ID: 962261950

View in Genome Browser
Species Human (GRCh38)
Location 3:133916024-133916046
Sequence CTGTGGGGCTTTCACGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962261936_962261950 28 Left 962261936 3:133915973-133915995 CCTTGGGAGAGGCCAGGCAGGCA No data
Right 962261950 3:133916024-133916046 CTGTGGGGCTTTCACGCTTCTGG No data
962261939_962261950 16 Left 962261939 3:133915985-133916007 CCAGGCAGGCAGAAGTGGGTGTA No data
Right 962261950 3:133916024-133916046 CTGTGGGGCTTTCACGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962261950 Original CRISPR CTGTGGGGCTTTCACGCTTC TGG Intergenic
No off target data available for this crispr