ID: 962250179

View in Genome Browser
Species Human (GRCh38)
Location 3:133831384-133831406
Sequence CCATTAGCAACATGGGCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962250174_962250179 20 Left 962250174 3:133831341-133831363 CCAGTGATGGAAATATTCTATAT 0: 1
1: 7
2: 8
3: 47
4: 247
Right 962250179 3:133831384-133831406 CCATTAGCAACATGGGCAACTGG 0: 1
1: 0
2: 1
3: 11
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962250179 Original CRISPR CCATTAGCAACATGGGCAAC TGG Intronic
905744995 1:40408011-40408033 CCATTACCAACTTTAGCAACTGG - Intronic
910206648 1:84754891-84754913 CCGCTAGCAAAATGGGCACCGGG - Intergenic
910541878 1:88368801-88368823 CAATTAGGAATATGAGCAACTGG + Intergenic
916984036 1:170171197-170171219 CCATTAAAAAAATGGGCAAACGG - Intergenic
917687492 1:177432163-177432185 CCATTAGCAACGTGGGTAAAGGG - Intergenic
1063765668 10:9137550-9137572 ACGGTAGCAGCATGGGCAACTGG + Intergenic
1067762287 10:49057416-49057438 CCCTTAGCGACAGGGACAACAGG + Intronic
1067776627 10:49168982-49169004 CCATTCGCAAAATGAGGAACGGG + Intronic
1069324870 10:67220992-67221014 CCATTAACATCATGGAAAACAGG + Intronic
1071429541 10:85595915-85595937 CCATGAGATACATGGGCAACAGG - Intergenic
1072321886 10:94258704-94258726 CAATTAGCAATATGAGCAAAAGG - Intronic
1074047163 10:109849739-109849761 CCATTACCATCCTGGGCACCTGG - Intergenic
1076686646 10:132201175-132201197 CCAACAGCAACAGGGGCAGCTGG + Intronic
1076726138 10:132414224-132414246 TCATTAGAAACATGTGTAACGGG - Intronic
1077251634 11:1563377-1563399 CCAAAAGCAGCCTGGGCAACTGG - Intronic
1087047033 11:93850870-93850892 TCATTGGCATCATGGGCAAAGGG + Intergenic
1088768508 11:113009522-113009544 CAATTACCAACCTGGGCAACAGG - Intronic
1089492783 11:118894225-118894247 CCATCACCAGCATGGGCAGCAGG - Exonic
1093189989 12:16063006-16063028 CCAGTAGTAAAATGGGCAAAAGG + Intergenic
1093275789 12:17123808-17123830 CCATTAAAAAAATGGGCAAGGGG - Intergenic
1094252691 12:28383126-28383148 CCCTTAACAACAAGGCCAACAGG + Intronic
1098108865 12:67100704-67100726 ACAGTAGGAACATGGACAACAGG - Intergenic
1100590371 12:96022535-96022557 AAATTAGCAATATGGGAAACTGG + Intronic
1105357141 13:19669067-19669089 CCATTTACAAAATGGGGAACAGG - Intronic
1106381633 13:29245102-29245124 TCATCAGAAACATGGGCATCAGG - Intronic
1109483212 13:62984421-62984443 CCATTGGAAACAAGGGCAAAGGG - Intergenic
1109860295 13:68189814-68189836 CCATTTCCAACTTGGACAACTGG + Intergenic
1110310752 13:74046227-74046249 ATATTAGCAACACGGGAAACTGG + Intronic
1111467370 13:88632521-88632543 CCATTCACAACTTGGCCAACTGG - Intergenic
1112736371 13:102424481-102424503 CCAATAGAAAAATGGGCAAAAGG + Intergenic
1117767697 14:59100125-59100147 CCAGTGGCAACATGGGCTTCAGG - Intergenic
