ID: 962251891

View in Genome Browser
Species Human (GRCh38)
Location 3:133840717-133840739
Sequence TCAAGGGCGCACAGGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962251891_962251898 11 Left 962251891 3:133840717-133840739 CCTCTGGCCCTGTGCGCCCTTGA 0: 1
1: 0
2: 1
3: 20
4: 152
Right 962251898 3:133840751-133840773 CCTGTTAAGAACACCTGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962251891 Original CRISPR TCAAGGGCGCACAGGGCCAG AGG (reversed) Intronic
900533052 1:3164077-3164099 TTCAGGGCGCAGCGGGCCAGTGG - Intronic
900792771 1:4690892-4690914 TCAAGTGCGCACTGGGTCATTGG + Intronic
901229969 1:7636251-7636273 TCAAGGGCTCACAGATCCAGTGG - Intronic
903056832 1:20641934-20641956 TCATGGGAGCTCAGGGGCAGAGG - Intronic
904438570 1:30515161-30515183 TCAGGGCCCCACATGGCCAGAGG - Intergenic
905349896 1:37338173-37338195 GAAAGGGAGCTCAGGGCCAGAGG + Intergenic
905929346 1:41776364-41776386 TCAAGCGTGGACAAGGCCAGTGG - Intronic
919939323 1:202275639-202275661 TCAAGGGCCCAGGGGGCAAGGGG - Intronic
923139842 1:231151878-231151900 TCCAGGGCTCAAAGGGGCAGGGG - Intergenic
1063615112 10:7593877-7593899 TCAAGGGTTAACAGAGCCAGTGG - Intronic
1064122338 10:12630715-12630737 TAAAGAGAGCAAAGGGCCAGGGG - Intronic
1066649950 10:37644952-37644974 TCAAGGTATCACAGGGCAAGGGG - Intergenic
1067909826 10:50334997-50335019 TCAAGGGAGTACAGGGCATGAGG + Intronic
1067917748 10:50418784-50418806 TCAAGGCCACACAGTGTCAGAGG - Intronic
1072624550 10:97102760-97102782 TCCAGGGAGCACAAGGCCTGGGG + Intronic
1075342918 10:121661645-121661667 GCCAGGGAGCACAGTGCCAGGGG + Intergenic
1075424169 10:122328542-122328564 AGAAGGGACCACAGGGCCAGTGG + Intronic
1076664325 10:132077407-132077429 TGAAGGGCACACTGGGCCACAGG + Intergenic
1077239647 11:1503842-1503864 CCAGGAGCCCACAGGGCCAGCGG - Intergenic
1077581682 11:3421373-3421395 CCAAGGTCACACAGGGCCAGGGG + Intergenic
1077717946 11:4600289-4600311 TCCAGGGAGCAGATGGCCAGAGG + Exonic
1079189201 11:18263932-18263954 CCAAGGGGCCACAGGGCCACGGG - Intergenic
1084238593 11:67804191-67804213 CCAAGGTCACACAGGGCCAGGGG + Intergenic
1084461583 11:69299336-69299358 TGATGTGCGCAGAGGGCCAGTGG - Intronic
1085408627 11:76278661-76278683 TCAAGGGGGCACAGGGCATCGGG - Intergenic
1089332933 11:117702316-117702338 TCTAGGGCCCCCAGGGGCAGTGG - Intronic
1091308385 11:134555545-134555567 TCAAGGTCGCACAGGGTGAATGG + Intergenic
1091849453 12:3683470-3683492 TCAAGAGCTCCCAGGGCCATGGG - Intronic
1092409280 12:8241814-8241836 CCAAGGTCACACAGGGCAAGGGG + Intergenic
1093247754 12:16761357-16761379 TTAAGGGCACACAGGGCCATGGG - Intergenic
1096514379 12:52148107-52148129 GCAGGGGCCCACAGGGCCTGGGG + Intergenic
1096782893 12:54001029-54001051 AGAAAGGCGGACAGGGCCAGGGG + Intronic
1096994987 12:55832819-55832841 TCAAGGGACCTCAAGGCCAGGGG - Intergenic
1098281309 12:68865470-68865492 GGAAGGTAGCACAGGGCCAGAGG - Intronic
1101090509 12:101280264-101280286 TCATGGCTGCAGAGGGCCAGTGG - Exonic
1101448438 12:104755124-104755146 TAAAAGGTGCACAGGGCCATTGG - Intronic
1102035406 12:109768306-109768328 TCAAGAGCGCCGAGGGCAAGCGG + Exonic
1102394749 12:112575974-112575996 TCAGATGCACACAGGGCCAGAGG + Intronic
1104409716 12:128547945-128547967 TCATGTGGGCAAAGGGCCAGGGG - Intronic
