ID: 962251631

View in Genome Browser
Species Human (GRCh38)
Location 3:133839522-133839544
Sequence CATGCTGGTGGGCAACAAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 1, 2: 3, 3: 19, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962251631_962251639 29 Left 962251631 3:133839522-133839544 CCGTCTTGTTGCCCACCAGCATG 0: 1
1: 1
2: 3
3: 19
4: 193
Right 962251639 3:133839574-133839596 GACGTCGTCGATCCACTTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962251631 Original CRISPR CATGCTGGTGGGCAACAAGA CGG (reversed) Exonic
901190184 1:7405223-7405245 CAGGCTTGGGGGCCACAAGATGG + Intronic
902924264 1:19685466-19685488 TATGTTGGTGAGCAACAAGTAGG + Intronic
903010550 1:20327204-20327226 CATGTTGGTGAGCATCCAGAGGG - Intronic
906165405 1:43682297-43682319 CATTCTGGTTGGAAAGAAGATGG + Intronic
907732380 1:57079670-57079692 CAAGGTGGTGGGGAACAAGGGGG - Intronic
910720014 1:90275468-90275490 CATGCTGCTGGTCAACAGGTGGG - Intergenic
912484171 1:110011394-110011416 GATTCTGATGGCCAACAAGAGGG - Intronic
912797649 1:112702613-112702635 CATCCTGGTGGGGAATAAGAAGG - Exonic
913214304 1:116607766-116607788 TATGCAGGTGGGCTACAACAGGG + Intronic
915653336 1:157335925-157335947 CTTGCTGGTGGGCAGGAAGCAGG + Intergenic
915684237 1:157615582-157615604 CTTGCTGGTGGGCAAGAAGCAGG - Intergenic
917064958 1:171082439-171082461 TATGCTTGTGGGTAACACGATGG - Intergenic
917590279 1:176469420-176469442 CATGTTGGTGGGGTACTAGAGGG - Intronic
1063622077 10:7658877-7658899 CATGCTGGAGGGGTACAAGGAGG + Intronic
1067709018 10:48633986-48634008 CATCCTGGTGGCCAGGAAGAAGG - Intronic
1067927776 10:50527814-50527836 CATGCTGCAGGGAAAGAAGAGGG + Intronic
1070828584 10:79405260-79405282 GAGGCTTGTGGGAAACAAGATGG - Intronic
1072787358 10:98293345-98293367 GATGCTGGGGGGCAGCTAGATGG + Intergenic
1072871229 10:99123523-99123545 CCTTGTTGTGGGCAACAAGAAGG - Intronic
1075197704 10:120375333-120375355 CATGCTTCTGGTCAACAGGATGG + Intergenic
1076912189 10:133396219-133396241 CTTGCTGGTCCTCAACAAGATGG + Exonic
1077633740 11:3827787-3827809 CCTGCTGGTGGGCACCAAGAAGG - Exonic
1077907310 11:6544532-6544554 AATGCTGGTGGGAAACACTAGGG - Intronic
1078730503 11:13969831-13969853 AATGCTGGAGGGAAACTAGAAGG - Intronic
1079609192 11:22410115-22410137 CATGCTTGTGAGCAACCAGTGGG + Intergenic
1082767069 11:57178820-57178842 CCAGATGGTGGGCGACAAGATGG - Intergenic
1083714617 11:64568298-64568320 CAGGCTGGCGGGCAGCAGGAAGG + Intronic
1084891052 11:72237429-72237451 CAGGCTGGGGGGCAGGAAGATGG - Exonic
1085865082 11:80281465-80281487 CATGTTTGTGGGATACAAGAAGG + Intergenic
1088363809 11:109018181-109018203 CATGGTGGTGGGCACCAGGCTGG + Intergenic
