ID: 962255965

View in Genome Browser
Species Human (GRCh38)
Location 3:133870470-133870492
Sequence GTGAACAATGCAGAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962255957_962255965 29 Left 962255957 3:133870418-133870440 CCTACAGAAGCCAGACTAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 240
962255961_962255965 -4 Left 962255961 3:133870451-133870473 CCAGAGATGGAGGATCTCAGTGA 0: 1
1: 0
2: 0
3: 14
4: 177
Right 962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 240
962255958_962255965 19 Left 962255958 3:133870428-133870450 CCAGACTAGGGGCAGAAATCTTG 0: 1
1: 0
2: 2
3: 4
4: 86
Right 962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962255965 Original CRISPR GTGAACAATGCAGAGGTGGT GGG Intronic
900437575 1:2638819-2638841 GTGCTCAGGGCAGAGGTGGTGGG + Intronic
900684559 1:3939856-3939878 GTCAACCAGGCAGAGGTGGACGG + Intergenic
900975193 1:6012236-6012258 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975206 1:6012288-6012310 GTGATGAAGGCAGAGGTGGTGGG + Intronic
900975238 1:6012410-6012432 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975270 1:6012532-6012554 GTGATGAAGGCGGAGGTGGTGGG + Intronic
900975289 1:6012605-6012627 GTGATGAAGGCGGAGGTGGTGGG + Intronic
901770255 1:11526550-11526572 GTGAACTATGCCGAGGAGGGAGG + Intronic
902421870 1:16287127-16287149 GTGAACAAAGGAGAGGAGGTTGG - Intronic
905508759 1:38501894-38501916 GGAAAAAATTCAGAGGTGGTTGG + Intergenic
905984336 1:42264661-42264683 GTGAAAAATGCAGTGGTGTCAGG + Intronic
906415507 1:45618744-45618766 GTGGACACTCCAGATGTGGTTGG + Exonic
906781145 1:48574202-48574224 TGGAACAGTGCATAGGTGGTGGG - Intronic
908340384 1:63172438-63172460 AGGAACATTGCAGAGGTGGCAGG - Intergenic
908596051 1:65689910-65689932 GTGAGCAGAGCAGAGGTGATGGG - Intergenic
908997763 1:70178178-70178200 TTGAACAATGCAAAGGTTATAGG - Intronic
910085986 1:83403047-83403069 TTGATCATTGCAGAGGTGGAGGG + Intergenic
911332417 1:96540767-96540789 GTGTACACTGCGCAGGTGGTGGG - Intergenic
911749182 1:101476642-101476664 TTGAATAATGCAAAGGTGATGGG - Intergenic
912371685 1:109178662-109178684 GTGTAGAATGCAGTGGAGGTGGG + Intronic
913038593 1:115000636-115000658 GTGTACACTGCTGAGGTGATGGG - Intergenic
913329025 1:117652214-117652236 AAGAACACTGCAAAGGTGGTAGG - Intergenic
914055334 1:144163532-144163554 GTGAACAGGGCAGAGGTTGGAGG + Intergenic
916411808 1:164553571-164553593 GTGAACAAGACAGATGAGGTTGG + Intergenic
920259758 1:204680858-204680880 GTCAACCAGGCAGAGATGGTGGG - Intronic
922184385 1:223261068-223261090 GTGAGCCAGGCAGAGGTTGTTGG - Intronic
922663697 1:227451448-227451470 GGGATGACTGCAGAGGTGGTGGG + Intergenic
922887088 1:229028428-229028450 GTGACCAGTGCAGTGCTGGTTGG - Intergenic
923161488 1:231318276-231318298 TTGAACAATGCCGGGGTTGTGGG - Intergenic
923275281 1:232389952-232389974 GTGACCATTTCAGAGGTGCTGGG - Intergenic
924058048 1:240143105-240143127 GTGCACCATGAAGAGGTCGTTGG + Intronic
924647810 1:245895419-245895441 GAGAACAACGCAGAGCTGGTTGG + Intronic
1064302086 10:14131911-14131933 GTGAACAAAGCAGGGGTCTTCGG - Intronic
1067029422 10:42870362-42870384 GTGAACAGGGCAGAGGTTGGAGG + Intergenic
