ID: 962264035

View in Genome Browser
Species Human (GRCh38)
Location 3:133933172-133933194
Sequence CAGCTGTTCCAGAGGACATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962264024_962264035 24 Left 962264024 3:133933125-133933147 CCAAGAAGGGTGGCACTTAAGGG 0: 1
1: 0
2: 1
3: 3
4: 96
Right 962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG 0: 1
1: 0
2: 2
3: 21
4: 236
962264027_962264035 -9 Left 962264027 3:133933158-133933180 CCATGACCCATGCCCAGCTGTTC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG 0: 1
1: 0
2: 2
3: 21
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962264035 Original CRISPR CAGCTGTTCCAGAGGACATG GGG Exonic
901033056 1:6319744-6319766 CAGCCCTTCCAGAGCAGATGGGG + Intronic
904214904 1:28911708-28911730 CAGCTGAACCTGAGGACTTGAGG + Intronic
904992110 1:34601465-34601487 CAGATGTTCCAGTGGCCCTGTGG + Intergenic
907493563 1:54826412-54826434 CAGCTGTCTGAGTGGACATGAGG + Intronic
907511381 1:54963565-54963587 CATCTCTTACAGAGGAAATGAGG + Intergenic
909771102 1:79422676-79422698 CAAATGTACTAGAGGACATGTGG - Intergenic
909799263 1:79785024-79785046 CAGATGTTCCAGAGAAGCTGTGG - Intergenic
910608505 1:89114017-89114039 CAAATGTTCCAGAGGAAATTAGG - Exonic
916059457 1:161088818-161088840 CAGCCGTTCCAGAGCCCAGGGGG + Intronic
916630588 1:166608049-166608071 CAGCTGCTCCTGCAGACATGGGG + Intergenic
920082085 1:203382229-203382251 CAGCAGCCCCAGAGGACAAGAGG - Intergenic
920555481 1:206901162-206901184 TAGCTGTTAAAGAGGCCATGTGG + Intronic
922585819 1:226734557-226734579 TAGCTTTTCCAGAGAGCATGGGG - Intronic
922659517 1:227417682-227417704 CAGGTGTTTCAGAGGGAATGAGG - Intergenic
923619500 1:235566585-235566607 CAGTTTTTCCACAGGTCATGGGG - Intronic
924305564 1:242685179-242685201 GAGCTGTTTCAGCGGATATGTGG + Intergenic
924526693 1:244858147-244858169 CAGTTGTGGCAGAGAACATGCGG + Exonic
1063024945 10:2168497-2168519 GAGCTGTTTCTGAGGACAGGGGG - Intergenic
1063130790 10:3174540-3174562 CAGGAGGTCCAGATGACATGTGG + Intergenic
1064136908 10:12758826-12758848 CAGCAGTTGCAGAGGAGAGGAGG + Intronic
1067346206 10:45440808-45440830 CTGCTGTTCCCCAGGACACGCGG + Intronic
1068892036 10:62157942-62157964 CTGCTATTTCAGAGGACATGTGG + Intergenic
1069951891 10:72024775-72024797 CAGATGTTCCACAGCAAATGAGG - Intergenic
1070462066 10:76680329-76680351 CAGCTGCCCCAGAGGGCATGTGG - Intergenic
1070761832 10:79028734-79028756 CAGCTGCCCCAGAGGCCATCTGG - Intergenic
1071472438 10:85993199-85993221 CAGCAGGTACAGAGGACAAGGGG + Intronic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1072717211 10:97760055-97760077 CAGCTGCTCCAGCGGAGCTGGGG - Exonic
1075082269 10:119391837-119391859 CAGCTTTTCCAGAGTCCTTGAGG - Intronic
1076152641 10:128175144-128175166 CTGGTGTTCCAAAGGCCATGAGG + Intergenic
