ID: 962254490

View in Genome Browser
Species Human (GRCh38)
Location 3:133861050-133861072
Sequence GAGGCTGAACCCTTCCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962254486_962254490 -7 Left 962254486 3:133861034-133861056 CCCAGCAGCACCTGCAGAGGCTG 0: 1
1: 0
2: 5
3: 53
4: 477
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254482_962254490 1 Left 962254482 3:133861026-133861048 CCTCCATCCCCAGCAGCACCTGC 0: 1
1: 2
2: 16
3: 196
4: 1446
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254485_962254490 -6 Left 962254485 3:133861033-133861055 CCCCAGCAGCACCTGCAGAGGCT 0: 1
1: 0
2: 4
3: 44
4: 575
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254476_962254490 16 Left 962254476 3:133861011-133861033 CCACCAAATCCTCCCCCTCCATC 0: 1
1: 0
2: 5
3: 66
4: 870
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254481_962254490 2 Left 962254481 3:133861025-133861047 CCCTCCATCCCCAGCAGCACCTG 0: 1
1: 1
2: 5
3: 84
4: 592
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254477_962254490 13 Left 962254477 3:133861014-133861036 CCAAATCCTCCCCCTCCATCCCC 0: 1
1: 0
2: 4
3: 156
4: 1654
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254480_962254490 3 Left 962254480 3:133861024-133861046 CCCCTCCATCCCCAGCAGCACCT 0: 1
1: 0
2: 12
3: 109
4: 824
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254487_962254490 -8 Left 962254487 3:133861035-133861057 CCAGCAGCACCTGCAGAGGCTGA 0: 1
1: 0
2: 8
3: 60
4: 493
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254483_962254490 -2 Left 962254483 3:133861029-133861051 CCATCCCCAGCAGCACCTGCAGA 0: 1
1: 1
2: 7
3: 96
4: 711
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254478_962254490 7 Left 962254478 3:133861020-133861042 CCTCCCCCTCCATCCCCAGCAGC 0: 1
1: 0
2: 19
3: 231
4: 1753
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
962254479_962254490 4 Left 962254479 3:133861023-133861045 CCCCCTCCATCCCCAGCAGCACC 0: 1
1: 1
2: 12
3: 230
4: 2469
Right 962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG 0: 1
1: 0
2: 0
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962254490 Original CRISPR GAGGCTGAACCCTTCCATGG TGG Intronic
900321841 1:2088357-2088379 GAGGCTGCCCCTTTCCATCGTGG + Intronic
902245941 1:15120417-15120439 GAGGCTCTACCCTTCCTTGGGGG - Intergenic
902535783 1:17118778-17118800 GAGGCTGAATCCGGCCCTGGAGG - Intronic
903413977 1:23168789-23168811 GCGGCGGAACCCTTCGCTGGCGG - Exonic
903550843 1:24156664-24156686 GAGGCTGAGCCCTGGGATGGGGG + Exonic
905127761 1:35727491-35727513 GAGGGTGGACCCTTCCATGAAGG - Intronic
907136016 1:52140662-52140684 GAGGCTCTATTCTTCCATGGAGG + Intergenic
908465190 1:64386596-64386618 GAGGCTCAAGACTTCCATGGAGG + Intergenic
910992014 1:93066484-93066506 GAGGATTAAGCCTTCCAGGGAGG + Intergenic
916925482 1:169515449-169515471 CAGGCTGAAATCCTCCATGGTGG - Exonic
919234621 1:194824724-194824746 GGGGCTGAACTCTTTTATGGTGG + Intergenic
922096121 1:222444420-222444442 GAGGCTGCACCCTCCTCTGGTGG - Intergenic
922350060 1:224727986-224728008 GAGGCTGCAACCTTCCAAGCAGG - Intronic
922465416 1:225843061-225843083 GAGACTGAATCCTGCCTTGGGGG + Intronic
1062860800 10:807667-807689 GAGGCTTAGCCCTGCCCTGGTGG - Exonic