1067668300 10:48297067-48297089 GTGCAAAATGCAGATGGGGTGGG + Intergenic
1068445199 10:57112358-57112380 GTGAACAATGCAAAAATGTTTGG - Intergenic
1070545008 10:77445307-77445329 ATGGACGATGCAGAGGTGGATGG - Intronic
1070582691 10:77734524-77734546 GTGTACAATGAAGAGGTGCCTGG - Intergenic
1072063915 10:91846518-91846540 GTGCCCAAAGCAGAGGTGGAAGG - Intronic
1072517940 10:96204834-96204856 TGGATGAATGCAGAGGTGGTAGG - Intronic
1074776328 10:116770705-116770727 GGGAACAGTGCACAGGAGGTTGG - Intergenic
1076223198 10:128751420-128751442 GTGAGCTATGCAGAAGTGGAGGG + Intergenic
1077443753 11:2580765-2580787 CTGAAGAAAGCAGGGGTGGTGGG - Intronic
1080121715 11:28685437-28685459 TTGAACAATGCAGAGGTTGGGGG + Intergenic
1080146232 11:28987409-28987431 CTGAAGAATGCAGAAGTGGCAGG + Intergenic
1080600549 11:33817822-33817844 GGGAACTGGGCAGAGGTGGTTGG + Intergenic
1081144771 11:39548988-39549010 GTGAACACTGCTCAGGTGATGGG + Intergenic
1081612528 11:44571125-44571147 GTGAACAATGCCCTGGTAGTTGG + Intronic
1084728609 11:71058874-71058896 GTGGACACTGCACAGGCGGTGGG + Intronic
1084809506 11:71603688-71603710 GTGGACACTGCAGGGGTGGAAGG + Intergenic
1086137486 11:83456605-83456627 GTCAACAACTCAGAGATGGTGGG + Intronic
1089000419 11:115047542-115047564 CAGTACAAGGCAGAGGTGGTTGG - Intergenic
1089858844 11:121571233-121571255 GTGAACCAAGCAGAGGTGGAGGG + Intronic
1090421087 11:126575389-126575411 GTGTACAATGGAGAGGTCTTGGG + Intronic
1090556573 11:127883019-127883041 GTGAACATTGCAGAACTGGCTGG + Intergenic
1090650693 11:128803458-128803480 AGGAACAAGGCAGAGGTGGGTGG - Intronic
1092669229 12:10843555-10843577 GAGACCAAGGCAGATGTGGTAGG - Intronic
1093566676 12:20614864-20614886 GTGAACTATGCCTATGTGGTTGG + Intronic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1095806703 12:46327499-46327521 GTGAACATTGGAGATGTGGAAGG - Intergenic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1098224861 12:68311034-68311056 GAGAAGAGTGCAGAGGTGATAGG - Intronic
1098869277 12:75798873-75798895 TTGAACAATGCAGAAGTTATGGG + Intergenic
1103110737 12:118275992-118276014 GTGAACAATGGGGATGTAGTAGG + Intronic
1103725160 12:122994167-122994189 GTTAAAAATGCAGAGCTGGCCGG - Intronic
1105652520 13:22395420-22395442 GTGAAGGATACAGAGGTGGAAGG + Intergenic
1108391262 13:49950071-49950093 GTGTACAATGCTCAGGTGATGGG + Intergenic
1110140213 13:72119764-72119786 GTGAACATTGTAGAAGTGTTTGG - Intergenic
1112785330 13:102944969-102944991 GTCAACACTGGAGAAGTGGTGGG + Intergenic
1116095568 14:40362732-40362754 TTGAACAATGCAGAGGTTGTGGG - Intergenic
1116731528 14:48628545-48628567 GAGAAGGATACAGAGGTGGTAGG + Intergenic
1117724956 14:58663889-58663911 GTGAACAATGCTGGGGTGAAGGG - Intergenic
1126772094 15:52068308-52068330 CTGAACATTGCAAAGCTGGTAGG - Intergenic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127448182 15:59087373-59087395 TTGAACAATGCAGAGGTTAGGGG + Intronic
1128382600 15:67124354-67124376 GTGTAAACTGCAGAGGTGGATGG - Intronic
1128580751 15:68808004-68808026 GTGAACAATCCCATGGTGGTGGG + Intronic
1129134756 15:73537814-73537836 GCGAACAGTGCAGATGTGGCAGG - Intronic
