ID: 962249040

View in Genome Browser
Species Human (GRCh38)
Location 3:133823716-133823738
Sequence CATCCCTGAGTGGCCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 229}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962249040_962249048 4 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249048 3:133823743-133823765 TAACTGGTGTGGTGTGGGGCTGG 0: 1
1: 0
2: 1
3: 24
4: 345
962249040_962249052 17 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249052 3:133823756-133823778 GTGGGGCTGGGGATGGAATATGG 0: 1
1: 0
2: 8
3: 61
4: 751
962249040_962249044 -2 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249044 3:133823737-133823759 TGTTCCTAACTGGTGTGGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 151
962249040_962249043 -7 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249043 3:133823732-133823754 AGGGATGTTCCTAACTGGTGTGG 0: 1
1: 0
2: 1
3: 4
4: 94
962249040_962249045 -1 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249045 3:133823738-133823760 GTTCCTAACTGGTGTGGTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 109
962249040_962249051 10 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249051 3:133823749-133823771 GTGTGGTGTGGGGCTGGGGATGG 0: 1
1: 2
2: 35
3: 432
4: 3924
962249040_962249049 5 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249049 3:133823744-133823766 AACTGGTGTGGTGTGGGGCTGGG 0: 1
1: 1
2: 6
3: 36
4: 731
962249040_962249046 0 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249046 3:133823739-133823761 TTCCTAACTGGTGTGGTGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 150
962249040_962249050 6 Left 962249040 3:133823716-133823738 CCTGGAGGGGCCACTCAGGGATG 0: 1
1: 0
2: 2
3: 20
4: 229
Right 962249050 3:133823745-133823767 ACTGGTGTGGTGTGGGGCTGGGG 0: 1
1: 1
2: 6
3: 119
4: 1188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962249040 Original CRISPR CATCCCTGAGTGGCCCCTCC AGG (reversed) Intronic
900525319 1:3125662-3125684 CATCCCTCAGTGGCTCTCCCAGG + Intronic
900528839 1:3142809-3142831 CATCCATCAGTTTCCCCTCCTGG - Intronic
900902536 1:5526803-5526825 CATCCCTGAGTGGGCACCCAGGG + Intergenic
901459513 1:9383247-9383269 CATCCCAGAGTCCCCCCTCGGGG - Intergenic
903141330 1:21340923-21340945 CATCCCTGAGTGCACCCTCCGGG + Intronic
903755812 1:25659698-25659720 CATCCCTGAGTGCATCCTACAGG - Intronic
903892201 1:26577336-26577358 CATCCCTGAGTGTCCCTTGCTGG - Intergenic
904307418 1:29599128-29599150 CATCTCTGAGTGTCACCTCTGGG - Intergenic
904388747 1:30165010-30165032 CAGCCCTGACCGGCCCTTCCAGG - Intergenic
904627648 1:31815966-31815988 CTTCCCTGAGTTTTCCCTCCTGG + Exonic
905408794 1:37754197-37754219 CACCCGTGAGTCCCCCCTCCAGG - Exonic
908170831 1:61503110-61503132 CTTCCCTGTATGGCCCTTCCTGG + Intergenic