1089661166 11:119986462-119986484 TAGGCTGGTGGGCAAGAGGAGGG + Intergenic
1089793449 11:120961082-120961104 GATGCTGGTGAGCAACCAAATGG - Intronic
1090056789 11:123430792-123430814 CATGCCGGCGGCCAACATGATGG + Exonic
1090664130 11:128903770-128903792 CATGCTGGAGGGGAGCAGGAGGG + Intronic
1091746650 12:2997111-2997133 CATGCTCATGAGCCACAAGACGG - Intronic
1096720346 12:53516726-53516748 CATGCTGGTAAGGAACAAAAAGG + Exonic
1096747224 12:53736985-53737007 TGTGCTGGTGGACTACAAGAAGG - Intergenic
1097053691 12:56238091-56238113 AACGCTGGTGGGCAGCAATAAGG - Exonic
1097559790 12:61188943-61188965 CCAGCTGGCGGGCAACAAGATGG + Intergenic
1097767082 12:63538213-63538235 CATGCTGGTGTGGAAGAGGAGGG - Intergenic
1097783431 12:63733157-63733179 CATGCTGGTGTGGAAGAGGAGGG - Intergenic
1099688001 12:85913823-85913845 GATGCTGGGCAGCAACAAGATGG - Intergenic
1100012280 12:89967913-89967935 CATGGAGGTGGGGACCAAGATGG - Intergenic
1103601501 12:122057476-122057498 CCTGCTTGTGGCCAACAGGATGG - Intronic
1105944263 13:25176256-25176278 AATGCTGGTAGGCACCAAGGGGG + Intergenic
1106169083 13:27273191-27273213 CATCATCGTGGGCAACAAGGGGG + Exonic
1106438623 13:29745638-29745660 CAGGCTGGTGGTCACAAAGAGGG - Intergenic
1107479657 13:40775222-40775244 CATGCTAGTGGGTCACAAAAGGG + Intergenic
1109571899 13:64203788-64203810 TATGCTGGTGGGGAAGAATAAGG + Intergenic
1109647959 13:65285265-65285287 CATGCTGGTGGGAAACACTATGG - Intergenic
1110998037 13:82138710-82138732 CATGGTGGAGGGCAAAAAGAGGG - Intergenic
1113013587 13:105799970-105799992 CATGGTGGTGGGCAGTAATAAGG - Intergenic
1114241738 14:20874429-20874451 CATGCGAGTGGGCTGCAAGAAGG - Intergenic
1114248330 14:20934995-20935017 CATGCGAGTGGGCTGCAAGAAGG - Intergenic
1118897367 14:69956237-69956259 CACTCTGGTGGGCAGCCAGACGG + Intronic
1121388781 14:93556237-93556259 CATGCTCTTGGGCAACTAGAAGG - Intronic
1121637794 14:95465590-95465612 CAGGCTGGTGGGGAAGTAGATGG + Intronic
1122857328 14:104566088-104566110 CAGGCTGGAGGGCACCATGAAGG + Intronic
1125285481 15:38088279-38088301 CATGCTGGTTTGGGACAAGATGG - Intergenic
1127006516 15:54576717-54576739 TGTGCTGGTGGGGGACAAGAGGG - Intronic
1128107984 15:65058443-65058465 CCTGCTGCTGGGCAACAAGCTGG - Exonic
1128133269 15:65244954-65244976 GATGCTGGGGGGATACAAGAAGG + Intronic
1128468257 15:67930555-67930577 CCTGCTGATGGGGAACAAGCTGG + Intergenic
1128756506 15:70187177-70187199 CATGCTGGTGGTGAATAGGATGG - Intergenic
1130396713 15:83508776-83508798 CATGATGGTGGCCAACCAGATGG - Intronic
1132878954 16:2152867-2152889 CATGCTGCTGGGGAACAAGGTGG + Exonic
1132893094 16:2214177-2214199 CCTGCTCGTGGGCACCAACATGG - Exonic