1070160819 10:73865800-73865822 GAGGCTCAGACCTTCCAAGGTGG + Intronic
1072296008 10:94010055-94010077 CAGGCAGAAGCCTGCCATGGAGG - Intronic
1072308532 10:94131770-94131792 CAGGCTGAAACACTCCATGGAGG + Intronic
1073517735 10:104092546-104092568 GAGGCTTAACTCTACCAGGGTGG - Intergenic
1075386351 10:122058062-122058084 GGTGCTGAACCACTCCATGGTGG - Intronic
1075450089 10:122545087-122545109 GAGGCTGAATGATGCCATGGGGG + Intergenic
1076853151 10:133102945-133102967 GAGGATGATCCGGTCCATGGGGG + Intronic
1077479795 11:2808199-2808221 GAGGGTGAACCCATCCAGGCTGG + Intronic
1077915792 11:6610819-6610841 GGGGCTGATCCCTCCCATGTTGG - Exonic
1080098641 11:28433992-28434014 GAGGCTGAACTGTTCTATGATGG + Intergenic
1080218566 11:29873915-29873937 GATGGTTCACCCTTCCATGGGGG + Intergenic
1081711287 11:45217656-45217678 GAGGCTGTTGCCTTCCAAGGAGG - Intronic
1084109415 11:67004015-67004037 GACTCTGAACCCAGCCATGGGGG + Intergenic
1084365276 11:68693521-68693543 GAGGCTGCACACCTGCATGGAGG - Intergenic
1089158474 11:116420304-116420326 CAGGCTGAGCCCTTCCCTGGAGG + Intergenic
1094362446 12:29644612-29644634 AAGGCAGCACCCTTCCATGAAGG + Intronic
1097959392 12:65517819-65517841 GGGGCTGAACTCCTCCCTGGGGG - Intergenic
1104714192 12:131005717-131005739 GAGGCTGAAACCCCCCAGGGAGG - Intronic
1104843115 12:131834104-131834126 GAGGCAGAGCCCTGCCCTGGGGG - Intronic
1106330120 13:28732339-28732361 GAGGCAGCTCTCTTCCATGGGGG + Intergenic
1106605056 13:31221328-31221350 GAGGCTGGCCCCTTCCCTGAGGG + Intronic
1110655498 13:77993870-77993892 GAGGCTCAACACCTCCTTGGTGG - Intergenic
1111912524 13:94328400-94328422 TAGGGTGAATCCTTCCATGTAGG - Intronic
1113973689 13:114210761-114210783 GAGGCTGAAGCCATCCAAGGTGG - Intergenic
1117741724 14:58825754-58825776 AAGGCTGAACTCTTTCTTGGAGG - Intergenic
1119091698 14:71788379-71788401 GAGGCTGAAGACTTCAGTGGAGG + Intergenic
1119256930 14:73206708-73206730 CAGCCTGAACCTTTCCATGCTGG - Intronic
1121794339 14:96723087-96723109 GAGGCCCCACCCATCCATGGAGG - Intergenic
1124891829 15:33740792-33740814 AAGCCTGAACCCTTCCCAGGGGG + Intronic
1125574458 15:40745827-40745849 GAGGCTGCACCCACCCATGTTGG - Intronic
1128236829 15:66073335-66073357 GAGGCTGTGCCCTTCCTTGTGGG + Intronic
1129958199 15:79658548-79658570 GTGGATGAAGCCTTCCAGGGAGG - Intergenic
1133149786 16:3818956-3818978 GAGGCTTCACCCTTGCACGGGGG + Intronic
1135287337 16:21205486-21205508 GAGGCTGAAGCCTTCCTTCATGG + Exonic
1135497399 16:22964503-22964525 GAGGCTGCATCCATTCATGGTGG + Intergenic
1135859535 16:26043307-26043329 GAATCTGAACCCTTTCATGCGGG + Intronic
1141154522 16:81587930-81587952 GGGGCTGCAGGCTTCCATGGAGG - Intronic
1142105800 16:88302023-88302045 CAGGCTCAGCCCTGCCATGGTGG - Intergenic
1142227132 16:88882990-88883012 GAGACTGAACCCTCCCTTGGAGG - Intronic
1142245806 16:88969583-88969605 GTGGCTGGACCCGACCATGGTGG - Intronic
1142807611 17:2379719-2379741 GAGGCTGACCCCTCCCATCCCGG - Exonic
1144635416 17:16904527-16904549 GAGGCTGGACCATACCATGAAGG + Intergenic
1144767372 17:17740041-17740063 CAGGCTGAGCCCTTCCAAAGTGG + Intronic
1144846854 17:18224722-18224744 GAGGCTGAACCTTTCCTTCCAGG - Intergenic
1146164851 17:30579771-30579793 GAGGCTGGACCATACCATGAAGG + Intergenic
1147684794 17:42280598-42280620 GGGGATGAATCCTTCCATAGGGG + Intergenic