1076842069 10:133050590-133050612 CAGCTGCTCCGCAGGACAGGCGG + Intergenic
1077245467 11:1534945-1534967 GAGCAGTGCCAGTGGACATGAGG + Intergenic
1079107269 11:17579511-17579533 CCGCTGGCCCAGAGCACATGAGG + Intronic
1079335945 11:19570787-19570809 CAAGTGTTTCTGAGGACATGGGG + Intronic
1080243234 11:30151331-30151353 CAGCTTTTCCATAAGACATAGGG + Intergenic
1081237064 11:40659002-40659024 CAGCTGTGCCAGGGAACATGGGG - Intronic
1082969317 11:59002938-59002960 CAGCTGCTCCTGAAGACATGGGG - Intronic
1083447897 11:62722253-62722275 CAATTTTTGCAGAGGACATGGGG + Exonic
1084174937 11:67418216-67418238 CAGCTGTTCCAGAGGTGCTGTGG - Intronic
1085080447 11:73629502-73629524 CAGCTGTTCCAAAGGCCCTGGGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089985664 11:122810495-122810517 CAGCTGCTCTAGAGAAAATGTGG - Exonic
1091734573 12:2909327-2909349 CACTTATTCCAGAGGACCTGAGG - Intronic
1095236275 12:39799946-39799968 CAGCTGCTCCACTGCACATGGGG - Intronic
1095635673 12:44430305-44430327 TAGTTGTTCCAGAGGATAGGAGG + Intergenic
1101242424 12:102851585-102851607 CCGCTCTTGCAGAGGGCATGAGG + Intronic
1102361137 12:112288666-112288688 GAGCTTTTCAAGAGGACAAGTGG - Intronic
1102597876 12:114006612-114006634 CAGCTGTGTCAAAGGAGATGTGG - Intergenic
1102647632 12:114414185-114414207 CAGCAGTTCCCGAGTACACGTGG + Intergenic
1104164709 12:126216529-126216551 CAGCAGGTCCTGAGGCCATGGGG + Intergenic
1104378067 12:128282600-128282622 CAGCAGTTCCAGATGAGATTTGG + Intronic
1105844993 13:24286412-24286434 CAGCTTTTCCAAAGTACCTGGGG + Intronic
1106463637 13:29994019-29994041 CAGCTGTTCCAGAGAAGGGGCGG + Intergenic
1107396167 13:40020114-40020136 CAGTTGTTCCCTAGGGCATGGGG - Intergenic
1109345768 13:61113383-61113405 CAGCTGTTCCTGGGAGCATGGGG - Intergenic
1109443235 13:62401181-62401203 AAGCTGTTCCACAGGACTTTGGG - Intergenic
1109979160 13:69883878-69883900 GAGCTGTCCCAGGAGACATGGGG - Intronic
1116697853 14:48200196-48200218 CGGATGATCCAGAGGAAATGTGG - Intergenic
1117171977 14:53109625-53109647 CAGCTTTTGGGGAGGACATGCGG + Intronic
1117196679 14:53346809-53346831 CAGTTGTCCCTGAGGGCATGGGG + Intergenic
1117372567 14:55092166-55092188 CAGCTATTCAAGAGCACAGGAGG - Intergenic
1117521339 14:56554192-56554214 CAGCTGTGCCAGGGCACCTGGGG - Intronic
1117567722 14:57012524-57012546 CAAGTGTTGAAGAGGACATGGGG - Intergenic
1118182052 14:63503531-63503553 CAACTGTTCCAGAGCAAAGGAGG + Intronic
1118283392 14:64449478-64449500 CCGCCTTTCCAGAGAACATGGGG + Exonic
1118989002 14:70781200-70781222 CAAGTGTTCCAGTGAACATGGGG - Intronic
1119879703 14:78090615-78090637 CAGCTGACCCATTGGACATGCGG + Intergenic
1121326538 14:93023428-93023450 CAGCTGGCCCTGTGGACATGTGG + Intronic
1127037680 15:54936709-54936731 CTGCTATCCCAGAGGACTTGAGG - Intergenic
1128133540 15:65246349-65246371 CAGCCATTCCAGAGGCCTTGAGG + Intronic
