ID: 962249509

View in Genome Browser
Species Human (GRCh38)
Location 3:133827097-133827119
Sequence CCTCCTAGGCAGAGGGTGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962249504_962249509 6 Left 962249504 3:133827068-133827090 CCTTGCTAGAGATGAGCTCTGGC 0: 1
1: 0
2: 2
3: 12
4: 131
Right 962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG 0: 1
1: 0
2: 3
3: 24
4: 283
962249502_962249509 20 Left 962249502 3:133827054-133827076 CCTGAAGATAAATTCCTTGCTAG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG 0: 1
1: 0
2: 3
3: 24
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962249509 Original CRISPR CCTCCTAGGCAGAGGGTGTG TGG Exonic
900150638 1:1177898-1177920 CACCCTAGGAAGAGGGCGTGAGG + Intronic
901002552 1:6155777-6155799 CCTCCTAGGCAGAGACCCTGGGG - Intronic
901788036 1:11637537-11637559 CCTCCTGGGCAGGGTGTGAGGGG - Intergenic
901918530 1:12519249-12519271 CCCCCAAGGGAGGGGGTGTGTGG + Intergenic
902374592 1:16024310-16024332 CCTCCCTGGAAGAGGGGGTGTGG + Intronic
902379535 1:16046082-16046104 CCTCCCTGGAAGAGGGGGTGTGG + Intronic
903071974 1:20731216-20731238 CCTCCTGGCCGGAGGGTCTGGGG + Intronic
904049969 1:27633147-27633169 CCTCCGGGGAGGAGGGTGTGGGG - Intronic
904432038 1:30470477-30470499 CTTCCTAGGCAATGGGTGTGAGG + Intergenic
904902667 1:33869698-33869720 CCTCCTACGCAGAGTGAATGAGG - Intronic
905339089 1:37266140-37266162 CCTCCCAGGCAGAGGGGCTTGGG - Intergenic
906098853 1:43243139-43243161 CCTCCTGGGCTGAGTGTATGGGG - Intronic
906402312 1:45513920-45513942 CCTCCTTAGCACAGGGTGTCAGG - Intronic
906562611 1:46770259-46770281 CATCCTGGGCAGAGGGGCTGGGG + Intronic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
907287317 1:53390186-53390208 CCACCAAGGCAGAGAGTATGAGG + Intergenic
908697262 1:66857608-66857630 CCTGGGAGGCAGAGGTTGTGGGG - Intronic
909818777 1:80031601-80031623 CATCCTATGCAGAGGCTCTGAGG + Intergenic
910104195 1:83613109-83613131 GATGCTAGGCAGAGGTTGTGGGG + Intergenic
910333312 1:86100709-86100731 CCTCCCTGGCAGAGGGGGTAGGG - Intronic
915222563 1:154386760-154386782 ACTGCTAGTCAGAGGGTGTGGGG + Intergenic
915567028 1:156720693-156720715 CCTTTTAGACACAGGGTGTGGGG + Intergenic
916646418 1:166790158-166790180 CCTCCAAGTCAGAGGGAATGAGG - Intergenic
917981365 1:180271682-180271704 CCACCTGGGGAGAGGGGGTGGGG + Intronic
918085375 1:181240497-181240519 CCTCGTTGGAAGAGGATGTGAGG - Intergenic
919781673 1:201225252-201225274 CCTCCAGGGCAGGGGCTGTGTGG - Intronic
920007574 1:202844688-202844710 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
920208540 1:204311413-204311435 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
920226603 1:204443597-204443619 CCTGCAAGGCAGAGGGAGTCAGG + Exonic
920593847 1:207248821-207248843 CCCCCGAAGCAGAGGCTGTGTGG - Intergenic