1131865684 15:96706927-96706949 GTGAGAAGCGCAGAGGTGGTTGG + Intergenic
1138443815 16:57050712-57050734 CTGAACAATGATGAGCTGGTTGG + Intronic
1138633482 16:58317992-58318014 GTTAAGAATGCAGGGATGGTGGG + Intronic
1138835327 16:60427890-60427912 GGGAACAAGGCAGAAGTGCTTGG - Intergenic
1139273232 16:65703011-65703033 GTGAACGACTCAGAGATGGTAGG - Intergenic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1141641809 16:85346057-85346079 ATGAACAATGGATAGGTGGATGG + Intergenic
1141954441 16:87360988-87361010 GTGAAAAGTGCAGCTGTGGTGGG - Intronic
1144088440 17:11831834-11831856 GATGACAATGCAGTGGTGGTGGG - Intronic
1144839755 17:18178681-18178703 GTACAGAATGGAGAGGTGGTTGG - Intronic
1146893093 17:36520883-36520905 TTGAACAATGCAGAGGTTAGGGG - Intronic
1147572708 17:41581195-41581217 GTGAAGATTCCAGAGGTGGGTGG - Intergenic
1148837517 17:50473619-50473641 GTGAACAAGGCAGAGATGACAGG + Intronic
1150857298 17:68765374-68765396 GTGATGACTGCAGAAGTGGTGGG + Intergenic
1151432033 17:74070166-74070188 GTCATCTATGCAGATGTGGTAGG + Intergenic
1152353895 17:79797649-79797671 ATGCACAATGCACAGGTGCTGGG + Intronic
1157464690 18:47932858-47932880 GGAAACAAGGCAGAGGAGGTGGG - Intergenic
1158302795 18:56071072-56071094 GCGAACAAGGTAGAGGTGGCTGG + Intergenic
1160393352 18:78554300-78554322 GTGAACAAACCAGTGGTTGTAGG + Intergenic
1161852250 19:6743685-6743707 CTGAAGAATGCAGAGGTGGAAGG - Intronic
1163443418 19:17333242-17333264 GTGAAGAAGGCGGAGGAGGTGGG + Intronic
1165827526 19:38713818-38713840 GTGAACAGTGTAGAGGAGGCAGG - Intronic
1202694817 1_KI270712v1_random:116209-116231 GTGAACAGGGCAGAGGTTGGAGG + Intergenic
926893766 2:17661656-17661678 AGGAACAATGCAGAAGTGGAGGG - Intergenic
927635958 2:24817042-24817064 GAGAACACTGCTGAGGTGGGTGG - Intronic
927877672 2:26669694-26669716 GTGGTCAATTCAGAGTTGGTGGG + Intergenic
929197586 2:39201883-39201905 GTGTACACTGCTCAGGTGGTGGG + Intronic
929423261 2:41816798-41816820 GTGTACAATGAGGAGGTTGTGGG - Intergenic
930240661 2:48932764-48932786 ATGGACAAAGCGGAGGTGGTGGG + Intergenic
931069813 2:58633174-58633196 GTGAAAAATTAAAAGGTGGTTGG + Intergenic
931862722 2:66373254-66373276 GGGAACAATGGAGAGGAGGAAGG - Intergenic
931920346 2:67008552-67008574 CTGCACAAGGCAGAGGTGGCGGG + Intergenic
932771027 2:74500948-74500970 GTGGACACTGCACAGATGGTGGG - Intronic
932851404 2:75191258-75191280 GTGAACAATGCAGGAGTTGGAGG + Intronic
934275989 2:91573258-91573280 GTGAACAGGGCAGAGGTTGGAGG + Intergenic
934675111 2:96244285-96244307 GTGTGCACTGCATAGGTGGTAGG + Intergenic
936616286 2:114050924-114050946 GTGAACTTGGCAGAGATGGTTGG + Intergenic
936884755 2:117297119-117297141 GTGAACACTGCTTAGGTGATTGG - Intergenic
937234679 2:120423503-120423525 TTGGCCAAGGCAGAGGTGGTGGG - Intergenic
937349129 2:121149147-121149169 GTGAATGATGGAGAGGTGATGGG + Intergenic
938128221 2:128689916-128689938 GGGAGCAATCCAGTGGTGGTGGG - Intergenic
938653567 2:133408456-133408478 GTCAGCAATGTAGAGGGGGTAGG - Intronic
939921665 2:148122998-148123020 GTGAGCAATGAAGAGGTGGGTGG + Intronic
941867563 2:170350567-170350589 GGGAACTATGCAGAGATGATGGG + Intronic