912161278 1:106987635-106987657 CTTCCCTGTGTGGCCCTGCCTGG + Intergenic
915283215 1:154836788-154836810 TCCCTCTGAGTGGCCCCTCCAGG + Intronic
916753900 1:167749977-167749999 CATACCTGAGTGGCCCCAGAGGG + Intronic
920017421 1:202924501-202924523 CCTCCCAGAGTGGCCACACCTGG - Intronic
920109480 1:203577054-203577076 CTGCCCTGAGTGGCCCCCACAGG + Intergenic
920137944 1:203785642-203785664 CATCAATGAGTGGTCCCTCTTGG - Intergenic
920682429 1:208083333-208083355 CACCCCTGGGTGGCCAGTCCTGG + Intronic
923538196 1:234869267-234869289 CCTACCTGCGTGGCCCCTCTTGG + Intergenic
924779357 1:247132099-247132121 CCTCCTTGAGTGGCATCTCCAGG + Intronic
1066010323 10:31188519-31188541 CTTCCATGGGTGGCCCCTGCTGG - Intergenic
1067048482 10:42999138-42999160 CACCTGTGATTGGCCCCTCCAGG + Intergenic
1067088863 10:43256529-43256551 CAGACCAGAGTGGCCTCTCCAGG + Intronic
1068596160 10:58905138-58905160 CCTCACTGAGTGGGTCCTCCAGG + Intergenic
1071455918 10:85851556-85851578 CATCCCTGAGATTTCCCTCCAGG + Intronic
1072291919 10:93971757-93971779 CTTCCCTGTGTGGCCCCTCATGG + Intergenic
1072462342 10:95631194-95631216 GAGCCAAGAGTGGCCCCTCCAGG + Intronic
1072725043 10:97807483-97807505 TTCCCCTGAGTGGCCCCTCCTGG - Intergenic
1072784710 10:98271816-98271838 TATCCTTGACTAGCCCCTCCAGG - Intergenic
1076391520 10:130106090-130106112 CAACCCTGCGTGGCTCCCCCAGG - Intergenic
1076463132 10:130660056-130660078 CCTCCCTGAGTGGCCACAGCTGG - Intergenic
1076734707 10:132453369-132453391 CGTTCCGGAGTGGCCCCTGCAGG + Intergenic
1076838406 10:133032686-133032708 CATCACAGAGAGGCCCCTCCTGG - Intergenic
1077142516 11:1030780-1030802 TGACCCTGAGTGGCCCCCCCAGG - Exonic
1077391727 11:2303462-2303484 TACCCCTGAGTGGCCCCAGCAGG - Intronic
1078519863 11:12054067-12054089 CACCCCTGGGTGTCCCCTCTGGG + Intergenic
1080416171 11:32071970-32071992 ATTCCCTCAGTGGCCCCTACTGG + Intronic
1081709049 11:45205348-45205370 CATCCCTGGGTGACCCTGCCTGG - Intronic
1085034253 11:73290770-73290792 CAGACCTGAGTGTTCCCTCCCGG + Intronic
1085414598 11:76311677-76311699 CTTCCCTGAGAGGCAGCTCCTGG - Intergenic
1088801115 11:113308163-113308185 CTTCCCAGAGTGGTCCATCCTGG - Intergenic
1089189587 11:116644331-116644353 CATGTCTGAGTGGTTCCTCCAGG - Intergenic
1089457256 11:118632819-118632841 CATCTGGGAGTGGCCCCTGCAGG - Intronic
1089704350 11:120266686-120266708 CTCCCTTGAGTGGCCCTTCCAGG + Intronic
1090458642 11:126870547-126870569 GCTCCCATAGTGGCCCCTCCTGG + Intronic
1090657864 11:128859690-128859712 CTTCCCTGCGTGCCCTCTCCTGG + Intronic
1091370039 11:135050071-135050093 CATCCCTGAGTTGGCCTTCTGGG - Intergenic
1091451080 12:572216-572238 CATCGCTGAGAGGCCGCTGCAGG + Intronic
1091792620 12:3280500-3280522 CCTCCCTGCCTGGCCCCACCAGG - Intronic
1091828693 12:3534147-3534169 CTTCCCTCCGTGGGCCCTCCAGG + Intronic
1093808548 12:23465051-23465073 CCTCCCTGAGTGACATCTCCAGG + Intergenic