921064355 1:211612100-211612122 CCTGCCAGGGAGACGGTGTGGGG + Intergenic
921189450 1:212696905-212696927 CGTGCAAGGCAGAGGCTGTGTGG + Intronic
921774030 1:219076497-219076519 TTTCCTTGGCAGAGGATGTGTGG - Intergenic
924567418 1:245210268-245210290 CCACCTAGGCAGAGAGGCTGAGG - Intronic
1063434689 10:6020371-6020393 CTTCCTTGGAAGAGGGTGAGAGG - Intronic
1063597830 10:7453162-7453184 CATTCTAGGTAGAGGGAGTGAGG - Intergenic
1065258994 10:23905362-23905384 GCTCCTCGGCTGTGGGTGTGGGG - Intronic
1065844502 10:29734511-29734533 CCTCCTGGGAAGAGGTTGTAAGG + Intronic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1067296135 10:44975978-44976000 CCACCAAGGCAGAGGGGTTGAGG - Intronic
1067410602 10:46060872-46060894 GCTCCTGGAAAGAGGGTGTGGGG - Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1068351071 10:55845921-55845943 CCTCCTAGGCAGTGTGTGGGGGG - Intergenic
1068974045 10:62989178-62989200 CCTGCTAGTGACAGGGTGTGAGG - Intergenic
1069597000 10:69678612-69678634 CATCCCAGGCAGAGGGTAGGTGG + Intergenic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1071916830 10:90302177-90302199 CCTCCTCAGCACAGGGTGTCGGG + Intergenic
1071977099 10:90965949-90965971 CCTCTTATGAAGAGGGGGTGTGG + Intergenic
1072611374 10:97019503-97019525 CCTCCTAGTCAGCAGGTGTCAGG - Intronic
1075303548 10:121347224-121347246 CCTCCTGGGTAGAGGGAATGAGG - Intergenic
1075506065 10:123023893-123023915 CACCCTAGGCAGAGGTTCTGAGG - Intronic
1075863248 10:125695989-125696011 CCTCCCAGGCTGAGTGTGAGAGG + Intergenic
1076653919 10:132008621-132008643 CCTGGGAGGCAGAGGTTGTGGGG + Intergenic
1076662885 10:132067261-132067283 TCTCCAAGGCTGAGGGTGGGGGG + Intergenic
1078556023 11:12326874-12326896 CCTCCAAGACAGAGGCTGTTGGG - Intronic
1079074652 11:17376703-17376725 TTTCCTAGCCTGAGGGTGTGAGG - Exonic
1079971408 11:27040389-27040411 CTGCCTAGGAAGAGGGTGTTAGG + Intergenic
1081715524 11:45247246-45247268 CCTCCTAGGAGGTGGGTGTTTGG + Intronic
1083195366 11:61082678-61082700 CCTCCTTGGCAGAGCACGTGGGG + Intergenic
1083309459 11:61776982-61777004 CCTGCTAGGCACTGGCTGTGTGG + Intronic
1083652629 11:64212038-64212060 CCTCATAGACAGTGTGTGTGTGG + Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1083925542 11:65803936-65803958 CCTCCAAGGCCGAGGCGGTGAGG - Intergenic
1084692353 11:70734681-70734703 CCTCCAGGGCACAGGCTGTGGGG - Intronic
1085189727 11:74608515-74608537 CCTCCTAGGCTCTGGGTTTGTGG + Intronic
1085410741 11:76288985-76289007 GATCCTGGGCAGAGGTTGTGGGG - Intergenic
1086087785 11:82972371-82972393 CGCCCAAGGCAGAGGGTGAGAGG + Intergenic
1089560053 11:119339279-119339301 ACTCCTAGAAGGAGGGTGTGAGG - Exonic
1089591398 11:119543562-119543584 CATCGGAGGCAGAGGTTGTGGGG - Intergenic
1089707929 11:120294022-120294044 CCTCATAGCCAGGAGGTGTGAGG - Intronic
