ID: 962249380

View in Genome Browser
Species Human (GRCh38)
Location 3:133826095-133826117
Sequence GCCCCTCCCTTCCTGGGGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 470}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962249380_962249393 27 Left 962249380 3:133826095-133826117 CCACACCCCAGGAAGGGAGGGGC 0: 1
1: 0
2: 5
3: 63
4: 470
Right 962249393 3:133826145-133826167 CATGGAACCACTGAGATGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 174
962249380_962249386 -1 Left 962249380 3:133826095-133826117 CCACACCCCAGGAAGGGAGGGGC 0: 1
1: 0
2: 5
3: 63
4: 470
Right 962249386 3:133826117-133826139 CGGAAACCGCACGTGCCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 6
962249380_962249391 24 Left 962249380 3:133826095-133826117 CCACACCCCAGGAAGGGAGGGGC 0: 1
1: 0
2: 5
3: 63
4: 470
Right 962249391 3:133826142-133826164 CGCCATGGAACCACTGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 55
962249380_962249388 9 Left 962249380 3:133826095-133826117 CCACACCCCAGGAAGGGAGGGGC 0: 1
1: 0
2: 5
3: 63
4: 470
Right 962249388 3:133826127-133826149 ACGTGCCGAAGGGAGCGCCATGG 0: 1
1: 0
2: 0
3: 0
4: 30
962249380_962249385 -2 Left 962249380 3:133826095-133826117 CCACACCCCAGGAAGGGAGGGGC 0: 1
1: 0
2: 5
3: 63
4: 470
Right 962249385 3:133826116-133826138 GCGGAAACCGCACGTGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 21
962249380_962249390 23 Left 962249380 3:133826095-133826117 CCACACCCCAGGAAGGGAGGGGC 0: 1
1: 0
2: 5
3: 63
4: 470
Right 962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962249380 Original CRISPR GCCCCTCCCTTCCTGGGGTG TGG (reversed) Exonic
900104340 1:975966-975988 GCACCTCCCTCCCAGGCGTGGGG + Exonic
900179307 1:1304331-1304353 GCCTCTGCCTGCCTGGGGTTGGG - Intronic
900246475 1:1638464-1638486 TCCCCTGCCTTTGTGGGGTGAGG + Intronic
900257703 1:1705606-1705628 TCCCCTGCCTTTGTGGGGTGAGG + Intronic
900308465 1:2022274-2022296 GCCCCTCACTTCCTCAGGTCAGG - Intronic
900319012 1:2073330-2073352 CCCGCTCCGTTCCTGGGCTGCGG + Intronic
900537972 1:3188185-3188207 GTCCCTCCCTGCCTGGTGTGTGG + Intronic
900558654 1:3292671-3292693 CCACCTCCCTTCCTGTGGGGTGG + Intronic
900760571 1:4467519-4467541 GCCCTTCCCTGTCTGAGGTGTGG + Intergenic
900933312 1:5750339-5750361 GCCCTTCACTGTCTGGGGTGTGG + Intergenic
900940249 1:5793801-5793823 GCACCTGCCAGCCTGGGGTGTGG - Intergenic
901627757 1:10633366-10633388 TCCCCTTCCCTCCTGGGGTCTGG - Intergenic
901674092 1:10872871-10872893 GCCCCTCCCTTGATGGAGTGTGG - Intergenic
902376562 1:16032682-16032704 GCCCCTCACTGCCAGGGTTGCGG + Intronic
902381729 1:16055937-16055959 GCCCCTCACTGCCAGGGTTGTGG + Intronic
902393356 1:16118986-16119008 TCCCACCCCTGCCTGGGGTGGGG - Intergenic
902554480 1:17238874-17238896 GCCTTTCCTCTCCTGGGGTGTGG - Intronic
902824600 1:18964450-18964472 AGCCCTCCCTTCCTGAGATGGGG - Intergenic
902837744 1:19057935-19057957 GCCAGTCTCTACCTGGGGTGGGG + Intergenic
903185644 1:21627332-21627354 GTCCTTCCCCTCTTGGGGTGTGG - Intronic
903654214 1:24939116-24939138 GCCCCTCCAGTCCTGGAGTCTGG - Intronic
904702417 1:32365859-32365881 CCCCCTCCCTTCTTGGGGAGGGG + Intronic
905187579 1:36207594-36207616 ACTCCTTCCTGCCTGGGGTGGGG - Intergenic
905213853 1:36393021-36393043 GGCCCTCCTCCCCTGGGGTGTGG - Intronic
905340581 1:37274781-37274803 GCCCCTTCCTTCCTTGGTGGTGG - Intergenic
905387303 1:37613671-37613693 GCCTCTGCCTCCCTGGGGTCAGG - Intronic
905713918 1:40131847-40131869 CCCCCTCCCTGGCTGGAGTGCGG + Intergenic
905788178 1:40774495-40774517 GACCCTCCCTTCAAAGGGTGAGG - Intergenic
905792733 1:40798939-40798961 GCCCCTCCCTTGTTGGGGTCTGG + Intronic
906033919 1:42739308-42739330 GTCCCTCTCCTTCTGGGGTGTGG - Intronic
906445062 1:45889266-45889288 GCCCCAGCCTTCCTGGGCTCAGG + Intronic
906761223 1:48381145-48381167 GCCACTCACCTCCTGTGGTGTGG + Intronic
907266112 1:53262419-53262441 GCCCTGCCTTTCCTGGGTTGGGG - Intronic
907460351 1:54601981-54602003 GCCGCTCCCTCCCTTGGGGGAGG + Intronic
911047190 1:93638275-93638297 CCAGCTCCCTCCCTGGGGTGGGG + Intronic
912691968 1:111811480-111811502 GTCCCTCCCTTACCTGGGTGTGG + Intronic
912792696 1:112668191-112668213 GCCTCAACCTTCCTGGGCTGAGG - Intronic
913554824 1:119954846-119954868 GCCCCTCCCTTCCATAAGTGAGG - Intronic
914718041 1:150267778-150267800 TCATCTGCCTTCCTGGGGTGGGG + Exonic
915031912 1:152886940-152886962 GCCTTTCCCTTGCTGGGGTCTGG + Intergenic
915328035 1:155091478-155091500 GCCCCTCCCTTCGGGGTGAGAGG + Intergenic
915514618 1:156405654-156405676 GCTCCTTCCTTCCTGGGCTGGGG + Intronic
915862562 1:159461698-159461720 GCTCCTCCCCTGCTGGGATGGGG - Intergenic
916268912 1:162919427-162919449 GCCATCCCCTTCCTGGGCTGTGG - Intergenic
916650928 1:166833906-166833928 GCCCCTCCCCTGGTGGGGAGAGG - Intergenic
919804873 1:201375612-201375634 GCCCCACCCATCCTAGGGTTAGG - Intronic
919907085 1:202085566-202085588 CCCCTTCCCTACCCGGGGTGGGG - Intergenic
921299378 1:213736051-213736073 GTCCCTGCCTTACTGGGATGAGG - Intergenic