1155141175 18:23045962-23045984 CAGGCTGAAACCAGCCATGGTGG - Intergenic
1155230112 18:23764874-23764896 AGGACTGAACCCTCCCATGGAGG + Intronic
1155540959 18:26867723-26867745 GAGGGTGACCCCTTCCTTGATGG - Intergenic
1161268886 19:3378575-3378597 GAGGGGGAACCCGGCCATGGGGG - Intronic
1163420855 19:17212910-17212932 CATGCTGGAACCTTCCATGGGGG + Exonic
1166936021 19:46333434-46333456 AGGGCTGAAACCTTCCATGGAGG + Intronic
1167606057 19:50481738-50481760 GAGGCTGAGCCCTTGCCTGCTGG + Intronic
926122753 2:10253830-10253852 GGGGCTGTCCCCTTCCTTGGAGG + Intergenic
926567135 2:14488562-14488584 GAGGCCCAAATCTTCCATGGTGG + Intergenic
926670860 2:15575607-15575629 TGGCCAGAACCCTTCCATGGTGG - Intergenic
929791590 2:45027165-45027187 GAGGCTGGACATTTCCAAGGAGG + Intergenic
929978755 2:46659120-46659142 GGTGCTGAACCATTCCCTGGTGG + Intergenic
932365607 2:71151162-71151184 GATGCTGATCCCATCCATGAGGG + Intergenic
933651073 2:84850701-84850723 CATGCTCAACCCCTCCATGGGGG + Intronic
934678593 2:96266568-96266590 GAGGCTGAACCTGTTCCTGGCGG + Intronic
934896615 2:98125233-98125255 GAGCCTGAACCCTTGGATGGTGG + Intronic
946467057 2:219921333-219921355 CAGGCTGAACCCTTCCTGGCTGG + Intergenic
1175666971 20:60869351-60869373 GGGGCTGAGCCCTTCCCTGACGG + Intergenic
1176116260 20:63432841-63432863 GAGGGTGGATCCTTCCCTGGGGG - Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179101922 21:38361612-38361634 GAGGCTGAAAGCAGCCATGGTGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1179942783 21:44650587-44650609 GGGGCTGGTTCCTTCCATGGTGG - Intronic
1180050733 21:45329927-45329949 GATGCTGCACCCATCCCTGGTGG - Intergenic
1180160544 21:45997100-45997122 CAGGCTTCACCCTTCCGTGGGGG + Intronic
1180160563 21:45997163-45997185 GAGGCTTCACCCCTCCGTGGGGG + Intronic
1181174202 22:21026756-21026778 GAGGCAGCACCCTACCAAGGTGG - Exonic
1183382686 22:37498322-37498344 CAGGCAGAACCCTACCATGATGG - Intronic
1184808280 22:46810934-46810956 GAGTCTGTACCCTTACATGCAGG + Intronic
1184945550 22:47801553-47801575 GAGGCTGCACTCTGCCAGGGTGG + Intergenic
952605834 3:35145955-35145977 GAGGCTGTACTCTGCCACGGGGG - Intergenic
952752693 3:36838258-36838280 GAGGCTGCAGTCTTCCAAGGAGG - Intronic
952920276 3:38279117-38279139 GGTGCTGAACACTTCCATGCTGG - Intergenic
954291624 3:49652959-49652981 GAGGCTGAGGCCTTGGATGGTGG + Exonic
957011432 3:75010081-75010103 GAGGATGAAGCCTTCAATAGAGG - Intergenic
961315866 3:126035269-126035291 GATGCTGAAACCTTCCAGGATGG + Intronic
962254490 3:133861050-133861072 GAGGCTGAACCCTTCCATGGTGG + Intronic
962321622 3:134395410-134395432 AAGGCTGAACACTCCCATGCTGG + Intergenic
964031042 3:152139200-152139222 GAGGCTCTGCCATTCCATGGAGG - Intergenic
964802337 3:160569352-160569374 GAGGCTCAACCCACCCGTGGGGG + Intergenic
966481239 3:180411511-180411533 GATTCTGCACCCTGCCATGGAGG - Intergenic
969313826 4:6369847-6369869 GAAACTCAACCCTTCCCTGGAGG - Intronic
969966850 4:11005356-11005378 GAGCATGAACCCATCCATGAGGG + Intergenic
970225449 4:13852189-13852211 TGGGCTGAAGCCTTCCCTGGAGG + Intergenic
971233881 4:24824096-24824118 AAGGCTTAACTCTTCCGTGGAGG + Intronic
976113201 4:81698996-81699018 GAGGCTGATCTTTCCCATGGGGG - Intronic
978152150 4:105449740-105449762 GAGACTGAATCCTTACATGAGGG - Intronic