1089951906 11:122535904-122535926 CCTCCTAGGCATATGGTGAGAGG - Intergenic
1090161698 11:124502035-124502057 CTTCCTAGGAAGTGGGAGTGCGG - Intergenic
1090164592 11:124533924-124533946 CCTCCTCGATAGAGGGAGTGAGG + Intergenic
1091556995 12:1581338-1581360 CCTCCTGGGGAGAGGGTTTGGGG + Intronic
1094058392 12:26288422-26288444 CCTCCTGGGCAGAGCCTGCGTGG - Intronic
1094224816 12:28033196-28033218 CCTTCTAAGCAGCTGGTGTGGGG - Intergenic
1096570157 12:52518272-52518294 CCTCATAGGCAGAGAGGGAGGGG + Intronic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1097986055 12:65784449-65784471 CCTCTTGGGAAGAGAGTGTGTGG - Intergenic
1099918140 12:88922038-88922060 CCTACTAGGCAGATGGTGAAAGG + Intergenic
1100836467 12:98571474-98571496 CCTGGGAGGCAGAGGCTGTGTGG - Intergenic
1101120958 12:101579690-101579712 CCTGGGAGGCAGAGGTTGTGGGG - Intronic
1104205005 12:126630506-126630528 GGTCCTAGGCAGAGGGGCTGCGG - Intergenic
1104450915 12:128867611-128867633 CCCCCGAGGCAGAGGGTAAGTGG - Intronic
1105432773 13:20352202-20352224 CCTCCTGTACAGTGGGTGTGTGG + Intergenic
1105723059 13:23135226-23135248 GATCCCAGGCAGAGGGTGAGGGG - Intergenic
1106616635 13:31336241-31336263 CCTCCAAGTCAGATGGGGTGAGG + Intergenic
1108001703 13:45910438-45910460 CATCCAAGGAAGTGGGTGTGAGG - Intergenic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1110176412 13:72561442-72561464 TATCCAGGGCAGAGGGTGTGAGG + Intergenic
1110920068 13:81073216-81073238 CATCCTAGGCAAGGGGTTTGTGG - Intergenic
1111808959 13:93073893-93073915 TCTCCTATGCAGACGGAGTGTGG - Intergenic
1112508757 13:99990792-99990814 GCTGCCAGGCAGAGAGTGTGTGG + Intergenic
1112761175 13:102695149-102695171 GGTCCTAGGCAGAGGCTGGGTGG - Intergenic
1113117195 13:106886080-106886102 GCTCCTTGGCAGAGGGGTTGGGG + Intergenic
1119103929 14:71906463-71906485 CCTCCTAGGCAAAGGGAGGTTGG - Intergenic
1119379608 14:74220076-74220098 CCTGCTAGGCATAGGATCTGGGG + Intergenic
1119666600 14:76489410-76489432 CCTGCATGGGAGAGGGTGTGTGG - Intronic
1121238715 14:92412517-92412539 CCTCCTGGGCACAGGGTGTGTGG + Intronic
1122931919 14:104937078-104937100 CCTCTGAGCCAGAGGCTGTGAGG - Exonic
1123955242 15:25328111-25328133 ACTCCAAGGAAAAGGGTGTGAGG + Intergenic
1124869903 15:33530383-33530405 CATCCTTGGGAGAGGGTGTGTGG - Intronic
1125649813 15:41307381-41307403 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
1126724627 15:51619836-51619858 CCTGCTCTGGAGAGGGTGTGTGG - Intronic
1128942747 15:71801916-71801938 CCTCATAGGATAAGGGTGTGTGG + Intronic
1130028840 15:80294100-80294122 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
1130040369 15:80401226-80401248 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
1130850824 15:87792004-87792026 CCTCATGGGCACAGGGTCTGAGG + Intergenic
1132684143 16:1155269-1155291 CCGCCCGGGCAGCGGGTGTGGGG - Intronic