1093847188 12:23987365-23987387 CATCCATTAGTGGCCCCACTGGG - Intergenic
1098442676 12:70534850-70534872 CCTGCCTGAGTGGACCATCCGGG - Exonic
1101347955 12:103903892-103903914 AAGCCCAGAGTGGCCCCACCTGG + Intergenic
1102904042 12:116660947-116660969 CATGCCTGAGCCTCCCCTCCCGG + Intergenic
1102967752 12:117141240-117141262 CAGCCCAGCGTGGCGCCTCCGGG - Intergenic
1103723666 12:122987545-122987567 CATCCCTGAGTCGCACCGCCTGG - Exonic
1103879779 12:124157284-124157306 CCTCCCAGAGAGGGCCCTCCTGG - Intronic
1104436984 12:128764542-128764564 CATCCCTGTGTGGCCAGTGCTGG + Intergenic
1104682921 12:130763646-130763668 CCTCCCTGGGCAGCCCCTCCAGG - Intergenic
1107374443 13:39786668-39786690 CATCACAGAGTGGCTCTTCCTGG - Intronic
1108384948 13:49890635-49890657 CAACCCTGCGTGGCTCCTCCAGG - Intergenic
1108946243 13:56028401-56028423 CCTCCTTGATTGGCCTCTCCTGG - Intergenic
1109126867 13:58528659-58528681 TAACCCTGCGTGGCTCCTCCAGG - Intergenic
1109736552 13:66492661-66492683 CATCTCTGAGTGGCACCTGGTGG - Intronic
1110287602 13:73767893-73767915 CCTACCTGAGTGGCACCCCCTGG + Intronic
1112292680 13:98158880-98158902 CATCCCTGTCTAGCTCCTCCAGG - Intronic
1113675234 13:112202458-112202480 CACCCTTCAGTGTCCCCTCCAGG - Intergenic
1113699899 13:112376476-112376498 CATCCCTGTGGGGCCCTACCTGG - Exonic
1113778380 13:112961799-112961821 CATCCATCAGTGGCCTCTCCTGG - Intronic
1113917519 13:113883428-113883450 CGTCCCTCAGCGGCCCCTGCGGG + Intergenic
1115822114 14:37223786-37223808 CCGCCCTGCCTGGCCCCTCCTGG + Intronic
1116907951 14:50423943-50423965 CATTCCTCAGTGGTCCCTACTGG + Intronic
1121088333 14:91163646-91163668 CATCACGGAGTGGCCTCTGCTGG - Intronic
1121719135 14:96097141-96097163 CCTCCCTGTGTGGCTCCTGCAGG + Intergenic
1121885106 14:97535645-97535667 CATCTTAGAATGGCCCCTCCAGG - Intergenic
1122373264 14:101241209-101241231 CATCTCTGAGTGGGACCTGCAGG - Intergenic
1124606827 15:31175695-31175717 CATGCCTGACTGGCACCACCAGG + Intergenic
1125550197 15:40539209-40539231 CATCCCTGCCTGGCCCGCCCTGG + Intronic
1127867576 15:63044185-63044207 CTTGCCTGCGTGGCCACTCCGGG + Intronic
1128493060 15:68170022-68170044 CTTCCATGAGTGGTGCCTCCTGG + Intronic
1129189690 15:73930154-73930176 CAGCACTGAGATGCCCCTCCTGG - Intronic
1129255226 15:74330512-74330534 CATCCCTGAGAGGACCCAGCTGG - Intronic
1130927124 15:88394067-88394089 CATCCCTTCTTGGCTCCTCCAGG - Intergenic
1131063165 15:89416857-89416879 CAGCCCGGAGTGTCCCCGCCAGG - Intergenic
1131303933 15:91224434-91224456 CCTCACTGAGTAGCCCCTCAGGG - Intronic
1131799470 15:96054173-96054195 CAACCCTGAGTTTCCACTCCTGG - Intergenic
1132847960 16:2009387-2009409 CCGCCCTGGGTGGCCCCACCAGG + Intronic
1133224187 16:4332811-4332833 AATCCCTGAGAGGCACCTCCTGG - Intronic
1134049655 16:11128530-11128552 CATAGCTGAGTGGCACTTCCAGG - Intronic