947325436 2:228970114-228970136 TTGAAGAAAGCAGAGGAGGTTGG - Intronic
947499941 2:230664516-230664538 GAGCACAGTGCAGAGGGGGTGGG + Intergenic
948058987 2:235029947-235029969 AGGAACAATGCAGAGGTGGACGG + Intronic
948164431 2:235850436-235850458 GTGCATAATGCAGAGGTGCTAGG - Intronic
1169970977 20:11269170-11269192 GTGAAGAACCCTGAGGTGGTAGG + Intergenic
1173568881 20:44064047-44064069 GTGTACACTGCTCAGGTGGTAGG + Intronic
1173710061 20:45147176-45147198 GTAAACCATGAAGAGGAGGTTGG + Intergenic
1174733817 20:52944768-52944790 TTGAACAATGCAGAGGTTAGGGG + Intergenic
1175475554 20:59271364-59271386 GTGAACCATGGTGTGGTGGTGGG - Intergenic
1176894565 21:14361413-14361435 GTGATCAAAGAAGGGGTGGTGGG - Intergenic
1178866374 21:36331120-36331142 GTGAGCACTACAGATGTGGTTGG + Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180470409 22:15650051-15650073 GTGTACACTGCACAGGTGTTGGG - Intergenic
1180613749 22:17114267-17114289 GAGAGCCATGCAGAGGTGGAGGG - Exonic
1181910920 22:26237677-26237699 GTGGACAATGCATAGTGGGTGGG + Intronic
1183747332 22:39699158-39699180 GTGAAGAAGGAAGAGGTGATGGG - Intergenic
950958879 3:17083421-17083443 GTGAACAATACAGGGTGGGTAGG + Intronic
951583793 3:24194168-24194190 GTGTACACTGCTCAGGTGGTGGG + Intronic
951678882 3:25273943-25273965 GTGCACAGTGCAGGGGTGGCAGG - Intronic
951697658 3:25462671-25462693 GTGAACCATGCAGATGAGTTTGG - Intronic
952305679 3:32144054-32144076 GAAGACAATGCAGAGGTGATTGG + Intronic
953232343 3:41076121-41076143 GGGAACAAGGCAGGGGTGGGAGG + Intergenic
954831328 3:53423743-53423765 GTTAACAAGTCATAGGTGGTGGG + Intergenic
955044112 3:55343788-55343810 GAGACCAATGCAGTGGTGGAGGG - Intergenic
958704936 3:97642634-97642656 GTGAAGAATGCAGAAGTCTTAGG + Intronic
960900368 3:122548559-122548581 GAGAATAAAGCAGAGATGGTCGG + Intronic
961076669 3:123989222-123989244 GTGGACAAAGCAGGAGTGGTTGG + Intronic
962202812 3:133414816-133414838 GTGAATAGAGCAGACGTGGTAGG - Intronic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
962745581 3:138395433-138395455 GTGAAGGATGGAGAGGAGGTGGG - Intronic
962869527 3:139475986-139476008 AAGAACAATGCAGAGGTCATTGG + Intronic
965800272 3:172485281-172485303 TTTAACAATGCAGAGGTCATTGG + Intergenic
965927461 3:173999594-173999616 GTTAAAAATGAAGTGGTGGTTGG - Intronic
967506085 3:190254539-190254561 GTGTACAATGCTCAGGTGATAGG - Intergenic
967827196 3:193886646-193886668 GTGAAGAATGCACAGGTGTATGG + Intergenic
968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG + Intergenic
970605717 4:17680073-17680095 GTGTACACTGCACAGGTGATGGG + Intronic
970797841 4:19935682-19935704 GTAAACAATGCATAGATGTTTGG - Intergenic
971025260 4:22583146-22583168 TTGAACAATGCAGAGGTTAGAGG - Intergenic
974262491 4:59543238-59543260 TTGAAAGATGCAGGGGTGGTGGG - Intergenic
974329373 4:60457090-60457112 GTAATCTATGAAGAGGTGGTTGG - Intergenic
978235484 4:106452859-106452881 GTTCAAAGTGCAGAGGTGGTGGG + Intergenic
978603360 4:110451308-110451330 TTGAACAATGCAGAGGTTAGGGG + Intronic
980132585 4:128830528-128830550 GTTAACAATGCAAATGTGGCTGG - Intronic
980860740 4:138496666-138496688 GTGTACACTGCTGGGGTGGTGGG - Intergenic
