ID: 962260674

View in Genome Browser
Species Human (GRCh38)
Location 3:133901570-133901592
Sequence CTGTGCTTGTTGATGTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962260665_962260674 28 Left 962260665 3:133901519-133901541 CCTGGTCCTTTGACTAGAGAGAT No data
Right 962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG No data
962260666_962260674 22 Left 962260666 3:133901525-133901547 CCTTTGACTAGAGAGATCAAGCT No data
Right 962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962260674 Original CRISPR CTGTGCTTGTTGATGTGTCT GGG Intergenic
No off target data available for this crispr