1135004919 16:18811830-18811852 ACTCCTATGCAGTGAGTGTGTGG - Exonic
1137545014 16:49396692-49396714 CCCCCTGGGCAGATGGGGTGGGG + Intronic
1137760911 16:50939512-50939534 CATCCAAGGCAGAGGATGTGAGG - Intergenic
1138155841 16:54702189-54702211 CCTCCCAGGCAGAGGCCGTCAGG - Intergenic
1138356645 16:56386420-56386442 TCTCCCAGGCTGAGCGTGTGAGG - Intronic
1139545254 16:67646959-67646981 CCACCTCGGCAGTCGGTGTGTGG + Exonic
1139671115 16:68492964-68492986 CCTCAGGGGCAGAGGATGTGGGG + Intergenic
1140956522 16:79871427-79871449 CCTTCTGAGCAGAGGTTGTGAGG + Intergenic
1142151281 16:88513547-88513569 CTTCCTGGGCAGAGGGTGTGTGG + Intronic
1142411443 16:89919083-89919105 CCAGCCAGGGAGAGGGTGTGAGG + Exonic
1143886316 17:10067576-10067598 CCCCCTAGCCAGAGGGGGTGGGG - Intronic
1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG + Intergenic
1144677152 17:17168911-17168933 CCTGCTAGACAGTGGCTGTGAGG - Intronic
1144702072 17:17346643-17346665 CCGCCTTCGCAGCGGGTGTGAGG - Intronic
1144863014 17:18317595-18317617 CATCCTCGTCAGAGTGTGTGTGG - Exonic
1146550665 17:33777775-33777797 CCTCCCAGGTAGCAGGTGTGCGG + Intronic
1146953076 17:36920181-36920203 CATCCTAGGAAGAGAGTGTAGGG + Intergenic
1148207342 17:45787335-45787357 CCTCGTAGGGAGATGGAGTGTGG + Intronic
1149320935 17:55480016-55480038 CCTGCTACACAGAGGGAGTGGGG - Intergenic
1149646655 17:58246130-58246152 CCACCCAGGCAGAGGGCATGGGG + Intronic
1151198092 17:72446028-72446050 CTCCCTAGGCAGAGGGTCTGTGG + Intergenic
1151723139 17:75869701-75869723 CCTCCCAGGCACAGCGGGTGCGG - Intergenic
1151875498 17:76865832-76865854 CCCCTTAGGAAGAGGGAGTGGGG + Intergenic
1152170107 17:78740286-78740308 CCTTTAAGGCAGAGGCTGTGGGG - Intronic
1152231904 17:79117998-79118020 GCCCCCAGGCAGAGGGTTTGGGG - Intronic
1153940578 18:9973325-9973347 CCTGCTAGGTAGAGGATGAGAGG + Intergenic
1154411973 18:14146501-14146523 CCTCCTCGGCAGAGGCTTTGGGG + Intergenic
1155926331 18:31659466-31659488 GCTGCTAAGCAGAGGGTGTTGGG + Intronic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1157570102 18:48706540-48706562 AATCCTAGGCAGAGAGTGCGAGG - Intronic
1159084195 18:63769864-63769886 CCTCCCAGGTAGAGGGTTTGAGG - Intronic
1160399086 18:78596102-78596124 CCTCCTGAGCACAGCGTGTGAGG - Intergenic
1161006129 19:1937634-1937656 CTTCCTGGGCAGAGGATGTGCGG + Intergenic
1161171384 19:2814008-2814030 CTTCCTAGGCAGAGTCTCTGGGG + Exonic
1161284804 19:3463629-3463651 CCTCCTATGCCGGGGGTGGGGGG - Intronic
1162850217 19:13425363-13425385 CCTCCTAGGGAGCAGGGGTGGGG + Intronic
1163310865 19:16513808-16513830 CCTCCTGGGCTGAGTCTGTGTGG + Intronic
1163831367 19:19548608-19548630 CCTCCCAGACTGAGGGGGTGTGG - Intergenic
1165069471 19:33247399-33247421 CCTCCTGGGCTGAGGGGATGGGG - Intergenic
1165358780 19:35320719-35320741 CATCCTGGGCAGAGGTTGGGGGG + Intronic
