAACAGCATTGCTCCTCCATGG - Intergenic
1026256298 7:68715091-68715113 AGATCAGCTGGGCTGCAGCAGGG - Intergenic
1029036031 7:97523032-97523054 ATATCAACAGGGCTCCTGTATGG - Intergenic
1029187167 7:98747524-98747546 GCATCTGCAGGGCTCCTTCAAGG + Intergenic
1029622369 7:101698185-101698207 ACCTCTGCAGGGCTCAGGCAAGG - Intergenic
1030233881 7:107237723-107237745 ACAACAGCAAGGCTGCTGAAGGG + Intronic
1036295109 8:7528889-7528911 GCATCAGCAGGGCTCTGGGAGGG - Intergenic
1036327454 8:7792102-7792124 GCATCAGCAGGGCTCTGGGAGGG + Intergenic
1038088720 8:24229718-24229740 ACATTAGCATGGCTTCTGAATGG + Intergenic
1038584913 8:28779672-28779694 ACACCAGCCGGAGTCCTGCAAGG + Intronic
1039267568 8:35842019-35842041 ACACCAGCAGGGAACCAGCAGGG + Intergenic
1042228051 8:66530314-66530336 ACTCCAGCACTGCTCCTGCATGG + Intergenic
1045548080 8:103146228-103146250 TCCTCTGCTGGGCTCCTGCAGGG - Intronic
1047616250 8:126564763-126564785 AAAACAGCAGGCCTCCAGCAGGG - Intergenic
1048144955 8:131832456-131832478 ACTTTAACAGAGCTCCTGCAAGG - Intergenic
1049331491 8:142056440-142056462 ACCCCCGCTGGGCTCCTGCAAGG + Intergenic
1050012793 9:1201816-1201838 ACAGGAGCAGGGCTGCTCCAAGG - Intergenic
1050958945 9:11702954-11702976 AGATCAGCCTGACTCCTGCAAGG - Intergenic
1055422749 9:76161299-76161321 CCCTCAGCAGGCCGCCTGCAGGG + Intronic
1057830234 9:98400660-98400682 ACCCCACCATGGCTCCTGCAGGG + Intronic
1060887446 9:127165204-127165226 ACAATAGCAGTGCTCCTGGAGGG + Intronic
1062188433 9:135231095-135231117 GCATGAGGGGGGCTCCTGCAGGG - Intergenic
1187733435 X:22279866-22279888 GTCTCAGCTGGGCTCCTGCATGG - Intergenic
1188084154 X:25882785-25882807 AGCTCAGCAAGGCTGCTGCAGGG + Intergenic
1189211626 X:39288822-39288844 ACATGAGCAGGGCAGCAGCAGGG + Intergenic
1194379727 X:93177662-93177684 ACATCACCTGGGCTCCTGGATGG - Intergenic
1200121632 X:153793947-153793969 GCCTCAGAAGGGCTCCTTCAAGG + Exonic