1104954235 12:132456720-132456742 TCAGGGCCCCACAGGGCGAGGGG + Intergenic
1105950496 13:25225467-25225489 TCAAGGTCCCACATGGACAGCGG + Intergenic
1107443153 13:40446303-40446325 TCAAGAGGGCACTGGGCAAGTGG - Intergenic
1109818605 13:67621847-67621869 TCAAAGCCACACATGGCCAGTGG + Intergenic
1111627437 13:90807418-90807440 TCAAGTGCGGCCAGGGGCAGTGG + Intergenic
1111676877 13:91398987-91399009 GCCAGGGCGCGCAGGGCGAGTGG + Exonic
1112565406 13:100547756-100547778 TCAAGGTCGAGCAGGCCCAGAGG + Intronic
1112734412 13:102400727-102400749 TCGGGGTCCCACAGGGCCAGGGG - Intronic
1112802695 13:103130184-103130206 TCAAGGGCCCACATGGGGAGTGG + Intergenic
1113313782 13:109157591-109157613 TTAAGGTTGCAAAGGGCCAGGGG - Intronic
1113635004 13:111913366-111913388 GGAAGAGTGCACAGGGCCAGGGG + Intergenic
1113909278 13:113834520-113834542 TGAAGGGCCCGCGGGGCCAGGGG + Intronic
1117819803 14:59636346-59636368 GCAAGGGAGCAGAGGGCAAGAGG - Intronic
1122638317 14:103141115-103141137 GCAAGGCAGCACAGGGTCAGAGG - Intergenic
1122663354 14:103312304-103312326 GAAAGGGCCCACAGGGCCATTGG - Intergenic
1122823159 14:104357120-104357142 CCAAGGGTGCCCAGGGCCACTGG + Intergenic
1122907208 14:104807311-104807333 TCCATGGCACACAGGGCCACCGG + Intergenic
1123122385 14:105922855-105922877 TCTAGGGCCCAGTGGGCCAGGGG + Intronic
1124421701 15:29528510-29528532 TCAAGTGGGCACAAGGCCAGTGG - Intronic
1125525066 15:40369481-40369503 GCAGGTGGGCACAGGGCCAGAGG - Exonic
1130833961 15:87631152-87631174 ACAAGGGCCCACAGGGCCCAAGG + Intergenic
1132685337 16:1159703-1159725 TGAGGGCCGCACAGGGACAGAGG + Intronic
1133001889 16:2856007-2856029 TAAAGGGAGCCCAGGGCCTGGGG + Intronic
1133225049 16:4337066-4337088 TCAAGGGGGCCGGGGGCCAGGGG - Exonic
1133350252 16:5096616-5096638 CCAAGGTCACACAGGGCCAGGGG + Intronic
1134073799 16:11276570-11276592 TGAGGGCAGCACAGGGCCAGGGG + Intronic
1136476479 16:30516896-30516918 GCAAGGGCACACAGGGTCTGGGG + Intronic
1136737260 16:32475911-32475933 ACAAGGGCGCAGAGGCACAGGGG - Intergenic
1139635416 16:68255572-68255594 CCCAGGGCTCACAGGCCCAGAGG - Intronic
1139948980 16:70660175-70660197 TCCAGGGTGCTCAGGGCAAGAGG - Exonic
1140407186 16:74718755-74718777 ACAAGGGTGCAGAGGGCCTGGGG + Intronic
1141681477 16:85546825-85546847 TTCAGGCCCCACAGGGCCAGGGG - Intergenic
1142194186 16:88732025-88732047 TCAAGCAAGGACAGGGCCAGCGG + Intronic
1142286043 16:89171966-89171988 CCAAAGGCGACCAGGGCCAGTGG - Intronic
1142429139 16:90017012-90017034 CCAAGGGTCCACAGGGACAGAGG - Intronic
1203015810 16_KI270728v1_random:353666-353688 ACAAGGGCGCATAGGCACAGGGG + Intergenic
1203034145 16_KI270728v1_random:626824-626846 ACAAGGGCGCATAGGCACAGGGG + Intergenic
1143328587 17:6117991-6118013 TCAAGGGCGAAAAGGACCACTGG + Exonic
1143334662 17:6163221-6163243 GCAAGGGTGCAGAGAGCCAGTGG + Intergenic
1144340310 17:14304259-14304281 TCCAGGGGGCACAGGGCCCGGGG + Intronic
1145249545 17:21289705-21289727 TGAAGGCCATACAGGGCCAGGGG + Intronic
1146640505 17:34537194-34537216 TCAAGGGTACACAGAGCCACTGG - Intergenic
1151709637 17:75795775-75795797 TCTAGGCCCCACAGGGCAAGGGG + Intronic
1152923565 17:83077864-83077886 TCAAGGGTGGACCGGGCCTGGGG + Intergenic