1165363525 19:35350889-35350911 CCACCTGGGCAGGGGGTCTGGGG - Intergenic
1165367521 19:35377650-35377672 CCTGGTAAGCAGAGGTTGTGAGG + Intergenic
1168195815 19:54772893-54772915 CCTACCAGGAACAGGGTGTGTGG + Intronic
1168721598 19:58557665-58557687 CCTCAGAGTCAGAGGGGGTGGGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925538979 2:4945970-4945992 CCTCCTGGGCAGAGTCTGTGGGG - Intergenic
926218526 2:10920182-10920204 CCTCCGAGGAGGAGAGTGTGGGG - Intergenic
927128356 2:20034501-20034523 CCTTCTACACAGAGGATGTGTGG - Intronic
928323501 2:30302210-30302232 TCTCCTGGGAGGAGGGTGTGGGG + Intronic
929780348 2:44953121-44953143 CCTCCTAGGCAGCGCGTAGGAGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930689646 2:54347696-54347718 CATCCTAGGCAGAGGTTTGGAGG - Intronic
931216771 2:60252400-60252422 CGTGCTAGGCACCGGGTGTGGGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932291388 2:70583059-70583081 CCTCCTACCCTGAGGGTCTGTGG + Intergenic
933456482 2:82525877-82525899 CCTCATATCCAGAGGGTGAGTGG - Intergenic
934572581 2:95382264-95382286 CCTCCAAGGCAGTGAGTGCGAGG - Intronic
936161261 2:110085823-110085845 CCTCCTGGGCAGTGGGGCTGAGG - Intronic
936183402 2:110285531-110285553 CCTCCTGGGCAGTGGGGCTGAGG + Intergenic
938309953 2:130283340-130283362 CTTCCTAGGGAGGCGGTGTGGGG + Intergenic
938408782 2:131047068-131047090 CAGCCCAGGCAGCGGGTGTGTGG + Exonic
938444965 2:131369030-131369052 CTTCCTAGGGAGGCGGTGTGGGG - Intergenic
939104626 2:137934893-137934915 CCTACTTAGCAGAGGGAGTGAGG + Intergenic
940205230 2:151195178-151195200 CCACCTATACAGAGGGAGTGAGG - Intergenic
941622018 2:167788948-167788970 TCTCCCAGGCAGAGGGTCAGTGG + Intergenic
945282500 2:208048886-208048908 CATCCTAGTAAGAGGGTGTCAGG + Intergenic
946849358 2:223890045-223890067 CCTCATATACAGAGGCTGTGTGG - Intronic
947314459 2:228840702-228840724 TCTTCCAGGAAGAGGGTGTGAGG - Intergenic
948015530 2:234687758-234687780 AGGCCTAGGCAGAGGCTGTGTGG - Intergenic
948225693 2:236307642-236307664 CATCTAAGGCAGGGGGTGTGAGG + Intergenic
1169909943 20:10639830-10639852 CCTCAGAGGCTGAGTGTGTGTGG + Exonic
1173551253 20:43934512-43934534 CCACATAGGGAGGGGGTGTGTGG + Intronic
1173660154 20:44727520-44727542 CCTCCTAGGCAGTGAGTTAGAGG - Exonic
1173704603 20:45100790-45100812 CCTCCTTGGCGGGGGGTGGGGGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174272618 20:49380642-49380664 ACTCCAAGGTGGAGGGTGTGGGG + Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174399153 20:50266745-50266767 CCTTCTAGGGAGGGGTTGTGTGG - Intergenic
1175114733 20:56674036-56674058 GCTCTCAGGCAGAGGGTGGGTGG + Intergenic
1175417134 20:58809199-58809221 CCTCCTGTCCTGAGGGTGTGTGG - Intergenic
1176378045 21:6096504-6096526 CTTCCTGGGCAGGGGTTGTGAGG + Intergenic