1136268100 16:29132493-29132515 CGACCCTGGGAGGCCCCTCCTGG + Intergenic
1137447635 16:48541510-48541532 CATCCCAGAGTGCTCCCTCCAGG - Exonic
1140224594 16:73067387-73067409 CACCCCAGCCTGGCCCCTCCAGG + Intergenic
1142071409 16:88092831-88092853 CGACCCTGGGAGGCCCCTCCTGG + Intronic
1142154698 16:88527714-88527736 CGTCCCTGAGTGGCCACCCAGGG + Intronic
1144421788 17:15105376-15105398 AACACCTGAGTGGCCCCTCATGG - Intergenic
1147166719 17:38597302-38597324 CAGCCCTAAGTGGCAGCTCCAGG + Intronic
1148346168 17:46904897-46904919 CATCTCTTTGGGGCCCCTCCCGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1151154822 17:72117116-72117138 CAGCCCTGAGTGGCACATGCCGG + Intergenic
1151227295 17:72656617-72656639 CAGCCCTGACAGGCCTCTCCCGG + Intronic
1151476489 17:74346936-74346958 CATCACTGAGCGCCCACTCCTGG + Intronic
1153526364 18:5998450-5998472 CCTTCCTGAAGGGCCCCTCCAGG - Intronic
1157714766 18:49876369-49876391 CATGCCTGAGTTTGCCCTCCAGG + Intronic
1160390487 18:78527662-78527684 CCTGCCTGTGTGGCCCCGCCTGG + Intergenic
1160920240 19:1516183-1516205 CAACTCTGCGTGGCCCCTGCTGG - Intergenic
1162572728 19:11482281-11482303 GATCCCCGGGTGGCCCCTCTTGG + Intronic
1162893656 19:13751522-13751544 CATCCCTCTGTGGCCCCCACCGG - Intronic
1163370698 19:16899715-16899737 CATCCTTGAGCGTCCTCTCCTGG - Intronic
1163897352 19:20071169-20071191 CCTCCTTGAGTGACCTCTCCAGG + Intergenic
1164705361 19:30315341-30315363 CTTCCCTGACTGCCTCCTCCAGG - Intronic
1166545472 19:43632362-43632384 CATCCCTGTCTGCCTCCTCCAGG + Intronic
1167348598 19:48961906-48961928 CGTCCCTGAGTGGCCCAAGCAGG - Intergenic
1167708104 19:51093804-51093826 CCTCCCTAAGTGCCCCATCCCGG + Intergenic
925160800 2:1681958-1681980 CATCCCTGAGGGGCCCCAGGCGG - Intronic
926170554 2:10550370-10550392 CATCCCTGCCTGGCCTCCCCGGG + Intergenic
926237212 2:11054940-11054962 CTGCCCTGAGTGGCCCCTCATGG + Intergenic
926335978 2:11863222-11863244 CTTCCTTCTGTGGCCCCTCCAGG + Intergenic
928627999 2:33160437-33160459 CGTCCTTGGGTGGCCCTTCCAGG + Intronic
932424273 2:71619380-71619402 CATCACTGAGGGGCCCCTCAGGG - Intronic
936090498 2:109498847-109498869 CTTCCCTGTGTGGCCACGCCGGG - Intronic
937124985 2:119469074-119469096 CATCCCTGAGAGGTGACTCCTGG - Intronic
939855851 2:147357711-147357733 GATCCCTGAGTGACCCACCCTGG + Intergenic
941898388 2:170653619-170653641 CATTGCTGAGTGCCCCATCCTGG + Exonic
943383210 2:187174952-187174974 CCTTCCTGAGAGGCCCCTCATGG + Intergenic
947984716 2:234438373-234438395 CATCTCTGGGTTCCCCCTCCAGG + Intergenic
948619527 2:239225631-239225653 CAGCCCTGCGTGGGCCTTCCTGG - Intronic
948902505 2:240963639-240963661 CCTCCCTGTGCAGCCCCTCCCGG - Intronic
1171456578 20:25275964-25275986 CATCCCTGAGTGCGCCTGCCGGG + Intronic
1173548649 20:43916949-43916971 CCTCCCTGACGGGCCCTTCCCGG - Intronic
1173834891 20:46118597-46118619 CTTCCCTGAGCGGCCCCTGTAGG - Intronic