983015431 4:162607116-162607138 GTGTAATAGGCAGAGGTGGTTGG + Intergenic
986133161 5:4949238-4949260 GTAAAAAATGCAGAGGAGGAGGG + Intergenic
986441335 5:7785072-7785094 GTGGACGAGGCAGAGGTGCTTGG - Intronic
987751706 5:22047664-22047686 GTCAACAGTGCATAGGAGGTAGG - Intronic
987827904 5:23057699-23057721 GTGAAGAAGGGAGAGGTGATGGG - Intergenic
989160215 5:38383836-38383858 GTGACAAATGCAGAGGTCCTGGG + Intronic
991057317 5:62334620-62334642 GGGTACAAGGCAGTGGTGGTGGG - Intronic
991966449 5:72096243-72096265 GTGAACATTGCAGAGGGTGAGGG + Intergenic
993166218 5:84357912-84357934 GTGCAAAATGCAGAAGTGCTAGG + Intronic
994272569 5:97798268-97798290 GGGAACAATGCAAAGGGGGAGGG + Intergenic
994579032 5:101614933-101614955 GGGAACATTGCAGAAGAGGTGGG + Intergenic
995181751 5:109236328-109236350 GTGAACAAAGCAGATGAGGTGGG - Intergenic
995375367 5:111468219-111468241 GTGTACAATGCTCAGGTGATGGG + Intronic
999458734 5:151739713-151739735 GTCAACAAGGCAAAGTTGGTGGG + Intergenic
1000149912 5:158489864-158489886 GTGAAAAAAGAAGAGGTGGAAGG + Intergenic
1001945076 5:175771980-175772002 TTGTACAATGCAGAGGTGCCAGG - Intergenic
1003288376 6:4755365-4755387 TTTAACAAGGCAAAGGTGGTCGG - Intronic
1004049364 6:12060058-12060080 GTGAACAATATAAACGTGGTGGG - Intronic
1004148281 6:13090345-13090367 GTCAACAATGCAGTGCTGGCTGG - Intronic
1005481795 6:26261949-26261971 GTGTACACTGCAGAGGGGGGTGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006786596 6:36671909-36671931 GTGAAGAATGGAGTGGAGGTGGG + Intergenic
1008443811 6:51564581-51564603 GAGGACAATGCAGTTGTGGTGGG + Intergenic
1008985800 6:57541616-57541638 TTGAACAATGCAGAGATTATAGG - Intronic
1009173830 6:60434486-60434508 TTGAACAATGCAGAGATTATAGG - Intergenic
1010830571 6:80523511-80523533 GTGGACAGGGCAGATGTGGTGGG + Intergenic
1012818091 6:104049910-104049932 GTGAACATTGCTCAGGTGATGGG + Intergenic
1014533735 6:122592089-122592111 GTAAACACAGCTGAGGTGGTTGG + Intronic
1017013844 6:150084131-150084153 GGAAACCCTGCAGAGGTGGTTGG + Intergenic
1017295302 6:152786630-152786652 GTGAACACTGCTTGGGTGGTGGG - Intergenic
1019799017 7:3074044-3074066 GTGAACAACAGAGAGGTGCTGGG - Intergenic
1020972643 7:14964993-14965015 GTGAAAAAAGCAGAGGTAGAGGG + Intronic
1021571606 7:22071518-22071540 TTGAACAATGCAGAGGTTAGGGG - Intergenic
1021907962 7:25354528-25354550 GCATACAAGGCAGAGGTGGTAGG + Intergenic
1022703793 7:32784784-32784806 TTGAAAAAAGCAGAGGTAGTGGG - Intergenic
1022908033 7:34874910-34874932 CTGAAAAAAGCAGAGGTAGTTGG - Intronic
1023496367 7:40801533-40801555 GTGGACAATGAAGAAGGGGTTGG + Intronic
1027650677 7:80864290-80864312 GTGTACAATGCTCAGGTGATGGG + Intronic
1028107699 7:86899697-86899719 GTAGACTAAGCAGAGGTGGTGGG + Intronic
1029114513 7:98230484-98230506 GTGGTCAAGGCAGAGTTGGTAGG - Intronic
1029222646 7:99002657-99002679 GTGAGGAATGCAGAGGAGGGAGG + Intronic
1031153154 7:118077688-118077710 GAGAACATTGCAGTGGGGGTGGG - Intergenic
1031335330 7:120523034-120523056 GTGAACGATACAGATGAGGTGGG + Intronic
1033158687 7:138978751-138978773 CTGAACACTGCTGTGGTGGTTGG - Intronic
1033499696 7:141935695-141935717 GTGAGGAATGGAGAGGTGGCTGG - Intronic