922237535 1:223733360-223733382 GCCCAGCCCATCCTGGGGGGTGG - Intronic
922416668 1:225428234-225428256 GCCCCACCCTGCCTGGGGGCGGG + Intronic
922471843 1:225881890-225881912 GCCTCTGCCTTCCTGGCGTCAGG + Intronic
922696002 1:227731407-227731429 CCTCCTCCCCTGCTGGGGTGAGG + Exonic
922712486 1:227844528-227844550 GCTCCTCCCTACATGTGGTGGGG + Intronic
922775193 1:228211312-228211334 GCCACTCCCTACCTGCGGGGTGG - Intronic
924713890 1:246554344-246554366 GCCGCTCACTTCCTGCTGTGTGG - Intronic
924853859 1:247857150-247857172 GCGCCTGCTTTCCTGGGGCGTGG + Intergenic
1062860367 10:805425-805447 GCCCCTCCCATCCCTGCGTGGGG - Intergenic
1063281417 10:4633405-4633427 GCTCCTTCCTTCCGGGTGTGGGG + Intergenic
1064772162 10:18734685-18734707 GTCCTTCTCTTTCTGGGGTGGGG + Intergenic
1065078448 10:22103954-22103976 GCTCCTCCCTTTCTGGGTGGTGG - Intergenic
1065126537 10:22579520-22579542 TCCCCTCCCCTCCAAGGGTGAGG - Intronic
1065187120 10:23179168-23179190 GCCACTCCATGCCTGGGATGAGG + Intergenic
1069873228 10:71545896-71545918 GCCCGTCACTCCCTGGGGGGTGG - Intronic
1070756119 10:78994236-78994258 GCCCCACCCAGCCTGGGGAGTGG + Intergenic
1070790696 10:79187616-79187638 GCCCCTTCCTTCTGGGGCTGAGG + Intronic
1071136492 10:82460025-82460047 GCCTCTCCCTAACTGGAGTGAGG + Intronic
1072806715 10:98428152-98428174 GCCTGTGCATTCCTGGGGTGAGG - Intronic
1073251310 10:102121520-102121542 GCCCCTCCCCTCCTAGGGCTGGG - Intergenic
1073466199 10:103695881-103695903 GTCCCTCCCTGCAGGGGGTGTGG + Intronic
1075428627 10:122362595-122362617 TGCCCTCCCATCCTGAGGTGGGG - Intergenic
1075467633 10:122663541-122663563 GCCCCTCCCTGCCTTGAGTCAGG + Intergenic
1075567130 10:123512870-123512892 TTTCCTCCCTTCCTAGGGTGGGG - Intergenic
1075785702 10:125048634-125048656 GCCCCTGGCTCCCTGGGGTCGGG - Intronic
1076201363 10:128561244-128561266 GCCACTCACCTCCTGTGGTGTGG + Intergenic
1076495135 10:130892012-130892034 TCCCCTCCATTCCTCAGGTGAGG - Intergenic
1076935289 10:133564913-133564935 TCCCCTCCCTTCCCAGGGTGAGG + Intronic
1077183741 11:1227492-1227514 GCCCCTCCCTGCCTGGTGCCCGG - Intronic
1077303610 11:1858179-1858201 GCTGCTCCCTGCCTGGGGAGGGG + Intronic
1077320583 11:1939142-1939164 GCCTCTGCCTTTCTGGGGGGTGG - Intergenic
1077373629 11:2195164-2195186 CCCCCTCCCTGCCCGGGGAGGGG + Intergenic
1077430902 11:2515566-2515588 GCCTCGCCATTTCTGGGGTGGGG + Intronic
1077506662 11:2932713-2932735 GACACTCACTTCCTGGGATGTGG + Intergenic
1078451286 11:11442827-11442849 GTCCCTCCCTCCCAGGGGTTAGG - Intronic
1078910077 11:15722985-15723007 GCCCCTCCCTTTCACAGGTGTGG - Intergenic
1080482937 11:32671186-32671208 ACCCCTCCCTTTCTGGTATGGGG + Intronic
1080652529 11:34234150-34234172 TCCCCTCCCCTGTTGGGGTGGGG + Intronic
1081856033 11:46304599-46304621 GTCCCTGCCTTCATGGGGTTTGG - Intronic
1082789207 11:57335691-57335713 GCCCCTGCCTTCCTGGGACCGGG + Intronic
1083183113 11:61000914-61000936 GCCGCCTCCTTCCTGGGCTGGGG + Intronic
1083272634 11:61580102-61580124 CTCTCTCCCGTCCTGGGGTGGGG - Intronic
1083299149 11:61731203-61731225 ACCCCTCCCTGCCAGGGGTTGGG + Intronic
1083592289 11:63902803-63902825 TCTCCTTCCTTCCTGCGGTGGGG + Intronic
1084033480 11:66494292-66494314 GCCCCTCCCCTCCGAGGGCGGGG + Intronic
1084661758 11:70550306-70550328 GACCCTCCCTACCTGGAGGGTGG + Intronic
1085049708 11:73374004-73374026 GCCAGGCCCTGCCTGGGGTGGGG - Intergenic
1085103609 11:73822764-73822786 GCCCCTCATTTCCTGCTGTGTGG - Intronic
1085259348 11:75195487-75195509 TCCTCTCCCTCCCTGGGGTGAGG - Intronic
1085266966 11:75242799-75242821 GCCCTTCCCTTCCTCGGCTCAGG + Exonic
1085312343 11:75524160-75524182 GTCCCTTCCTTCCTGGGCAGAGG + Intronic
1085854566 11:80161635-80161657 CCTCCTCCCTCCCTGTGGTGAGG + Intergenic
1088425411 11:109696555-109696577 ACCCCACCCTTCCTGGGCAGAGG + Intergenic
1088509778 11:110562416-110562438 GCCCCTACATCCCTGGGGTGGGG + Intergenic
1088920796 11:114258513-114258535 TCCCCTCCCTTCCTGGTGCCAGG - Intronic
1089395800 11:118135873-118135895 CCCCCTCCCACCCTGGGGTTGGG - Exonic
1089495910 11:118908629-118908651 GCTTCTCTCCTCCTGGGGTGGGG + Exonic
1089499143 11:118922578-118922600 GGCCCGCTCTCCCTGGGGTGGGG - Intronic
1089524457 11:119087879-119087901 GCCCCACCCTTCCTGTGGCCAGG + Intronic
1089603853 11:119630374-119630396 GCCCCTGCCCTCCCGGCGTGCGG - Intronic
1089741374 11:120586815-120586837 GCCTCTCCATTCCTGATGTGTGG + Intronic
1091124680 11:133083443-133083465 GCCCTTCCCAGGCTGGGGTGGGG - Intronic
1091325019 11:134679597-134679619 ATCCCTCCCTTTCTGGGGTGGGG + Intergenic
1091779104 12:3202686-3202708 CCCCCTCCCTGCCTGGGGTGTGG + Intronic
1092154464 12:6273575-6273597 GCCCCTCCCCTCCAGGGCTGGGG + Intergenic
1093539480 12:20264687-20264709 GCCCCTTCCCTCCTGTGCTGGGG + Intergenic
1094283881 12:28770592-28770614 GGCACTCCCTTCCTGGTGAGTGG - Intergenic
1094410270 12:30160745-30160767 GCCACTCACTTCCTGCTGTGTGG - Intergenic
1095102172 12:38196701-38196723 GCCCATCCCTTCTTGGAGTCAGG - Intergenic
1095656212 12:44672248-44672270 GCCACTCACTTCCTGCTGTGCGG - Intronic