1174282156 20:49447167-49447189 CACCCCTGGCTGCCCCCTCCTGG - Intronic
1175324103 20:58110569-58110591 CCTCCCTGAGAGGCATCTCCTGG + Intergenic
1175598402 20:60253633-60253655 CAGCCCAGTGTGGCCTCTCCAGG + Intergenic
1175767023 20:61598867-61598889 CTTCCCTGGATGGCTCCTCCAGG + Intronic
1176005526 20:62860784-62860806 CCTCCCTCAGTGGCCCCGCCTGG - Intronic
1176046559 20:63096006-63096028 CATCCCTGAATGTCCACACCGGG + Intergenic
1176237430 20:64060175-64060197 CAGCACAGAGAGGCCCCTCCTGG - Intronic
1178358863 21:31931761-31931783 CAACCCTGAGCGGCTCCCCCAGG + Intronic
1179151571 21:38813358-38813380 AACCCCTGAGCTGCCCCTCCTGG + Intronic
1179479159 21:41666798-41666820 TCTCCCAGAGAGGCCCCTCCGGG - Intergenic
1179962708 21:44779143-44779165 CAGCCCTGAGTGCCGCCTCCAGG - Intronic
1180986058 22:19904492-19904514 GATGCCTGAGTGGCCTCTCTGGG + Intronic
1182060004 22:27390321-27390343 CAGCCCTCATTGTCCCCTCCCGG + Intergenic
1182349295 22:29690009-29690031 CGTTCCTGAGTGCCCCCTGCTGG - Intronic
1184029530 22:41883769-41883791 CAGCCCTGTGTTCCCCCTCCTGG - Intronic
1184186269 22:42867377-42867399 GACCCCTGAGTGGCCCAACCTGG - Intronic
1184431221 22:44442404-44442426 CATGCCTTGGTGTCCCCTCCTGG + Intergenic
1184431525 22:44443894-44443916 CATGCATGTGTGGCCCCTCTCGG + Intergenic
1185285455 22:49997891-49997913 CGTCCCTCAGAGCCCCCTCCTGG - Intronic
1185332572 22:50258301-50258323 CAACCCTATGTGGCCCCCCCAGG - Exonic
949234702 3:1793963-1793985 CATCCCTGCTTGGCCTCTCATGG + Intergenic
950506931 3:13400780-13400802 CACGGCTTAGTGGCCCCTCCTGG - Intronic
953805740 3:46065915-46065937 CATCCCTACGTGGCCTCTTCCGG - Intergenic
954269030 3:49492847-49492869 CATGCCTGAGTAGCCCAACCTGG - Intronic
954707974 3:52491221-52491243 CTTTCCTGTGTGGGCCCTCCTGG + Intronic
954983944 3:54772909-54772931 CATTCCTGATCAGCCCCTCCAGG + Intronic
958471872 3:94531489-94531511 CTTACTTCAGTGGCCCCTCCAGG - Intergenic
961199897 3:125037300-125037322 CATTCCTAAGTGGCTTCTCCAGG - Intronic
961374869 3:126457437-126457459 CATCCTTGAAAAGCCCCTCCAGG - Intronic
961816038 3:129550886-129550908 CATCCCTGGATGACCCTTCCGGG - Intronic
961820160 3:129571795-129571817 CATGCCTGAGGGGGCCCTGCCGG - Exonic
962249040 3:133823716-133823738 CATCCCTGAGTGGCCCCTCCAGG - Intronic
963247441 3:143075816-143075838 CAACCCTGAGAGGTCCCTCTTGG - Intergenic
963400375 3:144790624-144790646 CATCCTTGAGTGACATCTCCAGG - Intergenic
965134327 3:164741990-164742012 CATCCCTGAGCACCACCTCCTGG + Intergenic
966539543 3:181074681-181074703 CCTCCTTGAGTGGCATCTCCAGG - Intergenic
967685296 3:192409932-192409954 CCACCCTGAGCGCCCCCTCCCGG - Intronic
968494773 4:909516-909538 CATCCCTGACACGCCGCTCCCGG - Intronic
968555011 4:1242429-1242451 CTTGGCTGAGTGGCCCCTTCTGG - Intronic
968869644 4:3235140-3235162 CTACCCTGAGTGGCTCCCCCAGG - Intronic