1176861062 21:14011830-14011852 CCTCCTCGGCAGAGGCTTTGGGG - Intergenic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1179745428 21:43441742-43441764 CTTCCTGGGCAGGGGTTGTGAGG - Intergenic
1179958114 21:44752265-44752287 CCTCCTGGGCAGAGCTGGTGGGG - Intergenic
1180351431 22:11807741-11807763 CCTGCCAGGCTGAGTGTGTGGGG + Intergenic
1180386771 22:12184336-12184358 CCTGCCAGGCTGAGTGTGTGGGG - Intergenic
1180703332 22:17793688-17793710 CCTCCGAGGCAGTGGGGATGGGG + Intronic
1181036945 22:20174291-20174313 TCACCTGGGCAGAGGGTGGGAGG + Intergenic
1181107000 22:20581514-20581536 GCTCCTAGGCAGACTGTGAGGGG + Intronic
1181634717 22:24169245-24169267 CCTCCAAGCCAGAGGGTAGGTGG + Intronic
1182687610 22:32132985-32133007 CCTCCAAGTCAGAGGAAGTGGGG + Intergenic
1182749973 22:32633589-32633611 CCTCCGAGGCAGAGGGAGCAAGG + Intronic
1184516528 22:44965857-44965879 ACTCCTAGGCACAGGGGGTCAGG + Intronic
1184528086 22:45037244-45037266 TCCCCTAGGGAGAGGGTGTAGGG - Intergenic
1184794252 22:46722477-46722499 CCTCCTGGGTATAGGATGTGGGG + Intronic
1185366266 22:50438318-50438340 CCTCCTCGGCAGAGGCTTTGTGG - Intronic
951268877 3:20601940-20601962 CCTGCCTGGCAGAGGGCGTGGGG + Intergenic
953290921 3:41661644-41661666 CCTGTGAGGCAGAGGGTGTGGGG + Intronic
953582543 3:44170143-44170165 TCTCCAATGCACAGGGTGTGTGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955131777 3:56176840-56176862 CCACCTAGGTAGTGGTTGTGGGG - Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
960958758 3:123054263-123054285 CCTCCTTGACAGAGGGTGAAAGG - Intergenic
961320245 3:126068131-126068153 CCTCCTGTGCTGAGGGGGTGAGG + Exonic
961451714 3:127005197-127005219 CCTCCCGGGCGGAGGGTGAGCGG - Exonic
961467172 3:127089039-127089061 CAGCCTAGGCATTGGGTGTGGGG - Intergenic
961481446 3:127183390-127183412 CCTGCTTGGCACAGGGTGAGAGG + Intergenic
962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG + Exonic
965590810 3:170358261-170358283 CTTCCCAGGGAGAGGGTGCGCGG + Intronic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
967690477 3:192467968-192467990 CCTCCTCGGCAGAGGATGAAAGG + Intronic
968504275 4:964706-964728 CCTCCCGGGCAGGGGGAGTGAGG + Intronic
968657071 4:1783324-1783346 CATCCTTAGGAGAGGGTGTGTGG + Intergenic
968904481 4:3445105-3445127 CCTCCCAGGCAGAGGTTCCGGGG - Intronic
968921072 4:3522600-3522622 CTCCCCAGGCAGGGGGTGTGGGG - Intronic
968921085 4:3522634-3522656 CTCCCCAGGCAGGGGGTGTGGGG - Intronic
968921099 4:3522668-3522690 CTCCCCAGGCAGGGGGTGTGGGG - Intronic
968921112 4:3522702-3522724 CTCCCCAGGCAGGGGGTGTGGGG - Intronic
969813817 4:9671145-9671167 CCTTCTAGGCAGCCTGTGTGGGG + Intergenic
970367601 4:15375757-15375779 CAACCCAGGCTGAGGGTGTGGGG - Intronic
972415127 4:38832216-38832238 CCTTCTTTGCAGAGGGGGTGAGG - Intronic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