1095962927 12:47846583-47846605 GCTCCACCCGTCCTGGGGTTTGG - Intronic
1096102678 12:48979059-48979081 GCCCTTCACTTCCCGAGGTGGGG - Intronic
1096110434 12:49026046-49026068 CCCCCTGCCTGCCTGAGGTGGGG + Intronic
1096180384 12:49547518-49547540 CCCCCTCCCTTCCTGCCGTGTGG + Intronic
1096232110 12:49902562-49902584 GCTGTTCCCTTCCTGGTGTGAGG - Intronic
1096610069 12:52795358-52795380 GGTCATCCCTTCCTGGGCTGGGG - Intronic
1098069948 12:66662608-66662630 GCCCGTCCCTTCCTAGGATTTGG + Intronic
1100116098 12:91306263-91306285 CCCCCTACCTCCCTGGGGTCTGG - Intergenic
1100550525 12:95642777-95642799 GCCACTCACTTCCTGCTGTGTGG - Intergenic
1102030486 12:109737487-109737509 GCCCCTGGCCTGCTGGGGTGGGG + Intronic
1102525551 12:113510103-113510125 GCCTCCTCCATCCTGGGGTGGGG + Intergenic
1102950274 12:117026484-117026506 GTCCCTGCCTCCCTGGGGTTGGG - Intronic
1102986159 12:117280364-117280386 GCTCTTCCCTTCCTGGTGAGAGG + Intronic
1103201719 12:119093387-119093409 GATCCTCCTTTCCTGGGTTGGGG + Intronic
1104374117 12:128249097-128249119 GCCCCTCCCTTGCAGGCATGAGG - Intergenic
1104477441 12:129082259-129082281 GCCCCTCACCTCCTGGTGAGGGG + Intronic
1104749090 12:131227191-131227213 GCCCATCCCCTCCTGGGGAGAGG + Intergenic
1104807539 12:131599065-131599087 TCCACTCCCCTCCTGGGATGGGG + Intergenic
1104946177 12:132415787-132415809 GCCCCTGACTTCCTGGGGGAGGG - Intergenic
1105210233 13:18253129-18253151 GGCCCTCCCTTACTGGGGCTGGG - Intergenic
1105236124 13:18555124-18555146 GCCCCACTCTTCCTGGGTAGAGG - Intergenic
1106840661 13:33682328-33682350 CCCCATCCCTGCCTGGGGGGAGG - Intergenic
1107379201 13:39837552-39837574 CCCCCTCCCTTCCTGGCCTTTGG + Intergenic
1107441732 13:40433780-40433802 GCCGCTCACTTCCTGCTGTGCGG - Intergenic
1108996006 13:56735716-56735738 GCCCCTCACTGCCTGGCGGGCGG - Intergenic
1109282254 13:60370564-60370586 GCCACTCACTTCCTGTTGTGTGG + Intergenic
1110247470 13:73342664-73342686 GCCACTCACCTCCTGGTGTGTGG - Intergenic
1112664575 13:101554730-101554752 ACTCCACCCCTCCTGGGGTGGGG + Intronic
1112939265 13:104841289-104841311 GCCACTCACTTCCTGCTGTGTGG - Intergenic
1113048954 13:106187332-106187354 GCCCCTCCCTTACTTATGTGTGG - Intergenic
1113539587 13:111095695-111095717 ACCCCTGCTTTTCTGGGGTGTGG + Intergenic
1113837115 13:113335619-113335641 CCCCCTCCCTTCCTGGCCTCTGG + Intronic
1113888427 13:113724083-113724105 GAGCCTCCCTGCCTGGGGGGAGG - Intronic
1114062884 14:19037049-19037071 GCCCCCCGCTTCCTGGGCTAAGG - Intergenic
1114099375 14:19362948-19362970 GCCCCCCGCTTCCTGGGCTAAGG + Intergenic
1114455437 14:22850681-22850703 TCGCCTCCCTTCCTGGGGACAGG + Intergenic
1116992499 14:51291251-51291273 GCCCCTCATTTCCTGCTGTGCGG + Intergenic
1117211948 14:53509681-53509703 GCCCCTCACTGCTTGGAGTGGGG + Intergenic
1117827065 14:59714838-59714860 GCCGCTCCCCTCCTGCTGTGTGG - Intronic
1118282563 14:64442831-64442853 CCCACTCCCTCCCTAGGGTGTGG - Intronic
1118593549 14:67419267-67419289 GCTACTCCCTTCCTGTGCTGGGG - Intergenic
1118749630 14:68796159-68796181 GCGCGTCCCTTCGTGGGGAGGGG + Intronic
1119385849 14:74257750-74257772 ACCCTTCGCTTCCTGGGGAGCGG - Intronic
1121405134 14:93715268-93715290 GCCCCTGCCCTCCAGGGGTAGGG - Intergenic
1121468221 14:94129479-94129501 CCCTGTCCCTTCCTGGGCTGGGG + Intronic
1121776195 14:96592712-96592734 GCCCCGCCCTTCCTGGAGCACGG + Intergenic
1122271734 14:100571315-100571337 GCCCATCCCTGCATGGGCTGAGG + Intronic
1122416283 14:101551169-101551191 TCCCTTCCCTTCCTAGGGGGTGG - Intergenic
1122746195 14:103898597-103898619 GTCCCTCCCCTCCTGGAGAGAGG + Intergenic
1122876567 14:104668930-104668952 GCCCATCCCTCACTGGGTTGAGG + Intergenic
1123034487 14:105466372-105466394 GCCCCTCCCCTGCTGGGCAGAGG + Intronic
1123538191 15:21260983-21261005 GCCCATCCCACTCTGGGGTGGGG - Intergenic
1123835708 15:24189573-24189595 GCACCTCCCTGCCTTGGTTGTGG + Intergenic
1123850475 15:24350929-24350951 GCGCCTCCCTGCCTTGGTTGTGG + Intergenic
1124233518 15:27967212-27967234 GCCCCTTCCCTCCTGGGCTCTGG - Intronic
1124493633 15:30173497-30173519 GCTCCTCCCTTCCTGTGGCCCGG + Intergenic
1124606411 15:31172931-31172953 GCCCATCCCTTCTCGGGGTCAGG - Intergenic
1124713994 15:32041517-32041539 GCCCCTCACCTCCTGGTGTGTGG + Intronic
1124749935 15:32365152-32365174 GCTCCTCCCTTCCTGTGGCCCGG - Intergenic
1125003730 15:34795850-34795872 CCCTCCCCCTTTCTGGGGTGTGG + Exonic
1125761127 15:42096122-42096144 GGCCCTCCCGTACTGGAGTGGGG - Intergenic
1126048882 15:44669237-44669259 CTCCTTCCCTTCCTGGGCTGAGG + Intronic
1127391175 15:58506195-58506217 GCCTCTCCCCTCCTGGGCTAAGG - Intronic
1127864649 15:63022354-63022376 GCCCCTCCTGTCCTGGCCTGGGG - Intergenic
1127922435 15:63504318-63504340 GCCCCACCCTTCCCGGGGCCGGG + Intergenic
1128743041 15:70096477-70096499 GCCCCCGCCTTACTGGGGAGAGG - Intronic
1129150435 15:73684664-73684686 GCCCCTCCTGCCCTGGGCTGTGG + Intronic
1129170297 15:73803521-73803543 ACCCCTGCCCTCCTGGAGTGAGG - Intergenic
1129999560 15:80034995-80035017 CTCACTCCCTTTCTGGGGTGTGG + Intergenic
1131141717 15:89981793-89981815 GCCCCTCTCATCCTGGCTTGCGG - Intergenic
1131176419 15:90212159-90212181 GAACCCCACTTCCTGGGGTGGGG + Intronic
1132146436 15:99432494-99432516 GCCCCTCTCCTCCTGGCTTGGGG - Intergenic
1132232159 15:100192364-100192386 CTCCATCCCTTCCTGGGGGGAGG + Intronic
1132373731 15:101314800-101314822 CTCCCTCTCTTCCTGAGGTGCGG + Intronic
1132591276 16:727406-727428 GCACAGCCCTTCCTAGGGTGTGG + Exonic
1132889230 16:2196031-2196053 CCCCCTCCCTTCCCAGGCTGCGG - Intronic
1133880797 16:9779753-9779775 GCACCTCCATACCTGGGGAGCGG - Intronic
1134661692 16:15989178-15989200 GCCCCTGCCTTCCTGGGTGATGG + Intronic
1135852739 16:25979338-25979360 GCCACTCACCTCCTGTGGTGTGG - Intronic
1137536810 16:49333503-49333525 GCCCCTGCGGTCCTGGGGTGGGG + Intergenic
1139442190 16:66973905-66973927 CTCCCTCCCTTCCTGGCTTGGGG + Exonic
1140115314 16:72036641-72036663 GCCCATTCCATCCAGGGGTGGGG + Intergenic
1140456387 16:75107929-75107951 GCCCTTTCCCTCCTGGGCTGAGG - Exonic
1142037507 16:87870797-87870819 GCCGCCCCCTCCCTGGGGTGGGG - Intergenic
1142146503 16:88495062-88495084 GCCCGTCCCATCGTGGGATGTGG + Intronic
1142413122 16:89926163-89926185 GCTCCTCCCTCCCCGGGGCGGGG + Intronic
1142875911 17:2852314-2852336 CCCCCTCCCTGCCGGGGTTGTGG - Intronic
1143175324 17:4951726-4951748 GCACCTGCCTTCTTGGAGTGGGG + Intronic
1144203060 17:12958653-12958675 GCCACACCCTTCCTGGGCAGGGG - Intronic
1144636354 17:16911518-16911540 TTCGCTCCCTGCCTGGGGTGTGG - Intergenic
1144740844 17:17581395-17581417 GCTCCTCACTGCCTGGGGTCTGG - Intronic
1145193223 17:20866405-20866427 GCCCATCCCGTTCTGGGGTGGGG - Intronic
1145298791 17:21614679-21614701 GCCCACCCCGTTCTGGGGTGGGG + Intergenic
1145351489 17:22088611-22088633 GCCCATCCCGTTCTGGGGAGGGG - Intergenic
1145403649 17:22568413-22568435 GCCCATCCCGTTCTGGGGTGGGG - Intergenic
1146756096 17:35433191-35433213 GCCCTCCCCATCCTGGGCTGCGG + Exonic
1147705684 17:42423327-42423349 GTCCCTCCCTTTCTGGGGTGGGG - Exonic
1148323490 17:46771051-46771073 CCGCCTCCCCTCCTGGGCTGTGG + Intronic
1148548200 17:48532634-48532656 GCCCTGCCCTTTTTGGGGTGTGG - Intergenic
1148549949 17:48544391-48544413 CCCCCTCCATTCCTGGGATGGGG - Intronic
1148605646 17:48927189-48927211 GCCTCTCCATCCCTGGGGTGGGG - Exonic
1148782460 17:50129650-50129672 GCCGCTCCATCCCGGGGGTGGGG + Exonic
1149532016 17:57402964-57402986 GCCCCACCCTGCCTAGGGAGAGG + Intronic
1150710074 17:67523722-67523744 GGCCCTCCCTTCCTGAGGACTGG - Intronic
1150788996 17:68184942-68184964 GCCTCCACCTCCCTGGGGTGGGG - Intergenic
1151310739 17:73291123-73291145 GTCCCTGTCTTTCTGGGGTGTGG - Intronic
1151352615 17:73540795-73540817 GCCTCTCCCCTCGTGGGCTGTGG + Intronic
1151629442 17:75300634-75300656 GCCCCTGCCTCCCGAGGGTGGGG + Intergenic
1151658647 17:75507537-75507559 GCCCCTACCTGCCCAGGGTGGGG + Intronic
1151765444 17:76131192-76131214 GGCGCTCCCTTCAGGGGGTGGGG + Intergenic
1151817231 17:76477287-76477309 GCTCATTTCTTCCTGGGGTGGGG + Exonic
1152078591 17:78172978-78173000 GCTGCTCCCTTCCTAGAGTGGGG + Exonic
1152609742 17:81309759-81309781 GCCTCCCCCTTCCTGGGGCTGGG - Intergenic
1152650712 17:81491363-81491385 GACCCTCCCTTGGTGGGGCGTGG - Intergenic
1152687944 17:81703744-81703766 GCCCCTTCCCTCCTGGGCCGTGG + Intronic
1152769239 17:82157325-82157347 GGCCCTCCCTGCGTGGGGAGGGG - Intronic
1153867052 18:9280340-9280362 GCCACTCACCTCCTGCGGTGTGG + Intronic
1154100462 18:11468361-11468383 TCCCTTCCCTTCCTGTGGTCTGG - Intergenic
1156463110 18:37332684-37332706 GCCCCTCCCTGCTAGGGGTTTGG + Intronic
1156484177 18:37454405-37454427 GACCCTCTCTTGCTTGGGTGGGG + Intronic
1157112644 18:44835225-44835247 GCCCCTCCCTTGGAGGGGAGTGG - Intronic
1157669447 18:49515952-49515974 GAACATCCCTTCCTGGTGTGTGG + Intergenic
1157698710 18:49745653-49745675 GCACCTCCTCTCCTGGGGTAAGG + Intergenic
1160105389 18:75969834-75969856 GCCCCTTCCTTCCAGGCATGTGG - Intergenic
1160803179 19:979827-979849 GTCCCTCCCTGGCTGGGGAGAGG - Intergenic
1160836987 19:1129506-1129528 GCTCCTACCCTCCTGGGGTGGGG - Intronic
1160892121 19:1384406-1384428 GCCCTTACCTCCCAGGGGTGGGG - Intronic
1160898622 19:1415487-1415509 GGCCCTTCCTTCATGGGGTGGGG + Intronic
1161094353 19:2380726-2380748 CCTCCTCACTTCCTGGGGTCAGG - Intergenic
1162393859 19:10405004-10405026 GCCCCGCCCTCCCTGGCCTGGGG - Intronic
1162881938 19:13666411-13666433 GCCCCTCACCTCCTGCTGTGTGG + Intergenic
1162907374 19:13831738-13831760 GCCCCTTCCAACCTGGGGTTGGG + Exonic
1163410249 19:17149548-17149570 GCACCTCCCTCCCTGGGGCGAGG - Intronic
1163754121 19:19096390-19096412 ACCCCTTCCTACCTGGGCTGAGG + Intronic
1166293579 19:41878310-41878332 GCCTCTCCCTGCCTGGGCTGAGG - Intronic
1166385936 19:42381063-42381085 GCCTCACCCTTCCTGCTGTGAGG - Intergenic
1167080043 19:47272083-47272105 GCCCCTGCCTTCCCGGAGAGTGG + Intergenic
1167286071 19:48599562-48599584 GCATCTCACTTCCCGGGGTGGGG + Intergenic
1167292237 19:48630653-48630675 CCCCCTCCCTTGCGGGGGCGGGG - Exonic
924985032 2:263497-263519 GCCCTTCCCTTCCGGGTGTGAGG + Intronic
925860306 2:8168940-8168962 ATCCCTCACTTGCTGGGGTGGGG - Intergenic
926284555 2:11478214-11478236 CCCCCTCCCTTGGTGGGGAGAGG + Intergenic
926707223 2:15845447-15845469 GCCCCTTCCTTCCAGGGGAGAGG + Intergenic
927674904 2:25098123-25098145 ATCCCTCCCTTCCTGAGCTGAGG + Intronic
927707602 2:25306453-25306475 GCCCCTCCCCTCCAGGAGAGTGG - Intronic
928177294 2:29043398-29043420 GCCCCTGCATTCCTGGAGAGGGG - Intronic
929455537 2:42062206-42062228 CCCACTCCCTTCCTTTGGTGGGG - Intergenic
932357144 2:71076350-71076372 TGCCCTCCCTTCCTGAGTTGGGG + Intronic
932410650 2:71545437-71545459 GCCCCTCCCTTCCTCGCTGGGGG + Intronic
933805884 2:85997807-85997829 GCCCCTCCCTCCTGGGGCTGAGG - Intergenic
934520119 2:95014797-95014819 GCTCTTCTCTTCCTGGGGGGAGG + Intergenic
934719610 2:96564460-96564482 GCCCCTCCCTGGCAGGGGTCGGG - Intergenic
935804312 2:106731016-106731038 GCCACTCACCTCCTGAGGTGTGG - Intergenic
936109196 2:109651110-109651132 GCCTCTCCCTTTGTGGGGAGAGG - Intergenic
937126521 2:119478345-119478367 GCCCCTGGCCTCCTGGGGCGAGG - Intronic
937293114 2:120793871-120793893 CCCCGTGCCTTCCTGGGGAGTGG + Intronic
937890694 2:126936353-126936375 TCCCCTCTCTTCCATGGGTGTGG - Intergenic
937917284 2:127105495-127105517 CCTCCTCCTTCCCTGGGGTGGGG + Intronic
938469487 2:131545352-131545374 GCCCAGCCCAACCTGGGGTGGGG + Intergenic
939440591 2:142244685-142244707 GCCCCTCACCTCCTGCTGTGTGG - Intergenic
940420761 2:153477729-153477751 GCCCCTCCCCTCCAGGGCAGGGG + Exonic
940870304 2:158854406-158854428 GCCACACCATTCCTGGGGGGTGG - Intronic
940873011 2:158875500-158875522 GCCACACCATTCCTGGGGGGTGG - Intergenic
941928081 2:170915632-170915654 GCCCCTCACTGCCCGGGGTTGGG + Intergenic
941993572 2:171579893-171579915 GCCCCTGCCTCTCTGGAGTGGGG + Intergenic
945341733 2:208664217-208664239 ACCCCTCCTGTCCTGGTGTGGGG - Intronic
945482938 2:210363899-210363921 GCCCCATGCTTCCTGGGCTGAGG - Intergenic
946131428 2:217609944-217609966 GGCACTGCCTTCCTGGAGTGTGG + Intronic
946241302 2:218357523-218357545 GCTCCTCCTTGTCTGGGGTGAGG - Exonic
946428250 2:219611399-219611421 GCTCATCCCTCCCTGGGGTGGGG + Intronic
946655875 2:221946563-221946585 GCCCCTCACCTCCTGCTGTGTGG + Intergenic
947544503 2:231001373-231001395 GGGCCTCAGTTCCTGGGGTGGGG - Intronic
948205092 2:236159382-236159404 GCCACTCTCTTCCTGGGGTCAGG + Intergenic
948237653 2:236402528-236402550 GACTCTCACTTCATGGGGTGGGG + Intronic
948524300 2:238560680-238560702 TCCCTTCCCTTCCTTGGGCGTGG - Intergenic
948613788 2:239185387-239185409 GCCCCACGCCTCCTGGGGAGAGG + Intronic
948669173 2:239555727-239555749 GCAGCTCCTCTCCTGGGGTGTGG - Intergenic
948672752 2:239579029-239579051 GGCCCTCAGTTCCTGGAGTGAGG + Intronic
948771403 2:240252984-240253006 GCCCATCCCTGCATGGGATGTGG + Intergenic
948790932 2:240376494-240376516 TCCCCTCCCTTCCCAGGCTGGGG - Intergenic
948825697 2:240572636-240572658 GCTCCTACCTGCCTGGGCTGTGG + Intronic
948830671 2:240596950-240596972 CCCCCTCCCTCCCTGGGGCAAGG - Intronic
949050314 2:241894445-241894467 GACACTCCCTGCCAGGGGTGGGG + Intronic
1168806068 20:673006-673028 CCTCTTCCCTCCCTGGGGTGCGG - Intronic
1168853216 20:990580-990602 CTCTCTCTCTTCCTGGGGTGGGG + Intronic
1169964257 20:11197361-11197383 GCCCCTCCCATCAAGAGGTGAGG + Intergenic
1170408742 20:16066246-16066268 CCACCTCCCTGCATGGGGTGGGG - Intergenic
1171291380 20:23984819-23984841 GGCCCTCCCTTACTGGGGCTGGG - Intergenic
1171393736 20:24817625-24817647 GGCCCTCCCTCCCAGAGGTGGGG - Intergenic
1171412890 20:24958534-24958556 CCCTCTCCATTCCTGGGGTCGGG - Intronic
1171561788 20:26133896-26133918 GCCCATCCCGTTCTGGGGTGGGG - Intergenic
1173227407 20:41169976-41169998 GTCCTTCCCCTCATGGGGTGTGG + Intronic
1174365728 20:50055145-50055167 GCCCCTCTGTGCGTGGGGTGGGG - Intergenic
1174455384 20:50645257-50645279 GCTCCTGCCTTCCTGGGCAGGGG - Intronic
1174470986 20:50760664-50760686 GCCCCTGCCTTGCTGGGGGCGGG - Intergenic
1174623444 20:51894827-51894849 GCCACTCCCTTCCTGCCCTGTGG + Intergenic
1175781004 20:61682093-61682115 GACACTACCTTCATGGGGTGTGG + Intronic
1175853703 20:62107511-62107533 GTCCCTACCTGCCTGGGGTCAGG + Intergenic
1176375388 21:6084546-6084568 GCCCCTCCCACACTGGGGTCAGG - Intergenic
1176649521 21:9531738-9531760 GCCCATCCCGTTCTGGGGTGGGG + Intergenic
1176780122 21:13183411-13183433 GCCCCACTCTTCCTGGGTAGAGG - Intergenic
1177180416 21:17739000-17739022 TCCCCTCCCTCCCTGGTGTTGGG + Intergenic
1177977778 21:27872428-27872450 GCCCCACCCTTCCTGGCCAGAGG - Intergenic
1178075833 21:29012178-29012200 GCCCCTCACCTCCCGGGGGGGGG - Intronic
1178847701 21:36187218-36187240 TCCCCTCCCTTCCCGGGGGAGGG + Intronic
1178914593 21:36699414-36699436 GCCTCGGCCTTCCTGGGGGGTGG - Exonic
1179452814 21:41477271-41477293 GCCCCTCCATGCCTGAGATGGGG + Intronic
1179518925 21:41929434-41929456 GCCCCTCCCGTGCAGGGCTGTGG - Intronic
1179748086 21:43453698-43453720 GCCCCTCCCACACTGGGGTCAGG + Intergenic
1179913682 21:44462987-44463009 GCCCCTCAGCTCCTGGGGTGGGG + Intergenic
1180199497 21:46215895-46215917 GCCAGTCCCTTCCTGGGTGGGGG + Intronic
1180481378 22:15759676-15759698 GCCCCCCGCTTCCTGGGCTAAGG - Intergenic
1180766019 22:18346274-18346296 GGCCCTCCCTTACTGGGGCTGGG + Intergenic
1180780294 22:18516104-18516126 GGCCCTCCCTTACTGGGGCTGGG - Intergenic
1180813010 22:18773425-18773447 GGCCCTCCCTTACTGGGGCTGGG - Intergenic
1180833725 22:18919413-18919435 GCCCCTCCCTGCCTGCCCTGGGG - Intronic
1180844068 22:18972025-18972047 GCCCCTCACACCCTGGGCTGGGG - Intergenic
1180932024 22:19598664-19598686 ACCCCGCCCTTCCTGGGATGAGG - Intergenic
1180944191 22:19680638-19680660 CCCCCTCCCTGCTGGGGGTGGGG + Intergenic
1180972872 22:19824735-19824757 GCCCCTGCCTCCCTTGAGTGGGG - Intronic
1181066105 22:20306841-20306863 GCCCCTCCCTGCCTGCCTTGGGG + Intergenic
1181068256 22:20316656-20316678 GCCTCTGCCTACCAGGGGTGTGG + Intronic
1181199188 22:21207741-21207763 GGCCCTCCCTTACTGGGGCTGGG - Intergenic
1181400577 22:22648116-22648138 GGCCCTCCCTTACTGGGGCTGGG + Intergenic
1181702558 22:24629214-24629236 GGCCCTCCCTTACTGGGGCTGGG + Intergenic
1182681403 22:32082738-32082760 GCTCCTCCCTGCCTTGTGTGTGG + Intronic
1182703473 22:32259983-32260005 CCCCTGCCCTTCCTGGGGTTGGG - Intergenic
1183315770 22:37136136-37136158 TTCTCTCCCTGCCTGGGGTGAGG - Intronic
1183543151 22:38441417-38441439 GCCCCACCCATGCTGGAGTGCGG - Intronic
1183570963 22:38653011-38653033 GCCACTCACTTCCTGCTGTGTGG - Intronic
1183597334 22:38820574-38820596 TCCCCGCACTTCCTGGGGTGGGG + Exonic
1183991620 22:41600804-41600826 GCCCCTCCCTTTCTCCAGTGTGG + Exonic
1184364076 22:44038189-44038211 GTTCCTGTCTTCCTGGGGTGTGG + Intronic
1184369209 22:44071904-44071926 GCGCCTCCCTTCCTGGGTCCTGG - Intronic
1185137338 22:49080300-49080322 GCCCCTCCCTATCTGGGGCCTGG - Intergenic
1185194914 22:49463089-49463111 GCCCCTTCCTTCCGGAGGTGGGG - Intronic
1203227637 22_KI270731v1_random:87165-87187 GGCCCTCCCTTACTGGGGCTGGG + Intergenic
1203283811 22_KI270734v1_random:144711-144733 GCCCCTCCCTGCCTGCCCTGGGG - Intergenic
950145896 3:10649580-10649602 TCCCCTCCCTTCCTGAGCTGAGG - Intronic
950581380 3:13864442-13864464 CCCCTTCCCCTCCTGGGTTGTGG + Intronic
950660408 3:14463629-14463651 GCCTCTCCCTTCCTGAGGACAGG - Intronic
952211179 3:31230994-31231016 GCCCCTTCCCTACTGGGCTGTGG - Intergenic
953252834 3:41262137-41262159 GCCACACCCTTCATGGGGAGAGG - Intronic
953391668 3:42537380-42537402 ACCCCACCCTCCCTGGAGTGTGG + Exonic
953914041 3:46906643-46906665 GCCCCTCCCTCCCTGGGATCTGG + Intergenic
954004843 3:47582591-47582613 GCCCTTCCCTTTCTGGGGGATGG - Intergenic
954083131 3:48224112-48224134 GCCCCTCCCACTCTGGGGTGGGG - Intronic
954109240 3:48424984-48425006 GCCTCTCCTTTCTTGGGGTCTGG - Intronic
954226199 3:49182873-49182895 GCCCCTCACTGCCCGGGGCGGGG + Intronic
954711757 3:52508365-52508387 TCCCATCCTCTCCTGGGGTGAGG + Intronic
954871253 3:53769163-53769185 CCCCTGCCCTCCCTGGGGTGGGG + Intronic
955330387 3:58042428-58042450 GCCCCCACCTTCCTGGGCTCAGG + Intronic
956877522 3:73478220-73478242 ACCTCTCCCTTCCTGCTGTGAGG - Intronic
957088552 3:75706264-75706286 GCCTGTCCCTTCTTGGGGTCAGG - Intergenic
961013452 3:123449962-123449984 GCCCCTCCCTCCCTGGGACTAGG + Intergenic
961177861 3:124850848-124850870 GCCCCTCCCTCACTGTGATGTGG - Intronic
961559040 3:127716158-127716180 GCCTGTCCCTTCCGGGGTTGGGG - Intronic
961580896 3:127881301-127881323 GCCACTCACTTCCTGCTGTGTGG + Intergenic
962249380 3:133826095-133826117 GCCCCTCCCTTCCTGGGGTGTGG - Exonic
962282702 3:134064340-134064362 GGAGCTCCCCTCCTGGGGTGGGG - Intergenic
962318085 3:134371126-134371148 TCCTCTCCCTTGCTGGGCTGTGG + Exonic
962921011 3:139950425-139950447 GCCACTCCCTACATGGGCTGAGG + Intronic
964297042 3:155245361-155245383 GCCCCTCCCTTCCTTGAGCTGGG + Intergenic
964590851 3:158360931-158360953 CCCCCTCACAGCCTGGGGTGGGG + Intronic
965435715 3:168648507-168648529 GCCACTCACTTCCTGCTGTGTGG - Intergenic
965757325 3:172039991-172040013 GCCCCCGCCTTGCTGGGCTGGGG + Intronic
967118704 3:186363791-186363813 GCTCCTCTCTTCCAGGGATGAGG - Intergenic
967594926 3:191317248-191317270 GCCCCTCACTGCCTGGGGCCGGG + Intronic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
968506259 4:972730-972752 GCCCAGCTCTTGCTGGGGTGAGG - Intronic
968603052 4:1519478-1519500 GCCCTGCCCTTGCTGGAGTGTGG - Intergenic
968699178 4:2046760-2046782 GCCCCTCCCTTCCTGCTCTGGGG + Intergenic
968972314 4:3802439-3802461 GCCCCTCCCTGCCTGCTGTGAGG + Intergenic
969289325 4:6228551-6228573 GCCCCTGCTGTCCTGGAGTGAGG + Intergenic
969895188 4:10297166-10297188 GCACTTCCCTTCCTGGCGTTAGG + Intergenic
970859225 4:20682823-20682845 GCCACTCCCTCCCAGGGCTGGGG + Intergenic
970951718 4:21764657-21764679 GCCCATTCCTTCCAGGGATGTGG - Intronic
970967780 4:21948479-21948501 CCCCTTCCCTTCCTCGGCTGGGG - Intronic
971281686 4:25246864-25246886 GCCCCTCACTGCCTGGGGCCTGG + Intronic
972368630 4:38399690-38399712 GCACCTCCCCTCCTGCTGTGCGG - Intergenic
974354471 4:60794568-60794590 GCCGCTCACTTCCTGCTGTGTGG - Intergenic
976195778 4:82530012-82530034 AGCCCTCCCCTCCTGGGCTGAGG - Intronic
977829528 4:101574287-101574309 GCCCCACCCTTCCTAGGCTCTGG + Intronic
979478232 4:121183546-121183568 GCCTCTCGCTTCCTGCTGTGTGG - Intronic
982157596 4:152536632-152536654 GCCCCACCCTTCCCGTGGCGTGG + Intergenic
982867963 4:160541661-160541683 GCCCCTCACCTCCTGCTGTGTGG + Intergenic
985695548 5:1338181-1338203 GGCCATCACTTCCTGGGGAGCGG - Intronic
985722021 5:1494427-1494449 GACCCTCCCTACCGGGAGTGAGG - Intronic
985825512 5:2187956-2187978 GCCCCAGCCTTCCTGGCTTGAGG + Intergenic
986145181 5:5071356-5071378 TCCCCTCCTTTCCTGGGCAGCGG - Intergenic
986388323 5:7261276-7261298 ACCCCTCCCCTCCTGGGCTGTGG - Intergenic
987091709 5:14513517-14513539 GCCGCTCCCCTCCTGCTGTGTGG + Intronic
991913069 5:71580683-71580705 ACCTCTGCCTTCCAGGGGTGAGG + Intergenic
993364580 5:87020099-87020121 ACCCCTCCCTTCCTGTGCAGAGG - Intergenic
996353982 5:122576782-122576804 CCCAATCCCCTCCTGGGGTGAGG - Intergenic
997581538 5:135020224-135020246 GCCACACCGTGCCTGGGGTGGGG + Intergenic
997711342 5:136007221-136007243 GCCCCTCCTGTCCTGGGTTGCGG - Intergenic
999102416 5:149037423-149037445 GCCCTGCCCTTCGTGGGGAGAGG - Intronic
999373303 5:151069191-151069213 ACCCCTCTCTTTCTGGGGTAAGG - Intronic
1000037439 5:157460060-157460082 GCGCATGCCTTCCTGGGGTGAGG - Exonic
1001633911 5:173196395-173196417 GCCCCTCCTTTCCAGCTGTGTGG + Intergenic
1002324131 5:178394393-178394415 GCCTCTGCATTCCTGGGGTGGGG - Intronic
1002416116 5:179121799-179121821 GAGCCTCTCTGCCTGGGGTGGGG - Intronic
1002587129 5:180256368-180256390 GCTCCTCCCTTCCTGGGATGTGG + Intronic
1002874624 6:1200362-1200384 TCCCCTCCCTTCCTTGGGGCTGG - Intergenic
1003946714 6:11082840-11082862 GCCCCTTTATTCCTGTGGTGAGG + Intergenic
1004380949 6:15132027-15132049 GTCCCTCACAGCCTGGGGTGGGG - Intergenic
1004425704 6:15505587-15505609 ACCCCTCCCTTCCTAGTGTGGGG + Intronic
1004427964 6:15518911-15518933 CACCCACCCTTGCTGGGGTGGGG + Intronic
1004677585 6:17858789-17858811 CCCACTCCCTTCCTGGGGGCTGG - Intronic
1006296851 6:33173613-33173635 TCAGCTTCCTTCCTGGGGTGAGG + Intronic
1006336897 6:33425705-33425727 GGCCCGCCCTTCCTGGGAGGAGG + Intronic
1006828513 6:36954669-36954691 GCACCACCCTGGCTGGGGTGGGG - Exonic
1007401971 6:41607918-41607940 GCCGCTCCCCTCCTGCTGTGCGG + Intergenic
1007403249 6:41616598-41616620 GCCCCTCACCTCCCCGGGTGGGG - Intergenic
1007935672 6:45729901-45729923 GGCCCACCCTTCCTGAGGTGAGG - Intergenic
1009684971 6:66945185-66945207 GGACCTCCCTTTCTGGGATGGGG + Intergenic
1012648212 6:101716587-101716609 GAGCCTCCTGTCCTGGGGTGGGG + Intronic
1012850990 6:104446444-104446466 GCCCCTCACTGCCTGGGTGGCGG - Intergenic
1013630877 6:111984695-111984717 TCCCCTCCCTTCCTGAGCTGTGG - Intergenic
1016357585 6:143234966-143234988 GCACTTCCCTTCCTGGGGCGGGG + Intronic
1016580159 6:145620376-145620398 GCCACTCACTTCCTGCTGTGTGG + Intronic
1017726029 6:157276428-157276450 CCCCCTCCCTCCCTGGGGAGTGG - Intergenic
1018678269 6:166241835-166241857 GCCCCTCCCTTCTCGTGCTGAGG - Intergenic
1018838650 6:167503648-167503670 ACCAATCCCTCCCTGGGGTGGGG + Intergenic
1018899621 6:168044531-168044553 GACCCTCCCTGACCGGGGTGAGG + Intronic
1019187913 6:170231730-170231752 GCCCCGCACTATCTGGGGTGGGG - Intergenic
1019328736 7:452467-452489 GTCCCTCCCTCCCTGGGGCGTGG - Intergenic
1019539473 7:1545337-1545359 GCCTCTTGCTTCCTGGGCTGAGG - Exonic
1019554599 7:1622627-1622649 ACGCCTCACTTCCTGGGGCGGGG - Intergenic
1019594189 7:1850842-1850864 GCTCCTCCCCTCCTGGGATGGGG + Intronic
1019625142 7:2012079-2012101 GCCCCTCCCTTCCCATGGTGGGG - Intronic
1019666335 7:2253908-2253930 GCCCCTCCCTGGCCGGGGAGGGG - Exonic
1019918575 7:4149104-4149126 GCCAGTCCCTTCCTTGGGTCAGG - Intronic
1022032950 7:26508625-26508647 GCCACTCCCTGTCTGGGCTGTGG - Intergenic
1022546880 7:31198146-31198168 GCCACTCACTTCCTGCTGTGCGG + Intergenic
1022989613 7:35694892-35694914 GCCGCTCCCTTCCTGCTGCGCGG + Exonic
1023582806 7:41700290-41700312 GCCCCTCGGATCCTGGGGTGGGG + Exonic
1023865197 7:44235100-44235122 GGCCCTGCCTTCCTGGGGTAGGG + Intronic
1024567900 7:50697826-50697848 CTCCTTCCCTCCCTGGGGTGGGG - Intronic
1025074916 7:55934584-55934606 GCCCCAGCCTCCCTGGGCTGAGG + Intronic
1025276085 7:57581797-57581819 GCCCATCCCATTCTGGGGTGGGG + Intergenic
1026361763 7:69608015-69608037 GCCCCAACCTTCCTGGGCTCAGG + Intronic
1026907061 7:74068800-74068822 GCCCGTTCCCTCCTGGGGTGGGG - Intronic
1029115896 7:98236914-98236936 GCCTCTCTCTTCCAGGTGTGGGG - Exonic
1029142275 7:98419773-98419795 GCCCCTACCTTCCCCGGGTAGGG - Intergenic
1029386895 7:100249136-100249158 GCCGCTCCTGGCCTGGGGTGGGG + Intronic
1029419233 7:100463862-100463884 TTCCCTCCCTTCCTGGCCTGTGG - Intronic
1029457764 7:100679650-100679672 CCCCTGCCCTTCCTGGGGTTGGG - Exonic
1029478799 7:100800930-100800952 GACCCTCCCTTCCCGGGTTTGGG - Intergenic
1029763319 7:102612160-102612182 CCCCGTCCCGTCCTGGGGCGAGG - Intronic
1033435416 7:141329260-141329282 CCCACCCCCTACCTGGGGTGTGG + Intronic
1034529250 7:151685135-151685157 GCCACTCCCACCCTGGGCTGGGG - Intronic
1034553311 7:151834700-151834722 TCCACTCCGTTCCTGGGGTGGGG - Intronic
1034875378 7:154720572-154720594 GGCCCTGCCATCCTGGAGTGGGG - Intronic
1035153194 7:156892595-156892617 GCCCTTCCCTTCCCGCGGGGAGG - Intronic
1036220223 8:6915130-6915152 ACCCCTGCCTTCCAGGGTTGGGG - Intergenic
1036483851 8:9162255-9162277 GCCCCTGCCTTCCTGGTATTTGG - Intronic
1036848379 8:12185161-12185183 GACCCTCCCTCCCTGTGCTGAGG + Intronic
1036869739 8:12427442-12427464 GACCCTCCCTCCCTGTGCTGAGG + Intronic
1039561237 8:38514048-38514070 CTCCCTCCCTCCCTGGGCTGGGG + Intronic
1039895328 8:41713084-41713106 GACGCTCCCTGCCTGGGCTGCGG + Intronic
1040965581 8:53077877-53077899 GCCCCTCACTGCCTGGGGCCGGG + Intergenic
1042461354 8:69072962-69072984 GCCACTCACTTCCTGCTGTGTGG + Intergenic
1042806633 8:72777455-72777477 GCCCCTGACTTCCTGTGGTAGGG - Intronic
1042877895 8:73456556-73456578 CCCCCTCCCTTCCTGCCATGAGG - Intronic
1045538212 8:103055349-103055371 GCCACTGGCTTCCAGGGGTGTGG - Intronic
1046313492 8:112469714-112469736 GCCACTCACTTCCTGCTGTGCGG + Intronic
1048055302 8:130857079-130857101 GCCCATCCATTTGTGGGGTGGGG + Intronic
1049235950 8:141512422-141512444 GCCCCTCCCGGGCTGGGATGTGG + Intergenic
1049618856 8:143588884-143588906 TCCCCTGCCCACCTGGGGTGGGG - Intronic
1049635218 8:143684567-143684589 GCCCCTCCGTCCCTGGGTCGTGG + Intronic
1050131631 9:2418889-2418911 GCCCCTCCCTTGCTTGCATGTGG - Intergenic
1050729838 9:8696432-8696454 GTCCCTCCAGTCTTGGGGTGGGG + Intronic
1051349599 9:16186465-16186487 GCCTCTTCCTGCCTGGGTTGGGG + Intergenic
1052973882 9:34398158-34398180 TCAGCTCCCTCCCTGGGGTGTGG - Intergenic
1053208440 9:36207571-36207593 GCCCCTTCCTGCCTTGGCTGAGG + Intronic
1055480729 9:76706757-76706779 TAGTCTCCCTTCCTGGGGTGAGG + Exonic
1055945350 9:81688059-81688081 GGCCCTCTCTTCCTGGGGTGGGG - Intronic
1056587306 9:87937337-87937359 ACCCATCCCGTTCTGGGGTGGGG - Intergenic
1056609571 9:88115606-88115628 GCCCATCCCGTTCTGGGGTGGGG + Intergenic
1056724582 9:89103396-89103418 TCCCCTCCATTACTGGGGTCAGG - Intronic
1057379051 9:94553030-94553052 GCCCATCCTGTCCTGGGGTGGGG - Intergenic
1057651895 9:96926688-96926710 TCCCCTCCTTGCCTGGGTTGTGG - Intronic
1058817299 9:108696250-108696272 GTCCCTGCCTTCCTGCTGTGTGG + Intergenic
1059798322 9:117724179-117724201 GCCGCTCCCTTCCTGAGCTGTGG + Intergenic
1061053926 9:128211789-128211811 GGCCCTCCCTGTGTGGGGTGGGG + Intronic
1061160030 9:128888425-128888447 GCCCAGCCCTTCCTGGGGATAGG + Intronic
1061160741 9:128892509-128892531 CACCCTCACTTCCTGGGGAGAGG - Intronic
1061237957 9:129352943-129352965 CCCTCTCCCCTCCTGGGGTGGGG + Intergenic
1061531957 9:131221419-131221441 GCCACTCACTTCCTGGATTGTGG + Intronic
1061944387 9:133900568-133900590 GCCCCTTCCTTCTGGGTGTGGGG - Intronic
1061948860 9:133924725-133924747 CCCCCTCCCTTCCAGGGCTCAGG - Intronic
1061973012 9:134054879-134054901 GCCCTTTCCTCTCTGGGGTGGGG - Intronic
1062029594 9:134356206-134356228 TCCCCTCCCTTGCAGGGCTGGGG - Intronic
1062031638 9:134364615-134364637 GCCACTTCCTGCCAGGGGTGTGG + Intronic
1062071626 9:134558398-134558420 GCCCCACCCAGCCTGGAGTGTGG + Intergenic
1062104966 9:134750364-134750386 GCCCCTCCCTTCTCCGGGTGGGG + Intronic
1062446385 9:136597118-136597140 GGCCCTCCCTGCCTTGGGAGAGG + Intergenic
1062459055 9:136655279-136655301 TCCCCTCCCTGCCTGGGGAAGGG + Intergenic
1062538022 9:137029356-137029378 GCCCACCCCTACCTGGGGTAGGG + Intronic
1203627262 Un_KI270750v1:35286-35308 GCCCATCCCGTTCTGGGGTGGGG + Intergenic
1185592796 X:1288748-1288770 TACCCTCCCTTCCTGGGAAGAGG - Exonic
1185601014 X:1339326-1339348 GCCCCTTCCTGCCTGGGCAGAGG - Intronic
1185650321 X:1642787-1642809 GCCCCTCCCTTTCTAGGTGGTGG + Exonic
1185703433 X:2248734-2248756 GCGCCTTCCTTCTGGGGGTGGGG - Intronic
1187708095 X:22027124-22027146 GCAAGTCCCTTCTTGGGGTGGGG + Intergenic
1187724640 X:22189858-22189880 TCACCTACCTTCCTGGGGTTTGG - Intronic
1188242555 X:27809247-27809269 GCCCCTCACTGCCTGGGCCGGGG - Intronic
1188490781 X:30737149-30737171 GCCTCTACCTTCCTGGGCTCAGG + Intergenic
1189348295 X:40258983-40259005 ACTCCTGCCTGCCTGGGGTGGGG - Intergenic
1190741755 X:53293317-53293339 GTCACTCCCTTTATGGGGTGTGG + Intronic
1192204408 X:69086532-69086554 CCTCCTTCCTTCCTGTGGTGGGG - Intergenic
1192561763 X:72131969-72131991 GCCCGCCCCTGCGTGGGGTGGGG - Intergenic
1194974567 X:100380435-100380457 TCCCCTGCCTTCATGGGGTGGGG - Intronic
1198322962 X:135537508-135537530 GCCCTTTCATTCCTTGGGTGAGG + Intronic
1199991579 X:152990329-152990351 GCCCCTCCCTGCCTGGAGTCTGG + Exonic
1200142542 X:153909232-153909254 GCTCCTCCCATCCTGGGGTGTGG + Intronic
1200794179 Y:7325742-7325764 TCCCCTCCCCTCCTGTGGCGGGG + Intergenic
1200985850 Y:9303285-9303307 GCATCTGGCTTCCTGGGGTGGGG + Intergenic
1202100592 Y:21303816-21303838 GCCCCTCACTGCCTGGGGCCGGG + Intergenic