1134471413 16:14529788-14529810 CATGCTTGAGGGGAACAGGAAGG - Intronic
1135687923 16:24513271-24513293 CATTCTGGTGTGCCACAGGATGG + Intergenic
1136172527 16:28497448-28497470 CATGCAGGTGGGCAAGAATTTGG + Exonic
1137549361 16:49426633-49426655 AATGCTCATGGGCAACAACAGGG - Intergenic
1137596065 16:49724738-49724760 AATGCTGCTGTGCAACAAGCCGG - Intronic
1139423754 16:66866225-66866247 CATGCTGGTGGGACACTCGAAGG + Intronic
1140291951 16:73667519-73667541 CATGCTGGTGGAATACAAAATGG - Intergenic
1140530890 16:75664876-75664898 CTTGCTGGTGGGGACCAAGGTGG - Intronic
1141066201 16:80916017-80916039 CACGGTGGTGGGCAAGAGGAAGG - Intergenic
1141780555 16:86157566-86157588 CATGCTGGGGACTAACAAGATGG + Intergenic
1143418555 17:6770237-6770259 CATGCTAGGAGGCAGCAAGAAGG - Intronic
1144391228 17:14795337-14795359 TATGCTAGTGGGCAAAGAGAGGG + Intergenic
1145743795 17:27297969-27297991 CGTGGTGGTGGGCATCATGATGG + Intronic
1146405653 17:32534807-32534829 CCAGCTGGAGGGCCACAAGAAGG + Intronic
1146788978 17:35741062-35741084 CATCATCGTGGGCAACAAGCGGG + Exonic
1147995075 17:44355771-44355793 CAGGATGGTGAGCAAGAAGATGG + Exonic
1149655644 17:58308465-58308487 GCTGCTGGTGGGCAGCAAGCAGG + Intronic
1152744736 17:82033481-82033503 CCTCCTGGTGGGCACCAAGCTGG + Exonic
1153049657 18:889796-889818 CATCCTGGGGGCCAAAAAGAGGG - Intergenic
1156268379 18:35508684-35508706 CATGCTGGTTAGCAAGAGGAAGG - Intergenic
1156937378 18:42726623-42726645 CATGGTGGGGGGCAAGGAGAGGG + Intergenic
1158413709 18:57231146-57231168 CATGCTGGTGGGGGACAGGTGGG + Intergenic
1158496187 18:57956997-57957019 CAGGCTGGTGGGCACTGAGATGG + Intergenic
1162422654 19:10574694-10574716 CAAGCCGGTGGGGAACAAGGTGG + Intronic
1162729043 19:12706589-12706611 CATCCTGGATGGCAACAAGAGGG - Exonic
1167528049 19:49997567-49997589 CATCCTGGTGGGGGACAGGAGGG + Exonic
925046016 2:773690-773712 CCTGCTGGGGGGAAACAGGATGG - Intergenic
926043473 2:9692915-9692937 CAAGCTTGTGAGCAACGAGACGG + Intergenic
927423841 2:22959195-22959217 CATGCTCATGGCCAAGAAGAAGG - Intergenic
931349158 2:61472243-61472265 CCTGCTAGTGGGAAACAAAACGG - Intergenic
932096434 2:68853688-68853710 TGTACTGGTGGACAACAAGATGG + Intergenic
933063443 2:77767549-77767571 CAGGGTGGTGGGCTCCAAGATGG - Intergenic
934593291 2:95578461-95578483 CAGGCTGTTGAGCAACAAAAAGG - Intergenic
936076640 2:109405572-109405594 CATGCTGAGGGGCAGCAAAAGGG - Intronic
939091317 2:137782978-137783000 CATGCTCTTGGGCACCTAGAAGG + Intergenic
939670327 2:145002855-145002877 CATGATGCTGGGCAGCAACAGGG - Intergenic
941752562 2:169148505-169148527 CATGGTGGTGTGCAAGTAGAAGG + Intronic
944022619 2:195125159-195125181 CCTGCTTGCAGGCAACAAGAAGG - Intergenic
945499776 2:210557528-210557550 AATGCTGGGGGGCAGGAAGAAGG - Intronic
946035299 2:216737170-216737192 CTTCTTGGTGGGCAGCAAGATGG + Intergenic
946362116 2:219225209-219225231 AATCCTGGTGGGGAAAAAGAAGG + Exonic
947312707 2:228821567-228821589 CCAGCTGGTTGGCAACAAGATGG + Intergenic
948385325 2:237577289-237577311 GATGCTGGTGGGCAACAAGACGG - Exonic
1170565418 20:17599452-17599474 TATGCTGGTAGGCACCAAAAGGG - Intronic
1172152671 20:32801384-32801406 CATGAAGGTTGGCGACAAGAGGG + Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177829596 21:26122522-26122544 CATGCTGGTGGGAAGTCAGATGG - Intronic
1178595697 21:33950448-33950470 CACGTTGGTGGTCAAGAAGAGGG + Intergenic
1178891717 21:36525625-36525647 CAAGCTGGTGAGCAGCAGGATGG + Intronic
1181672080 22:24430379-24430401 GAGGCTGGTGGGCAGCAGGAAGG + Intronic
1182503057 22:30762634-30762656 CACGCTGGCTGGCAGCAAGATGG - Intronic
1182667062 22:31967684-31967706 AATGGTGGTGAGCAACAAGGAGG - Intergenic
1183332983 22:37231327-37231349 CATCCTGGTGGGCACCAAGCTGG - Exonic
1183986811 22:41574714-41574736 GATGCTGGCGGGCAGGAAGAGGG - Exonic
1185377150 22:50487867-50487889 CATGCTGGCGGGGAAGGAGAAGG - Exonic
949809273 3:7988569-7988591 CTTGATGGTGGGCTACCAGAAGG + Intergenic
950002923 3:9671132-9671154 CCTGATGGTGGAGAACAAGAAGG + Exonic
950101566 3:10360075-10360097 TCGGCAGGTGGGCAACAAGACGG - Exonic
953795190 3:45979788-45979810 CACCCTCCTGGGCAACAAGAAGG - Exonic
954250353 3:49362546-49362568 CATCCTGGTTGGGAATAAGAAGG - Exonic
954338050 3:49931555-49931577 CATGATCATGGACAACAAGAAGG + Intergenic
954472431 3:50708955-50708977 GATGATGGTGGGCTTCAAGATGG - Intronic
956020455 3:64928219-64928241 CAAGATGGTGCCCAACAAGAGGG - Intergenic
961241017 3:125411638-125411660 AAGGGTGGTGGGCAAGAAGAGGG + Intergenic
962251631 3:133839522-133839544 CATGCTGGTGGGCAACAAGACGG - Exonic
962538168 3:136350276-136350298 CAGGCAGGTGGCCAAGAAGATGG + Intronic
963731638 3:148980367-148980389 CATGATAGTGGTCAAAAAGAAGG - Intergenic
964119035 3:153163026-153163048 GATCCTGGTGGGCAACAAGGTGG + Exonic
964220383 3:154337855-154337877 ATTACTGGTGGGCAAAAAGAGGG + Exonic
964331331 3:155606670-155606692 CATGCTCTTGGGCATGAAGAAGG + Intronic
964743580 3:159990726-159990748 GAAGCTGGTGGGCAGCAGGAGGG - Intronic
967919663 3:194605023-194605045 CCTGCTGGTGGGCATGAGGAAGG - Intronic
967926447 3:194652592-194652614 GATGCCAGTGGGCAACAAGAGGG + Intronic
968526521 4:1060686-1060708 CAGGCTGCTGGGCATCCAGATGG - Intronic
969868304 4:10089611-10089633 CCTGCAGGTGGGCAGCAAGAGGG - Intronic
969970105 4:11038149-11038171 CAGGGTGGAGGGCAACATGAAGG - Intergenic
972041687 4:34608818-34608840 CATGCAGGTGTGCAATATGAGGG + Intergenic
972859225 4:43146820-43146842 CATGCTGGAGGGAAATGAGAAGG + Intergenic
973980199 4:56302270-56302292 CATGCTGGTGGGCAGCTGTAGGG - Intronic
976711991 4:88082308-88082330 CATTCTGGAGGGCAACCTGATGG - Intergenic
977037555 4:91974649-91974671 AATGCTGGAGGCCTACAAGAAGG - Intergenic
981234845 4:142403202-142403224 CCTGCTCTTGGGCAACAACATGG + Intronic
985044652 4:185928357-185928379 CAGGCTGGAGTGCAACAACAGGG - Intronic
985745932 5:1647744-1647766 GATGCTGGTGGGCACCAAGCAGG - Intergenic
987691600 5:21274094-21274116 CATCCTGGAGGGGAAAAAGAAGG + Intergenic
991748779 5:69776043-69776065 CATCCTGGAGGGGAAAAAGAAGG - Intergenic
991800357 5:70355855-70355877 CATCCTGGAGGGGAAAAAGAAGG - Intergenic
991828243 5:70654186-70654208 CATCCTGGAGGGGAAAAAGAAGG + Intergenic
991892715 5:71355295-71355317 CATCCTGGAGGGGAAAAAGAAGG - Intergenic
996976599 5:129441491-129441513 CATGCTGTTGGGCACAGAGATGG - Intergenic
997304350 5:132826933-132826955 CAGGCTGTTGGGGAACAGGAGGG - Intronic
999449853 5:151669703-151669725 CACCCTGGAGGGCACCAAGAAGG - Exonic
1001139106 5:169128782-169128804 CATGTTGGCTGGCAACATGAAGG - Intronic
1002285437 5:178159769-178159791 CATGAGGGTGTGCCACAAGAGGG + Intergenic
1005582624 6:27248978-27249000 GATGCTGGTGGGGACCAGGAAGG + Intronic
1006025347 6:31143246-31143268 CATGCTGGTAGGAGACAGGAGGG - Exonic
1008318810 6:50081106-50081128 GATGCTGGTGGAGAAAAAGAAGG - Intergenic
1010542624 6:77110518-77110540 CATGATGGTGGGAAAAACGATGG + Intergenic
1011865110 6:91816064-91816086 CAGCCTGGTTGGGAACAAGAAGG - Intergenic
1013081264 6:106815550-106815572 CATGCTCTTGGACACCAAGAAGG + Intergenic
1013747841 6:113366895-113366917 TAGGCTCGTGGGCAACCAGAGGG - Intergenic
1014654434 6:124082133-124082155 CATGGTGGTGGGCAACAGGAAGG + Intronic
1015573930 6:134650955-134650977 CATCCAGGTGGGCTAGAAGAAGG + Intergenic
1016803412 6:148189349-148189371 CATGGTGGTGGGCACCTAGGAGG - Intergenic
1019062109 6:169263892-169263914 CATGCTGGTGGGCAAGAAGCCGG - Intergenic
1019607702 7:1918388-1918410 CATGCTCGGGGGCCCCAAGACGG - Intronic
1022592194 7:31675063-31675085 CAGGCAGGTGGGCAACCAGTGGG - Intergenic
1025758239 7:64366409-64366431 CATGCTGATAGGAAACCAGAAGG + Intergenic
1026230400 7:68478248-68478270 CATGTTGATGGGCAACCTGATGG + Intergenic
1028825292 7:95265503-95265525 TATGCTGCTGGGTAACTAGAAGG - Intronic
1028987481 7:97019498-97019520 CATGCAGGAGTGCAAGAAGAAGG + Intergenic
1029005081 7:97201035-97201057 CACCTTGGTGGGGAACAAGAAGG - Intergenic
1032406105 7:131656906-131656928 GATGCTGGTGGAGAAGAAGAAGG - Intergenic
1036289005 8:7470679-7470701 CATGCTGGTTGGGAATCAGAAGG - Intronic
1036332470 8:7840849-7840871 CATGCTGGTTGGGAATCAGAAGG + Intronic
1037819448 8:22128682-22128704 CAAGCAGGTGGGCACCCAGAAGG + Exonic
1038352079 8:26785979-26786001 CATGCAGGAGATCAACAAGAAGG - Intronic
1040692734 8:49959248-49959270 CATGCTGGTGAAAAGCAAGAAGG + Intronic
1041465913 8:58157582-58157604 CCTGCAGGTGGGCAGAAAGATGG - Intronic
1042226939 8:66521540-66521562 AATGCTGGTGGGGAACATGTAGG - Intergenic
1042679420 8:71365754-71365776 CATGCTGGTGGGGAAAGAGCAGG - Intergenic
1043011242 8:74884360-74884382 CAAGCTGGTGGGCAAAAGCAAGG - Intergenic
1043580530 8:81707359-81707381 CATCCTTGTGGGAAACATGAGGG + Intronic
1043827828 8:84950145-84950167 CAAGCTGGGGGACAAAAAGAGGG - Intergenic
1044205099 8:89484732-89484754 CATGCTGATGGCCAAGAAAAGGG - Intergenic
1045094219 8:98780672-98780694 CAGTCTGGAGGGGAACAAGATGG + Intronic
1045787526 8:105939235-105939257 TAAGCTGGTGGGCAACTAGATGG - Intergenic
1047882278 8:129208865-129208887 CATGTTTGTGGGGAACAATAGGG - Intergenic
1050498017 9:6264622-6264644 CATACTGGTGGGTGGCAAGAAGG + Intergenic
1051516080 9:17931886-17931908 AGTGCTGATTGGCAACAAGATGG + Intergenic
1053578306 9:39375944-39375966 CATGTTGTTAGGCAGCAAGAAGG + Intergenic
1053842833 9:42204016-42204038 CATGTTGTTAGGCAGCAAGAAGG + Intergenic
1054099890 9:60934755-60934777 CATGTTGTTAGGCAGCAAGAAGG + Intergenic
1054121289 9:61210378-61210400 CATGTTGTTAGGCAGCAAGAAGG + Intergenic
1054586453 9:66972130-66972152 CATGTTGTTAGGCAGCAAGAAGG - Intergenic
1054822033 9:69532341-69532363 CATGTAGGTGGGCCACAAGTTGG + Intronic
1060449093 9:123720362-123720384 CATGCTGGGGGGCAAAAGGGGGG + Intronic
1060588099 9:124799380-124799402 CATCATGCTGGGCATCAAGAAGG + Exonic
1187783934 X:22863073-22863095 CTTGCTGGGGGGCAAGAAAATGG + Intergenic
1189035908 X:37493174-37493196 CTTGCTTCTGGGCAGCAAGATGG + Intronic
1192465522 X:71352748-71352770 TCTGCTGGTAGGCACCAAGAGGG + Intergenic
1192509567 X:71713866-71713888 CATGCTGTTGAGGAACAAGACGG - Intergenic
1192517130 X:71767687-71767709 CATGCTGTTGAGGAACAAGACGG + Intergenic
1195962987 X:110404491-110404513 CATGCTGGTTGGTAATAGGAAGG + Intronic
1196138269 X:112233089-112233111 CATCCTGGTGGGCATAAAGGGGG + Intergenic
1196944959 X:120814594-120814616 TAAGCTGGTGGCCAACGAGATGG - Intergenic
1197406552 X:126060161-126060183 CATGTTAGTATGCAACAAGAAGG + Intergenic
1199816621 X:151403118-151403140 CATGCTGGAGGACAGCAAGCTGG + Intronic
1201452074 Y:14127795-14127817 CTTGCTGGTGAGGAAGAAGATGG - Intergenic
1201977469 Y:19868536-19868558 CAGGCTGGTGGGAAACATTATGG + Intergenic