985065690 4:186118820-186118842 CCTCCCAGGCAGTGGGTGCTTGG - Intronic
985129633 4:186726705-186726727 CCTCCAAGGGGGAGGGAGTGGGG - Intronic
986082092 5:4405547-4405569 CCTCATTGGCAGAGTGGGTGGGG + Intergenic
986910956 5:12556363-12556385 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
987005165 5:13703150-13703172 TGTCCTGGGTAGAGGGTGTGGGG - Intronic
990216894 5:53543583-53543605 CCTGGTAGGCTGAGGGAGTGGGG + Intergenic
992445920 5:76833375-76833397 GCACATAGGCAGAGGCTGTGAGG - Exonic
993738874 5:91511581-91511603 CCTCCTAGGCACATGCTATGTGG - Intergenic
997445974 5:133940665-133940687 CATCCTTGGCAGGGGGTGGGGGG - Intergenic
997660536 5:135586196-135586218 CCTCCCAGGAGGAGGGTGGGGGG + Intergenic
998133082 5:139660866-139660888 CCTCCCAGCCAGTGGGTGGGTGG - Intronic
998184640 5:139968858-139968880 CCTCCTGGGCTGAGGCTGGGAGG - Intronic
998353042 5:141513480-141513502 ACCCCTAGGCAGCGGGGGTGGGG - Intergenic
998578086 5:143339707-143339729 CCTTCTAGGCTGAGGGTTGGTGG + Intronic
998806500 5:145922176-145922198 TAACCTGGGCAGAGGGTGTGTGG - Intergenic
999134718 5:149310995-149311017 CCTGCCAGGCAGTGAGTGTGTGG + Intronic
999301050 5:150490610-150490632 CCTCCAAGACAGAAGCTGTGAGG - Intronic
1000285109 5:159819963-159819985 CCTCCTAGGGATGGGGGGTGGGG + Intergenic
1000822751 5:166004916-166004938 ACTCCTAGGAAGAGGATTTGTGG + Intergenic
1001430659 5:171659222-171659244 TCTTCTAGGCAGTGGGGGTGGGG + Intergenic
1002321795 5:178380848-178380870 CTTCCAGGGCAGCGGGTGTGGGG + Intronic
1004961247 6:20791111-20791133 ATGCCTAGGCAGAGGGTGTCGGG - Intronic
1005019593 6:21404789-21404811 CCTCCTAGGCAAACTGTGAGAGG - Intergenic
1005811566 6:29519881-29519903 CCTGCAAGGCAGAGGGAGAGAGG - Intergenic
1008526150 6:52408977-52408999 CCTTCAAGGAAGAGGATGTGTGG + Intergenic
1010215760 6:73400014-73400036 CCTCCTAGTCAGATGGAGAGGGG - Intronic
1013234415 6:108184503-108184525 AATCCTAGTCAGAGGGAGTGAGG + Intronic
1013633591 6:112008345-112008367 TCTCCTGGGCACAAGGTGTGGGG - Intergenic
1017820854 6:158048228-158048250 TCTCCCAGGCTGAGGGTGTGGGG + Intronic
1018550590 6:164992967-164992989 CCTGGGAGGCAGAGGTTGTGGGG + Intergenic
1019472101 7:1226689-1226711 CCTCTGAGGCAGAGGGAGAGGGG + Intergenic
1019586893 7:1809912-1809934 CCTCCTGGGCAGAGGGACAGAGG - Intergenic
1019985235 7:4650714-4650736 CCTCCTTGGCAGAGCGCTTGGGG - Intergenic
1022500446 7:30879255-30879277 CCTCCTAAGCAGAGGAGGTTAGG + Intronic
1026448381 7:70505763-70505785 CCTGCTAACCAGAGGGTTTGGGG + Intronic
1027560472 7:79722225-79722247 TCTCCAAGGGAGAGGGTGTATGG - Intergenic
1028705520 7:93840486-93840508 CCTCCCAGGCAAAGGGCTTGAGG - Intronic
1028865569 7:95707437-95707459 CCTACTAGCCAGAGGGGATGAGG + Intergenic
1030273205 7:107692101-107692123 CCTCCTTGGCACAGGGTTTGGGG + Intronic