1160404420 18:78635298-78635320 CCAAGGGCCCACACCGCCAGGGG + Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1161613630 19:5257690-5257712 TCTTGGGCCTACAGGGCCAGGGG - Intronic
1166101103 19:40571898-40571920 ACTAGGGCGCAAAGGTCCAGAGG + Intronic
1168294082 19:55370307-55370329 TCATGTCCCCACAGGGCCAGGGG + Exonic
925028087 2:625294-625316 ACCAGGTCGCACAGGGCCAGAGG - Intergenic
931802835 2:65775261-65775283 TCCAGGATGCACAGGGCCACTGG + Intergenic
932421590 2:71604496-71604518 TCATGGGCTCCCATGGCCAGGGG - Intronic
934991576 2:98925249-98925271 CCAAGTGTGCACAGGGCCTGGGG - Intronic
935171154 2:100612444-100612466 TCATGAGGGCACAGGCCCAGAGG - Intergenic
937720971 2:125095825-125095847 TCAAGGGATGACAGGACCAGAGG + Intergenic
938222870 2:129587099-129587121 GCAAGGGAGCAAAGGGGCAGGGG - Intergenic
940517978 2:154705000-154705022 AAAAGGGCCCACAGGGCCAGTGG - Intronic
946401827 2:219472337-219472359 TCAGGGCTGCACAGGGCCATGGG + Intronic
946402433 2:219475689-219475711 TGCAGGGCTCTCAGGGCCAGGGG - Intronic
946935134 2:224712341-224712363 TCAAGGTTCCACAGGGCAAGAGG + Intergenic
948119240 2:235516647-235516669 GCCAGGGTGCACAGGGCCAGAGG - Intronic
948727873 2:239945833-239945855 TCAAGGGCCCACAGGGCTCCGGG + Intronic
1172118124 20:32583725-32583747 TCCAGGGCGCCCCGGGCCAGAGG + Intronic
1175697057 20:61110641-61110663 TCTAGGGGGCACAGGCACAGGGG - Intergenic
1175878533 20:62243150-62243172 TCAGGTGCGCACAGGGCGTGGGG + Intronic
1177608094 21:23408188-23408210 ACAGGGGCACACATGGCCAGAGG + Intergenic
1180120316 21:45741725-45741747 GCAAGGGAGCTCAGGGCCTGAGG - Intronic
1181140956 22:20804569-20804591 ACAAGGGGGCTTAGGGCCAGCGG - Intronic
1183530708 22:38351854-38351876 TGAAGGTCACAGAGGGCCAGAGG - Intronic
1183591085 22:38779635-38779657 TCAAGGGGGCGCAGGGCAGGTGG + Intronic
1183700775 22:39449784-39449806 TCAAGGCCACACAGGCCTAGAGG + Intergenic
1183748963 22:39708481-39708503 TCAAGGGCGGTCAGGCGCAGTGG - Intergenic
950670995 3:14525367-14525389 TGATGGGAGCCCAGGGCCAGTGG - Intronic
953742996 3:45552871-45552893 TCAAGGCCAGACTGGGCCAGAGG + Intergenic
954134730 3:48576690-48576712 TCCAGGCCTCCCAGGGCCAGTGG - Exonic
955192411 3:56773683-56773705 AGAAGGGCACACAGGGCCTGTGG - Intronic
955210769 3:56938790-56938812 ACAAAGGCGCCCTGGGCCAGTGG - Intronic
957054547 3:75433986-75434008 CCAAGGTCACACAGGGCCAGGGG + Intergenic
961300300 3:125917719-125917741 CCAAGGTCACACAGGGCCAGGGG - Intergenic
961888201 3:130110348-130110370 CCAAGGTCACACAGGGCCAGGGG + Intronic
962251891 3:133840717-133840739 TCAAGGGCGCACAGGGCCAGAGG - Intronic
968997358 4:3954296-3954318 CCAAGGTCACACAGGGCCAGGGG + Intergenic
969447519 4:7253625-7253647 TCAGGGGCCCACAGGGTCACTGG + Intronic
969756661 4:9154398-9154420 CCAAGGTCACACAGGGCCAGGGG - Intergenic
970316116 4:14829829-14829851 CCAAGGTCACACAGGGACAGAGG + Intergenic
980156877 4:129118010-129118032 TATTGGGAGCACAGGGCCAGTGG - Intergenic
982404208 4:155002315-155002337 TCAGGGGAGCACAGGGGAAGAGG - Intergenic
983863289 4:172734712-172734734 TCAATGGATCACAGGCCCAGAGG + Intronic
985094649 4:186401547-186401569 TAAAGGGAGGAGAGGGCCAGTGG + Intergenic
999427437 5:151500062-151500084 TCTAGGTGGCACAGAGCCAGGGG - Intergenic