981354862 4:143777425-143777447 GAGGGGGAAGCCTTCAATGGTGG + Intergenic
981995461 4:150969430-150969452 GAGGTTCAAGACTTCCATGGAGG + Intronic
982397168 4:154925336-154925358 CAGGGTGAGACCTTCCATGGGGG - Intergenic
982543145 4:156700448-156700470 TAGGCTGCACCCTACAATGGAGG - Intergenic
984505952 4:180618951-180618973 GAGTCTTAACCCCTCCATGTTGG + Intergenic
987717095 5:21586079-21586101 AACCCTGAACCCTTCCATCGTGG + Intergenic
993391166 5:87320916-87320938 GAGGCTGGAGCCTTTCATGGTGG + Intronic
994336880 5:98577124-98577146 AGGGATGATCCCTTCCATGGCGG - Intergenic
995809565 5:116089634-116089656 GTGGCTAAAGCATTCCATGGAGG + Intronic
1001242583 5:170081617-170081639 GAGGCTGAACCCTTGTCTGTAGG + Intronic
1002198256 5:177512785-177512807 GAGGCCGTAGCCATCCATGGGGG - Exonic
1002352431 5:178592377-178592399 GAGGCTGGCCCCTGCCCTGGAGG - Intergenic
1003099435 6:3165714-3165736 TAGGCTGAGGCCATCCATGGTGG + Intergenic
1003116675 6:3288111-3288133 GTGGCTGCACCCTCCCACGGAGG + Intronic
1005957834 6:30676943-30676965 GAGAGTGTACCCTGCCATGGGGG + Exonic
1009426652 6:63521428-63521450 GAGGCAGTATCCTTCCATGTAGG + Intergenic
1017043699 6:150327746-150327768 GAGACTGAACCCTGCCCTGGAGG + Intergenic
1017794479 6:157831286-157831308 GAGGTTGTATCCTTCCAGGGAGG + Intronic
1028986707 7:97015268-97015290 GAGGATGAACCCTGCCCTGGTGG + Intergenic
1033361426 7:140640993-140641015 GTGGCTTAACCCTTCCTGGGAGG + Intronic
1034282615 7:149864558-149864580 GGGGCTGAAACCTTTCATGATGG - Exonic
1034946196 7:155263367-155263389 AAGGGTGAGCCCTTCCCTGGGGG + Intergenic
1035070315 7:156139865-156139887 GAGGCTGGGCCTTTGCATGGGGG + Intergenic
1036125717 8:6060196-6060218 TAGGCTGAATCCATCCATAGAGG - Intergenic
1037707350 8:21326327-21326349 GGGGCTGAGCCCTTGCTTGGGGG - Intergenic
1037833914 8:22205118-22205140 GAGGTTGAAGCCATTCATGGTGG + Intronic
1041110049 8:54475464-54475486 GATGCTGAAACCCCCCATGGTGG + Intergenic
1042090742 8:65156668-65156690 GAGGTTGAACCCTTCCAGAGTGG - Intergenic
1043237367 8:77884914-77884936 GAGGCTGGGACCTTCCCTGGAGG + Intergenic
1043391810 8:79799022-79799044 GAGGATGAATCCTTCCATTTGGG + Intergenic
1045510383 8:102808385-102808407 GAGGCTGCACTCTTCTGTGGCGG - Intergenic
1045967141 8:108038093-108038115 AAGGGTGAACCCTTTCCTGGAGG - Intronic
1048496768 8:134942156-134942178 AAGCCAGAAGCCTTCCATGGAGG + Intergenic
1049436797 8:142590150-142590172 GAGTCTGAGCCCCTCCATGGTGG + Intergenic
1052791005 9:32875608-32875630 TAGGCTCAACCCTCGCATGGTGG - Intergenic
1053281201 9:36820709-36820731 GGGGCTGCACCCTCCCACGGTGG - Intergenic
1053418060 9:37959137-37959159 GAGGCTGACCCCCTCAATGACGG + Intronic
1058368843 9:104241089-104241111 TAGGCTGAACCACTGCATGGGGG + Intergenic
1062208559 9:135350617-135350639 GAGGCTGACCCCGACAATGGAGG - Intergenic
1191690561 X:63933959-63933981 GAGGCTGAAGCCTTCTACTGGGG - Intergenic
1197437453 X:126449024-126449046 GAGGCTCAACCCTTCGATGCTGG + Intergenic
1199486736 X:148356745-148356767 TATGCTGCACCATTCCATGGTGG + Intergenic
1199717553 X:150517211-150517233 GAGAGTGAACTCTTCCATGGGGG - Intergenic
1200136999 X:153880039-153880061 GGGGCTGAACCCCTCCCTGTAGG - Intronic
1202592477 Y:26500924-26500946 GAGGCTGCTCCCTTTGATGGTGG - Intergenic