1128867993 15:71130021-71130043 GAGCTGTTCCAGAGTGAATGGGG + Intronic
1129790074 15:78335257-78335279 CTGCTCATCCAGAGGACACGTGG + Intergenic
1132743906 16:1428872-1428894 CAGCTGTGGCTGAGGACCTGCGG - Intergenic
1133891545 16:9883909-9883931 CCGATGTTCCAGAAGACATTAGG - Intronic
1138145838 16:54611220-54611242 CAGCTGTTCCAGTTCCCATGTGG + Intergenic
1138412127 16:56849097-56849119 GAGCTGATCCAGAGGATGTGGGG - Intronic
1139574327 16:67831697-67831719 CAGCCTCTCCAGAGGACAGGAGG + Intronic
1140804854 16:78523781-78523803 CAGCTGTTCCAGAGGCCCCCAGG - Intronic
1141645695 16:85366250-85366272 CAGCTGCTCCGGAGGGCACGGGG + Intergenic
1142624154 17:1181298-1181320 CAGCTGCCCCAGGGGAGATGGGG + Intronic
1146159791 17:30553705-30553727 CTGCACTGCCAGAGGACATGGGG + Intergenic
1146528870 17:33590911-33590933 CAGCTGTTCCTGAGTACCTATGG - Intronic
1147055721 17:37833393-37833415 CGGCTGTTCAAGAGACCATGCGG - Intergenic
1147237650 17:39069628-39069650 GGGCTGTTCCACAGGACAGGAGG + Intronic
1147505124 17:41008720-41008742 CAGATGGTGCAGAGGACATTGGG + Exonic
1150142769 17:62744063-62744085 CAGCTGCTCCAGAGGGCATTTGG - Intronic
1151344787 17:73494901-73494923 CACTGGTGCCAGAGGACATGGGG - Intronic
1151502025 17:74496405-74496427 CAGCTGACCCAAAGGACATGGGG + Intergenic
1152802226 17:82336136-82336158 CTGCTGTGCCAGGTGACATGTGG + Intergenic
1153595619 18:6722367-6722389 CAGTCTTTCCAGAGGACTTGAGG + Intergenic
1153703541 18:7721160-7721182 TAGCTATTCCAGTGGGCATGAGG + Intronic
1156392190 18:36660726-36660748 GAGATGTTCCAGAGGCCCTGGGG + Intronic
1157570929 18:48711794-48711816 CAGCTGATCCTGATGAGATGGGG + Intronic
1157681761 18:49613057-49613079 CAGCTTTTCCAAGGGACCTGAGG - Intergenic
1158325363 18:56307983-56308005 CAGCTGGGCCAGAGGAAATGAGG - Intergenic
1160015076 18:75134044-75134066 CGACTGTTCCAGAGCACGTGTGG - Intergenic
1162174989 19:8823796-8823818 CACCTGCTCCAGGGGACATTCGG + Intronic
1162427446 19:10604897-10604919 CAGCAGTTCCAAGGGAAATGGGG + Intronic
1162774890 19:12973485-12973507 CAGCTGTTGCACAGGACTAGTGG - Exonic
1163488889 19:17605683-17605705 TGGCTTTTCCAGGGGACATGAGG + Exonic
1163594224 19:18211536-18211558 CATCTGTTCTAGGTGACATGCGG - Intronic
1164227052 19:23255117-23255139 CAGAAGGTCCTGAGGACATGTGG + Intergenic
1164590695 19:29505271-29505293 CAGCTGTTCCTGCAGACAAGTGG + Intergenic
1167207239 19:48110813-48110835 CAGCTGTTCCAGAGCTCACCCGG + Exonic
925336510 2:3102615-3102637 CAGCTGTGGCAGAGGAGGTGAGG + Intergenic
925787711 2:7448831-7448853 CAGCAGTTTGAGATGACATGTGG - Intergenic
925804383 2:7633788-7633810 CAGATGTCCCAGAGAAAATGGGG + Intergenic
926139406 2:10359462-10359484 CTGCTGTCACAGAGGCCATGAGG - Intronic
926274999 2:11396852-11396874 CAGCTGTGGCAGATGACATGGGG + Intergenic