1033882678 7:145904971-145904993 GTGAACAATCAACAGGTAGTAGG + Intergenic
1034021288 7:147646033-147646055 GTGGAGGAAGCAGAGGTGGTGGG + Intronic
1035949564 8:4005186-4005208 GTGCATACTGCACAGGTGGTGGG + Intronic
1036478044 8:9111834-9111856 GAAGTCAATGCAGAGGTGGTGGG - Intronic
1039134785 8:34309215-34309237 GGGAAAAATGGAGAGGTGATGGG + Intergenic
1039917554 8:41871165-41871187 GAGAACAATGCAGGGGCGATGGG - Intronic
1041409189 8:57534595-57534617 ATTAACACTGCAGAGGTGGGTGG + Intergenic
1041716472 8:60937078-60937100 GTGGACACTCCAGATGTGGTTGG - Intergenic
1041820982 8:62032706-62032728 GTGAGAAATGCACAGGAGGTCGG - Intergenic
1043817721 8:84823627-84823649 GAGAAGAAGGCAGAGGTGGGAGG - Intronic
1044781133 8:95744532-95744554 GTGAACAAGGCAGATGGGGAAGG + Intergenic
1045588930 8:103571325-103571347 GGGAACAATGCAAATGTGGCTGG - Intronic
1046675799 8:117106856-117106878 GGCATCACTGCAGAGGTGGTAGG - Intronic
1046804090 8:118461093-118461115 GAGAACAAGGCAGAGGGAGTTGG - Intronic
1047902465 8:129438490-129438512 TTGAACAATGCAGAGGTTAAGGG - Intergenic
1051364987 9:16315563-16315585 GAGAACATTGCAGAGGTGTAGGG - Intergenic
1053515189 9:38724397-38724419 GTGTACAATTCAGTGGTGTTTGG + Intergenic
1054913618 9:70476347-70476369 GTGAAGAATCCAGGGGTGGAAGG - Intergenic
1055867764 9:80836248-80836270 GTAAATGATGCAGAGGTGCTGGG - Intergenic
1056330495 9:85517249-85517271 GTAAACAATTTAGAGGTGGAGGG - Intergenic
1057644851 9:96863909-96863931 GTGTACACTGCTCAGGTGGTAGG + Intronic
1057664058 9:97029606-97029628 TTGAACAATGCAGAGGTTAGGGG - Intergenic
1058905921 9:109482707-109482729 CAGAGCATTGCAGAGGTGGTAGG - Intronic
1059652116 9:116324729-116324751 ATGGGCAATGCAGCGGTGGTGGG + Intronic
1061623647 9:131827728-131827750 GTGAAGAATGCGGGGGTGGAAGG + Intergenic
1186510358 X:10125681-10125703 GTGAGCACTGCAGAGGTCATTGG - Intronic
1187255431 X:17637509-17637531 GTGAACCATCCAGAGTTGGCAGG - Intronic
1187994091 X:24906572-24906594 GTATACAATGCTTAGGTGGTGGG + Intronic
1188137133 X:26504618-26504640 CTGTGCAAGGCAGAGGTGGTGGG - Intergenic
1189281847 X:39824655-39824677 GAGAAAAATGCAGTGGGGGTGGG - Intergenic
1191749899 X:64530619-64530641 GTGTACACTGCATGGGTGGTGGG + Intergenic
1193916796 X:87374994-87375016 TTGAACAATGCAAAGGTTGTAGG - Intergenic
1195755401 X:108194498-108194520 GTGAAAAATCCAGGGTTGGTAGG - Intronic
1196501320 X:116386420-116386442 TTGAACAATGTGGAGGTTGTGGG + Intergenic
1197106081 X:122717824-122717846 TTGAAAAATGCAGAGGTGGATGG + Intergenic
1197372170 X:125638797-125638819 GTGCACAATGGGGATGTGGTGGG + Intergenic
1197447324 X:126566398-126566420 GTGAAGAATGCAAAGGAAGTAGG - Intergenic
1197552338 X:127907479-127907501 GTGAACAAGACATAGGTGATTGG + Intergenic
1197921068 X:131594919-131594941 GTCAAGAATACAGAGATGGTGGG + Intergenic
1198796649 X:140403829-140403851 GTGTACACTGCTGAGGTGATGGG - Intergenic
1199605232 X:149572732-149572754 GTGAACCGAGCAGAGGAGGTTGG + Intergenic
1200284763 X:154809709-154809731 GTGTACACTGCTGAGGTGATGGG + Intronic
1201761650 Y:17546016-17546038 GTGTACATTGCAGAAGTGGCAGG - Intergenic
1201839902 Y:18359974-18359996 GTGTACATTGCAGAAGTGGCAGG + Intergenic