999865424 5:155695512-155695534 TCAAGCATGAACAGGGCCAGAGG - Intergenic
1001967147 5:175918588-175918610 TCTGGAGCGCACAGTGCCAGAGG + Intronic
1002249788 5:177920624-177920646 TCTGGAGCGCACAGTGCCAGAGG - Intergenic
1002612690 5:180431889-180431911 TCAAGAGGTGACAGGGCCAGTGG + Intergenic
1004156310 6:13171280-13171302 TCCAGGGCACACATGGACAGTGG - Intronic
1004716339 6:18219835-18219857 TCCAGCGCCCACAGTGCCAGGGG - Intronic
1005610095 6:27515335-27515357 TGTAGGGCTCAGAGGGCCAGGGG - Intergenic
1019213310 6:170423380-170423402 TCAGCTGCACACAGGGCCAGAGG - Intergenic
1019660172 7:2219697-2219719 GCAGGGGAGCAGAGGGCCAGGGG + Intronic
1020014162 7:4821232-4821254 TCAGGCGGGCACAGTGCCAGAGG - Intronic
1022311628 7:29201685-29201707 TCAATAGCACACATGGCCAGTGG + Intronic
1022910710 7:34897675-34897697 TCAAGGGAGCAGAAGGCAAGTGG + Intergenic
1023171273 7:37392249-37392271 TCAAGTTCCCACATGGCCAGTGG + Intronic
1023654634 7:42407162-42407184 CCAAGTACGCTCAGGGCCAGTGG - Intergenic
1026987665 7:74564963-74564985 TCAAGGGAGCTGTGGGCCAGGGG + Intronic
1030722418 7:112885150-112885172 TCAAGGCTGCACAGGGCAGGGGG + Intronic
1031984554 7:128155115-128155137 TCAGGGGCTGACAGGGCCATCGG + Intergenic
1036379897 8:8229706-8229728 CCAAGGTCACACAGGGCCAGGGG - Intergenic
1036849664 8:12192947-12192969 CCAAGGTCACACAGGGCCAGGGG + Intronic
1036871028 8:12435220-12435242 CCAAGGTCACACAGGGCCAGGGG + Intronic
1039733029 8:40300154-40300176 TGCAGGGCACACAGGGCCTGTGG + Intergenic
1040598132 8:48859806-48859828 ACAGGGGCTCACAAGGCCAGAGG - Intergenic
1046272016 8:111909131-111909153 TCAAGAAGGTACAGGGCCAGAGG - Intergenic
1048136454 8:131751091-131751113 TCAAGGGAGTACAAGGCCTGTGG - Intergenic
1051893522 9:21966346-21966368 TCCAGTGGGCACAGGCCCAGGGG - Intronic
1052786886 9:32836692-32836714 TCTAGGGTGCACAAGGCCAAAGG - Intergenic
1053446088 9:38154273-38154295 TCCTGGGCTCACAGGGACAGTGG - Intergenic
1054820388 9:69515930-69515952 CCAAGGGCACACAAGGCCATGGG + Intronic
1055550791 9:77430466-77430488 TCATGGGCACACAGGCACAGAGG + Intronic
1057429385 9:94980142-94980164 TCTGGGAGGCACAGGGCCAGAGG - Intronic
1058560968 9:106228869-106228891 TCAAAGGAGCAGAGGGTCAGGGG - Intergenic
1060969638 9:127730798-127730820 TCAAGGCCACCCAGGGCCAGAGG + Exonic
1061289497 9:129642470-129642492 TCAGGGGCGCCCAGGGCCAGTGG - Intergenic
1061297374 9:129684087-129684109 TGCAGGGAGCACAGTGCCAGAGG - Intronic
1062181086 9:135191679-135191701 TCAAGGTTGCACGGGCCCAGTGG - Intergenic
1062191953 9:135252713-135252735 TCTAGGGAGGACAGGCCCAGCGG - Intergenic
1062331103 9:136045300-136045322 TCACGGGCCCACAGGCCCTGTGG + Intronic
1062594901 9:137295286-137295308 TCAGGGGCGCCCTGGGGCAGAGG - Intergenic
1186792377 X:13011618-13011640 TCAAGGGCTCACAAGGCAGGTGG + Intergenic
1192855093 X:75000511-75000533 TCAGGGGGGCTCAGAGCCAGTGG - Intergenic
1199252496 X:145679278-145679300 CTGAGGGCACACAGGGCCAGAGG + Intergenic
1199810864 X:151347174-151347196 TCAAGCCCTCACAGGGCAAGGGG + Intergenic
1199896357 X:152131070-152131092 GCAAGGGTGCACAGGACCACTGG + Intergenic
1200018479 X:153182498-153182520 TCCAGGGTGCCCAGGACCAGAGG - Exonic
1200179344 X:154140912-154140934 ACAAGGGCAGACAGGGCGAGCGG + Intergenic