1120666423 14:87311406-87311428 CCTTGAGCATCATGGGTAACAGG - Intergenic
1121891740 14:97600665-97600687 CTAATAGAAACATGGGCAAAAGG + Intergenic
1125830725 15:42715477-42715499 CTAAGACCAACATGGGCAACAGG + Intronic
1126273770 15:46851402-46851424 CCATGTGCAACATGGGAAGCAGG + Intergenic
1133324304 16:4934199-4934221 TCATTAGGAACCCGGGCAACGGG + Intronic
1135208658 16:20504410-20504432 CCATTCACAAACTGGGCAACAGG + Intergenic
1136745412 16:32584959-32584981 CCATTAGCAGAATGGACAAAAGG - Intergenic
1137559565 16:49493989-49494011 CCACTACCAACATGGGCACAGGG + Intronic
1141974485 16:87506302-87506324 CCACGAGAAACATGGGAAACGGG + Intergenic
1203047538 16_KI270728v1_random:844164-844186 CCATTAGCAGAATGGACAAAAGG - Intergenic
1144540283 17:16134691-16134713 CCTCTATCATCATGGGCAACTGG + Intronic
1146447746 17:32946026-32946048 CCAGTAGAAAAATGGGCAAAGGG - Intergenic
1153150521 18:2087578-2087600 CCATTAGCAAGATGACAAACTGG - Intergenic
1154319775 18:13338363-13338385 CCACTAGCAACTTGGGAACCTGG - Intronic
1164720429 19:30428033-30428055 CCATTAGAAACCTGGACAAAAGG - Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
926881840 2:17553618-17553640 ACATCAGCAACATGGGAAAATGG + Intronic
934566503 2:95344421-95344443 GCATTAGCCACCTGGGCTACGGG - Intronic
935556742 2:104518667-104518689 CCTTTACCAACATGGGTACCAGG + Intergenic
935939478 2:108223184-108223206 CCATTATAAACCTGGGTAACAGG - Intergenic
936736506 2:115449270-115449292 CCAATAGTAACATGGTCAACTGG - Intronic
940103506 2:150070297-150070319 CCATTACCAACAAGGAAAACTGG + Intergenic
942131560 2:172885246-172885268 CCAATACCGCCATGGGCAACTGG - Intronic
942324842 2:174767227-174767249 CCATTTCCATCATGGGCAACAGG - Intergenic
943894660 2:193340538-193340560 CCATTATCATCATTGGTAACAGG - Intergenic
1171484214 20:25475962-25475984 CCATTAGCAACAGGGGTCAGTGG + Intronic
1172265778 20:33612280-33612302 CAATTAGAAACATTGGGAACTGG - Intronic
1175511599 20:59531523-59531545 CCATTATCAACATCGCCCACTGG - Intergenic
1176919780 21:14674062-14674084 ACATTTGCAACCTGGGTAACTGG + Intergenic
1182026069 22:27120279-27120301 GCATTACCACCATGGGCCACTGG - Intergenic
1184479661 22:44739032-44739054 CCATTAGCAACATGGGCAGGAGG + Intronic
950801887 3:15559154-15559176 CCAGTAGAAAAATGGGCAAAGGG - Intergenic
952626447 3:35410893-35410915 CCATTAACAACAGGAACAACTGG - Intergenic
957379968 3:79414736-79414758 CCATTATAAATATGGGAAACTGG + Intronic
959016641 3:101142228-101142250 CCATGAGCAAAATGGGCAAGAGG + Intergenic
959789880 3:110346816-110346838 TCATCATCAAAATGGGCAACTGG + Intergenic
962250179 3:133831384-133831406 CCATTAGCAACATGGGCAACTGG + Intronic
962346152 3:134620268-134620290 ACACTAGCAACATTGGCCACTGG - Intronic
964057030 3:152473299-152473321 CCATTAGGAAAAAGGGCAAGGGG + Intergenic
967317644 3:188164316-188164338 TCATTATCAAGATGGGCCACTGG - Intronic
971255152 4:25007808-25007830 CCTTTGGCAACATGGTCACCAGG + Intronic
973804571 4:54513457-54513479 CCAGCAGCAACTTGGGCAGCAGG + Intergenic
980158809 4:129136143-129136165 TCATCAGCATCATTGGCAACTGG + Intergenic
985276134 4:188239748-188239770 CCAATAGGAAAATGGGCAAAGGG - Intergenic
986133829 5:4955794-4955816 CCCTGAGAAACATGGGCATCTGG + Intergenic
986287789 5:6372759-6372781 CCAATAGCAACATATGCAAAAGG + Intronic
986597923 5:9442574-9442596 CCATGAGCCACATGGCAAACAGG + Intronic
988854415 5:35214022-35214044 CCATTAGCAAGAGGCACAACGGG - Intronic
991479099 5:67057853-67057875 CCAATAGAAAAATGGGCAAAAGG + Intronic
991498179 5:67248743-67248765 CCATTAGCAAAATAGGCAAGTGG - Intergenic
991517129 5:67449686-67449708 CCATTACCACCATGGATAACTGG - Intergenic
991553953 5:67874390-67874412 GTATTAGCATCATGGGGAACAGG - Intergenic
992777249 5:80099162-80099184 CCATTTGCCACATGCCCAACAGG + Intergenic
994293868 5:98065289-98065311 CCATTAGCCACATGTGGCACTGG + Intergenic
995761804 5:115570571-115570593 CCAATAGAAACTTGGGCAAAGGG + Intergenic
995793238 5:115915860-115915882 CCAACAGCAAAATGGGCAAGAGG + Intergenic
1006030410 6:31173267-31173289 CCACTAGGAAAATGGGCAGCAGG - Intronic
1007642890 6:43357037-43357059 CCATTAGGAACATAGCCCACAGG + Intronic
1009372015 6:62916943-62916965 CCATTAAAAAAATGGGCAAATGG + Intergenic
1012612458 6:101232390-101232412 GAATTATCACCATGGGCAACTGG - Intergenic
1018145927 6:160888686-160888708 CCTTTAGCAAAATGGGAAACTGG + Intergenic
1019323984 7:429024-429046 CCATTGGCAACATGGGCGGCAGG + Intergenic
1023531627 7:41162570-41162592 CCATTAGAAAAATGGGTAACAGG + Intergenic
1027830168 7:83166824-83166846 CCATTGGCAATATGGCCTACGGG + Intergenic
1028534493 7:91877220-91877242 CTATTAGCATCATGGTAAACAGG + Intronic
1033029152 7:137808085-137808107 CCAATATCAACATGAACAACTGG - Intronic
1034741424 7:153477507-153477529 CCATCAACAAGATGGTCAACAGG - Intergenic
1036109239 8:5879145-5879167 ACATTATCCACAAGGGCAACGGG - Intergenic
1038710950 8:29944977-29944999 CCATTAGCAACTGGGGCCACAGG + Intergenic
1041709677 8:60882460-60882482 CCAGTAGAAAAATGGGCAAAAGG - Intergenic
1048005849 8:130418928-130418950 CCTTCAGCGACATGGGCCACAGG + Intronic
1057443149 9:95096408-95096430 CCATCGGCAACATGGGGAGCTGG + Intergenic
1187569928 X:20490472-20490494 CAATTATCAGTATGGGCAACTGG - Intergenic
1187727073 X:22214498-22214520 CAGTTATCACCATGGGCAACTGG + Intronic
1189860257 X:45264332-45264354 CCATTAGCAACAAAGCCCACAGG - Intergenic
1195512167 X:105728649-105728671 ACATTAACAAAATGGGAAACTGG - Intronic
1196950344 X:120870404-120870426 CCCATAGCAAGATGGGCTACTGG + Intergenic
1199535462 X:148897753-148897775 CCCTTAGCATCAGGGGCAAGAGG + Intronic