927212426 2:20646972-20646994 CAGCTGCTCCAGAGCCCAGGTGG + Intronic
927217094 2:20673904-20673926 CACCTGCTCCAGAGGAAATCTGG - Intergenic
927509470 2:23635422-23635444 CAGCAGTCTCAGAGGACACGTGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932088300 2:68782026-68782048 CAGCTATTCCAGAGCAAATCAGG - Intronic
932097669 2:68866020-68866042 TAGCTTTTCCAGTGGACCTGGGG - Exonic
933757740 2:85653365-85653387 CAGATGTACCACATGACATGAGG + Intergenic
937794261 2:125998398-125998420 CCACTGTCCCAGAGGAAATGTGG + Intergenic
937951197 2:127388937-127388959 CAACTGCTCCAGTGGAAATGTGG - Intergenic
940947520 2:159635459-159635481 CAGCTTTTTCGGAGCACATGTGG + Intergenic
941811074 2:169756632-169756654 CTGCTGCTCCAGAGGGCACGAGG + Intronic
942614313 2:177774348-177774370 GAGCTGTTCCAGTGGAGAGGTGG - Intronic
944944701 2:204670241-204670263 CAGCTGCAACAGAGGTCATGTGG - Intronic
944999673 2:205335107-205335129 CAACAGTTCTAGAGGCCATGGGG + Intronic
945444245 2:209917049-209917071 CAGTTGTGCCAGAAGAAATGGGG - Intronic
946206313 2:218111472-218111494 CAGGTGGTCCAGAGGAGATTTGG + Intergenic
946522472 2:220481705-220481727 CATGTGTTCAAGAGGATATGTGG + Intergenic
947978550 2:234388167-234388189 CAGCTGTGCCAGAGGAGAAAGGG + Intergenic
948074558 2:235155862-235155884 CAGCAATTCCAGAGGACACCCGG + Intergenic
948342511 2:237266112-237266134 CAGCTGGGCCAGAGGACATGTGG - Intergenic
1170071437 20:12373497-12373519 CAGCTGTTCCAAATCCCATGAGG - Intergenic
1170323306 20:15126770-15126792 CAGCTGGCCCAAGGGACATGAGG - Intronic
1171427019 20:25055550-25055572 CAGATGCTCCAGAGGACACTCGG - Intronic
1172338207 20:34133813-34133835 CAGCTGCTCCTGCAGACATGGGG - Intergenic
1172521398 20:35568862-35568884 CAGCTGGTACAGAGGCCATCAGG - Intergenic
1173455990 20:43201768-43201790 CAGCTGTTCCTGAGGGAGTGAGG - Intergenic
1173697212 20:45028533-45028555 CAGGTGTTCCAGATGAGCTGGGG - Intronic
1173738262 20:45377204-45377226 CAGCTTACCCAGAGGAGATGCGG + Exonic
1173848543 20:46203120-46203142 CAGCTGTTCCTAAGGCCATAGGG + Intronic
1173960346 20:47066548-47066570 CAGCTGAGCAACAGGACATGAGG - Intronic
1174056045 20:47799248-47799270 CAGCTGGTGCAGAGGACAGCTGG + Intergenic
1176060037 20:63168499-63168521 CAGCTGCACCTGAGGACCTGGGG - Intergenic
1176132789 20:63503309-63503331 CAGCTGGTCCAGAGAGAATGGGG + Intergenic
1176238564 20:64065436-64065458 CACGTGTTACAGAGGAGATGGGG + Intronic
1178008712 21:28256721-28256743 GAGATGTTCCAGAGGATCTGGGG - Intergenic
1178549174 21:33520926-33520948 CATCTGTTCCAGAGGCCAGAAGG + Exonic
1179361597 21:40714402-40714424 CAGCTTTTCCTGAGGCCCTGGGG + Intronic
1182557249 22:31135917-31135939 CAGCTGTTCCAGAGACCCTAGGG - Exonic
1182649614 22:31840531-31840553 CAGCTATTCCAGAGAACAACAGG - Intronic
1182745204 22:32600487-32600509 CCCCTGCTCCAGAGGAAATGAGG + