ID: 962249390

View in Genome Browser
Species Human (GRCh38)
Location 3:133826141-133826163
Sequence GCGCCATGGAACCACTGAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962249382_962249390 18 Left 962249382 3:133826100-133826122 CCCCAGGAAGGGAGGGGCGGAAA 0: 1
1: 0
2: 1
3: 16
4: 280
Right 962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 71
962249387_962249390 -5 Left 962249387 3:133826123-133826145 CCGCACGTGCCGAAGGGAGCGCC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 71
962249380_962249390 23 Left 962249380 3:133826095-133826117 CCACACCCCAGGAAGGGAGGGGC 0: 1
1: 0
2: 5
3: 63
4: 470
Right 962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 71
962249376_962249390 28 Left 962249376 3:133826090-133826112 CCTTTCCACACCCCAGGAAGGGA 0: 1
1: 0
2: 1
3: 47
4: 332
Right 962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 71
962249384_962249390 16 Left 962249384 3:133826102-133826124 CCAGGAAGGGAGGGGCGGAAACC 0: 1
1: 0
2: 3
3: 11
4: 220
Right 962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 71
962249383_962249390 17 Left 962249383 3:133826101-133826123 CCCAGGAAGGGAGGGGCGGAAAC 0: 1
1: 0
2: 1
3: 13
4: 207
Right 962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962249390 Original CRISPR GCGCCATGGAACCACTGAGA TGG Exonic
903256948 1:22108813-22108835 GCTGCAGGGAACCACTGAGAAGG + Intergenic
906110974 1:43321770-43321792 GGGTCATGGCACCTCTGAGAGGG - Intronic
910481333 1:87661453-87661475 GACCCAATGAACCACTGAGAAGG - Intergenic
911681780 1:100725064-100725086 GAGCCATGGAAACTCTGGGAGGG - Intronic
913116554 1:115702729-115702751 GAGCCATGGAACCACAGATTGGG + Intronic
917274259 1:173314496-173314518 GTGCTATGGAAACACAGAGAAGG - Intergenic
922301215 1:224302748-224302770 GCTCCTTAGAACCACTGGGAGGG + Intronic
924447638 1:244148790-244148812 GCAGCATGGAAACACTGAGAGGG + Intergenic
1062937566 10:1399738-1399760 GTGCCAGGGAACCACTGACCAGG + Intronic
1065935457 10:30516734-30516756 GCACCATGGGATCACAGAGATGG + Intergenic
1066235749 10:33482607-33482629 GGGACATGGAAACACTTAGAAGG + Intergenic
1070695782 10:78562037-78562059 GCCTCATAGAACCAGTGAGAGGG + Intergenic
1073420893 10:103422870-103422892 GAGCACTGGAACCACTGACAAGG - Intronic
1077639347 11:3867407-3867429 GGGCCATGGAACCAAAGACAGGG - Intronic
1085054894 11:73397829-73397851 GCTCCAGGGCACCACAGAGAAGG + Intergenic
1089731999 11:120525045-120525067 GCATCATGGATCCACTGAGAAGG - Intronic
1101818475 12:108164250-108164272 GAGCCATGGAACCATTGCCAAGG + Intronic
1105412631 13:20184188-20184210 GAGCCATGGAACCACTGTTCTGG - Intergenic
1105847558 13:24307211-24307233 GCTCCATGTAACCACTGGGTAGG + Exonic
1109100835 13:58181705-58181727 GTGCCATGGAGCCACTGCTAGGG + Intergenic
1109123050 13:58482846-58482868 GTGAGATGGAACCACTGAGGTGG + Intergenic
1110677141 13:78262506-78262528 TCTCCATGGAACCACTCAGAAGG - Intergenic
1112502011 13:99950299-99950321 GCTCCCTGGGAACACTGAGAAGG + Intergenic
1122300265 14:100727311-100727333 GCGCCCTGGGACCCCTGGGACGG - Intronic
1127832987 15:62767227-62767249 CCTCCTTGGAACCACTGGGAAGG - Intronic
1130816764 15:87444154-87444176 GCACCTTGGAGCCTCTGAGATGG + Intergenic
1140990683 16:80208446-80208468 GCACAATGGAAACACTAAGATGG + Intergenic
1144351933 17:14405046-14405068 GCTCCATGTAATCACTCAGATGG + Intergenic
1151383021 17:73738453-73738475 TCTCCATGGAACTTCTGAGATGG + Intergenic
1152072601 17:78141196-78141218 AGGCCCTGGAGCCACTGAGAGGG - Exonic
1154230135 18:12549045-12549067 GTGCCAGGGAAGCACTGAAATGG - Intronic
1155388036 18:25302331-25302353 GAGCCATGGAACCACGGAGGTGG - Intronic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1164551942 19:29219287-29219309 GAGCCATAGGACCACTGAGAAGG - Intergenic
1165112355 19:33509804-33509826 CCGCCCTGGCACCACTGAGCAGG + Intronic
1166843185 19:45711460-45711482 GGGCCGTGGACCCTCTGAGAAGG - Exonic
925711614 2:6746617-6746639 ATGCCATGGAACCAGAGAGAAGG + Intergenic
926641991 2:15246935-15246957 GTGCCATGGAAGCCCTCAGAAGG + Intronic
932023308 2:68110375-68110397 TTGCCATCAAACCACTGAGAAGG - Intronic
932904956 2:75739212-75739234 GCTCCATGGGCCCACTGTGATGG + Intergenic
937455220 2:122035611-122035633 GCTCCATGGAACACCTGAAAGGG - Intergenic
938553737 2:132404181-132404203 TCACAATGAAACCACTGAGATGG + Intergenic
938839777 2:135148959-135148981 GACCCATGGGATCACTGAGAGGG - Intronic
942591660 2:177552997-177553019 GCGCCGCGGAACCACTGGAACGG - Exonic
942822598 2:180133449-180133471 GCGCCATGCAAAAGCTGAGATGG + Intergenic
948205442 2:236160604-236160626 GCTGCATGGATACACTGAGAGGG + Intergenic
1168848222 20:959552-959574 GGGGCATGGAACCCATGAGAGGG + Exonic
1172573400 20:35987650-35987672 GGGACATGGAAACTCTGAGAAGG - Intronic
1173220814 20:41131679-41131701 GGGCCATTGGAGCACTGAGAAGG - Intergenic
1181865754 22:25853591-25853613 GCTGAATGGAGCCACTGAGAGGG + Intronic
1183229725 22:36574225-36574247 GCTCCAGGGAAGCAGTGAGAAGG + Intronic
953622646 3:44546540-44546562 GATCCATGGAAACAGTGAGATGG - Intergenic
956605238 3:71067009-71067031 GCACCATGGGACCACAAAGAAGG + Intronic
957499330 3:81033631-81033653 GCTGCATGGAACCAGTTAGATGG + Intergenic
962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG + Exonic
969656013 4:8499002-8499024 GAGCCACAGAACCACAGAGAGGG - Intergenic
975644979 4:76537159-76537181 GAGCCATGTAGCTACTGAGAGGG + Intronic
981477037 4:145197468-145197490 GCTCCCTGGCACCTCTGAGAGGG - Intergenic
983648181 4:170012873-170012895 AGCCCATGGAACAACTGAGAGGG + Intronic
984171895 4:176369068-176369090 GCGGCTTGGAGACACTGAGAGGG - Intergenic
987449620 5:18065535-18065557 AAGCTATGGAAGCACTGAGAAGG - Intergenic
988829486 5:34973587-34973609 GCTCCATGGAAACACAGAAAGGG + Intergenic
989426068 5:41297556-41297578 GCCCCATGGAGCCCCTTAGATGG + Intergenic
999278384 5:150347694-150347716 GCACCATGGAAACACGGACAGGG + Intergenic
1008127419 6:47684602-47684624 GAGCCATGGATCTACTGAGATGG + Intronic
1008884582 6:56418280-56418302 GGGCCAAGGAATCACAGAGAAGG + Intergenic
1017607179 6:156146839-156146861 CAGCCATGGAACCAGTAAGAAGG + Intergenic
1018524462 6:164692973-164692995 GAGCCATGCAAGCAGTGAGAGGG - Intergenic
1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG + Intronic
1036641275 8:10585566-10585588 GGGGCATGGAACCACCCAGAAGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1049619968 8:143593645-143593667 GCCCCATGGGACCAGTAAGAGGG + Intronic
1050917685 9:11158228-11158250 GCCCCAGGGGACCACTGAGTAGG - Intergenic
1051276151 9:15400859-15400881 GGGACAATGAACCACTGAGAGGG - Intergenic
1052890783 9:33697674-33697696 AGGCCATTGTACCACTGAGAAGG - Intergenic
1185794120 X:2950158-2950180 ACGCCATGGAAACATGGAGATGG - Intronic
1190741353 X:53290925-53290947 GCTCAATGGAGCCACTCAGAGGG + Intronic
1191862048 X:65673744-65673766 GAACCATGGAACAACTGAGCTGG + Intronic
1192220397 X:69193954-69193976 GAGCCATGGGACATCTGAGAAGG + Intergenic
1192478102 X:71461064-71461086 GTGCCAAAGCACCACTGAGAAGG + Intronic