1031986426 7:128167163-128167185 CGTGCTAGGTAGAGGGTGGGAGG + Intergenic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1036119785 8:6003310-6003332 TCTGCTAGGTAGAGGGAGTGGGG - Intergenic
1036575857 8:10027189-10027211 CCTCCTAGGAGGATGATGTGAGG - Intergenic
1037162540 8:15790644-15790666 CCTTCTAGGTAGAGGTTGTGAGG - Intergenic
1038250847 8:25902962-25902984 CCTGGTAGGCAGAGGCTGAGTGG + Intronic
1039040507 8:33403604-33403626 GCTACTAGGGAGAGAGTGTGAGG + Intronic
1039438484 8:37578260-37578282 CCTCCTTGGCAGAGGGTCCAGGG - Intergenic
1039923394 8:41908424-41908446 TGTGCCAGGCAGAGGGTGTGGGG - Intergenic
1040512089 8:48104997-48105019 GCCCCTAGGAACAGGGTGTGAGG + Intergenic
1040797222 8:51299572-51299594 GCTCATAGGCAGAAGGTGAGAGG - Intergenic
1041106996 8:54453962-54453984 CCTCCAAGGCAGGGGGCGCGCGG + Intergenic
1047750793 8:127878897-127878919 CCCCCTAGGCTCAGGGAGTGGGG - Intergenic
1048425521 8:134319663-134319685 CAGCCCAGGGAGAGGGTGTGAGG + Intergenic
1048475671 8:134740209-134740231 CCTTCTAGGAAGAGTGAGTGAGG + Intergenic
1049180722 8:141220720-141220742 GCTCCGAGGCAGAGGGGCTGGGG + Intronic
1049289723 8:141795373-141795395 CCTCCCATGCTGAGGGTCTGAGG - Intergenic
1049376040 8:142289666-142289688 GCTCCTATGCAGAGGGCTTGGGG - Intronic
1049403493 8:142441348-142441370 GCTCCAAAGCAGAGGCTGTGTGG - Intergenic
1049591371 8:143464460-143464482 CCTCCTGGGAAGTGGGTGTGAGG + Intronic
1051337106 9:16076047-16076069 CCACCAATGCAGAGGGTCTGTGG + Intergenic
1053421878 9:37984866-37984888 CCTCAGAGGCTGAGGGTGAGTGG + Intronic
1057117626 9:92540693-92540715 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
1058547084 9:106072143-106072165 CCTGGAAGGCAGAGGTTGTGGGG + Intergenic
1060989971 9:127843030-127843052 GCTCCAAGGCAGATGGGGTGAGG - Intronic
1061082161 9:128378024-128378046 CCTCCTTTGCAGAGGTGGTGCGG + Exonic
1061183774 9:129040254-129040276 CCTGGTAGGCAGAGGGTCTGTGG + Intronic
1061684596 9:132264724-132264746 CCTTGGAGTCAGAGGGTGTGTGG + Exonic
1185854380 X:3520557-3520579 CGGCCTTGGCAGAGGCTGTGGGG - Intergenic
1186612902 X:11155835-11155857 CTGCAGAGGCAGAGGGTGTGGGG - Intronic
1186896917 X:14012837-14012859 CCTCCCAGGCAGAGGGGCTATGG + Intronic
1192584701 X:72309727-72309749 CCTCCTAGGCAGCGGGGATTAGG - Intergenic
1196268508 X:113682150-113682172 CCTTCTGGGTAGAGAGTGTGGGG - Intergenic
1196782794 X:119398784-119398806 CCTCATTGACAGAGGCTGTGTGG - Intergenic
1196930174 X:120674268-120674290 CCTCATAGGCAGAGGGGATTAGG - Intergenic
1197819355 X:130529713-130529735 CATCCAAGGCTGAGGGAGTGAGG - Intergenic
1198030110 X:132746613-132746635 CTTCCTAGGCAGAGGGAGTGAGG - Intronic
1200119548 X:153783870-153783892 CCACCCAGGCTGAGGGTGAGGGG + Exonic
1200211718 X:154349565-154349587 CCTGCAAGGCAGAGTGGGTGGGG + Exonic