968916117 4:3497722-3497744 CATCCCTGACTGTCCCCTCCAGG - Intronic
968966035 4:3769538-3769560 CATCCCTGGGAGGCCCCCCTGGG + Intergenic
969525618 4:7702532-7702554 CCACCCTCAGTGTCCCCTCCCGG + Intronic
970952653 4:21775285-21775307 CCTCCTTGAGTGACCTCTCCAGG - Intronic
974768750 4:66383349-66383371 CCTCCTTGAGTGACACCTCCAGG + Intergenic
976282782 4:83341714-83341736 CCTCCCTGAGTGCCACCTCCAGG + Intergenic
979583791 4:122391185-122391207 CCTCCCTGAGTGACATCTCCAGG - Intronic
984540835 4:181035154-181035176 CACCCTTGTGTGGCCGCTCCTGG - Intergenic
984699589 4:182809926-182809948 CATCCCCGAGAGGGCCCTCCAGG + Intergenic
985669306 5:1198279-1198301 CATTCCTGAGTCCCCACTCCAGG + Intergenic
985739206 5:1605140-1605162 CATCCCTCAGCGGCCCTTTCTGG - Intergenic
985947477 5:3197691-3197713 CATCCCGCAGTAGCCTCTCCAGG - Intergenic
987380327 5:17279117-17279139 CATCCCAGGATGGCCCTTCCTGG + Intergenic
992802030 5:80302501-80302523 CTTCCCTGTGTGGCCCCTCATGG + Intergenic
994344614 5:98669414-98669436 CCTCCTTGAGTGGCATCTCCAGG + Intergenic
998530441 5:142879649-142879671 AATACCAGAATGGCCCCTCCGGG - Intronic
998610543 5:143683377-143683399 CATCCACCAGTGGCTCCTCCGGG + Intergenic
998810152 5:145958318-145958340 CCTCCCTGAATGGCCCCAGCTGG + Intronic
1002080361 5:176733821-176733843 TGTCCTTGAGGGGCCCCTCCTGG - Intergenic
1002377837 5:178801052-178801074 AATCCCTCACTGACCCCTCCAGG + Intergenic
1002955703 6:1861383-1861405 CACACTGGAGTGGCCCCTCCTGG - Intronic
1005922662 6:30415824-30415846 CATCCCAGAGAGTTCCCTCCTGG + Intergenic
1006072316 6:31506738-31506760 CATCCCGGAGAGTTCCCTCCTGG + Intronic
1006654089 6:35575645-35575667 CACCCCTCAGTGAACCCTCCGGG + Exonic
1007115997 6:39343677-39343699 CCTCCCTCGGTGGCTCCTCCTGG - Intronic
1007273640 6:40657682-40657704 CATTCCTGCCTGGCCCCTGCTGG + Intergenic
1007710478 6:43820123-43820145 CAAGCCTGAGTGGCCTCCCCTGG + Intergenic
1014489351 6:122043063-122043085 CCTCCCACACTGGCCCCTCCTGG - Intergenic
1017550266 6:155498504-155498526 CATTCATGTGAGGCCCCTCCAGG + Intergenic
1017744903 6:157437265-157437287 CATTCCTGCATGGCCCCTGCAGG - Intronic
1017793588 6:157822936-157822958 CAACCCTGCGTGGCCGCCCCAGG - Intronic
1019049125 6:169169933-169169955 CAGCCCTGAGTGCCCACACCTGG + Intergenic
1020699537 7:11462251-11462273 CATCCCTGAGAGGCTTCACCTGG + Intronic
1022923516 7:35038022-35038044 CGCCCCTAAGTGGCCGCTCCGGG - Exonic
1023237551 7:38106404-38106426 TATCCCTGCTTGGCCCCTGCAGG + Intergenic
1025044394 7:55680720-55680742 CATCCCTCTGTGACGCCTCCAGG + Intergenic
1029424457 7:100487257-100487279 CTTCCCTGAATGAACCCTCCCGG - Intronic
1032398889 7:131610152-131610174 CAGCCCTGAGTCAGCCCTCCTGG + Intergenic
1033483215 7:141762193-141762215 CATCCCTGAGTGGCCTTGCATGG - Intronic
1033879185 7:145860649-145860671 CCTCCCTGAGTGACATCTCCAGG + Intergenic
1033879499 7:145863050-145863072 CCTCCCTGAGTGACATCTCCAGG + Intergenic
1034451106 7:151137798-151137820 GCTCCTTGAGGGGCCCCTCCTGG - Intronic
1035198382 7:157242004-157242026 CATCCCTCAGCTGCCACTCCTGG - Intronic
1035365881 7:158349176-158349198 CACCCCTGGGTGGCCCCTGAGGG + Intronic
1035366030 7:158349677-158349699 CACCCCTGGGTGGCCCCTGAGGG + Intronic
1035366074 7:158349828-158349850 CACCCCTGGGTGGCCCCTGAGGG + Intronic
1035582079 8:746833-746855 CATCCCGGTGTAGCCCCTGCTGG + Intergenic
1035599400 8:888701-888723 CCTCCCTGAGTGACATCTCCAGG - Intergenic
1036443811 8:8804524-8804546 CATCTCTGAGAGGCCCCAACTGG - Intronic
1036739373 8:11347436-11347458 CGTCCGTGCGTGGCCCCGCCAGG - Intergenic
1036812966 8:11880236-11880258 CATCCCTGTGTGGCTCATTCGGG - Intergenic
1039374277 8:37017415-37017437 CATCCCTCAGTGACCCTGCCGGG - Intergenic
1045705353 8:104916335-104916357 CCTCCCTGAGTGACATCTCCAGG - Intronic
1047495087 8:125403566-125403588 CAGCCCTGAGCGGCCCCTTAGGG - Intergenic
1048318743 8:133382139-133382161 CATCACTGAGACGCCCCTACAGG - Intergenic
1048907060 8:139098566-139098588 CACACCCCAGTGGCCCCTCCTGG + Intergenic
1049362500 8:142219114-142219136 GTTCCCTGAGTGTCACCTCCTGG + Intronic
1049672513 8:143876257-143876279 CTTCCCTGAGGGTCCCCTCTAGG - Intronic
1049813179 8:144585403-144585425 TACCCCTGGCTGGCCCCTCCAGG - Intronic
1051414916 9:16829114-16829136 CTCCCCTGAGTGGCCTCTGCGGG + Intronic
1052369332 9:27645992-27646014 CCTCCCTGAGTGACACCTCCAGG + Intergenic
1055637725 9:78295153-78295175 TATCCCTGAGTGGCCCCTGGAGG + Intergenic
1056809261 9:89751654-89751676 CTGCCCTGAGTGGCCCCACCAGG + Intergenic
1056901112 9:90600249-90600271 CTTCCCCGGGTGGCCCCACCTGG + Intergenic
1056972036 9:91213311-91213333 CATGCCTGAGTAGCCACACCTGG - Intergenic
1057052220 9:91934326-91934348 TATCTCTAAGTGGCCCCTCCTGG - Intronic
1057184369 9:93048679-93048701 CTTCCCTGTGTGGCCCTTCAAGG - Intergenic
1059418865 9:114178747-114178769 CCTCCCCGCATGGCCCCTCCAGG - Intronic
1060148532 9:121271717-121271739 CAGCCCCGGGAGGCCCCTCCAGG - Intronic
1060443297 9:123662105-123662127 CATCCTTTGGTGGTCCCTCCTGG - Intronic
1061385272 9:130285874-130285896 CATCTCAGAGTGGCCCCTGGAGG - Intronic
1185480112 X:439437-439459 GAACCCTGAGTGGCCCAGCCTGG - Intergenic
1186356723 X:8799311-8799333 CACACCTGAATGGCCCCTGCAGG + Intronic
1186357050 X:8800426-8800448 CACACCTGAATGGCCCCTGCAGG + Intronic
1186799812 X:13081515-13081537 CAACCCAGAGTGCCTCCTCCGGG - Intergenic
1189487481 X:41444551-41444573 CAACCCTGGGTAGCCCTTCCTGG - Intergenic
1190298901 X:49044550-49044572 CCACCCTGAGTTGCGCCTCCAGG + Intergenic
1190746023 X:53321859-53321881 CGTCCCTGAGTCTCCCATCCTGG + Intergenic
1192153008 X:68723709-68723731 CATCCCAGAGGGCCCGCTCCCGG - Exonic
1200228592 X:154432790-154432812 CTTACCTCAGTGCCCCCTCCTGG - Intronic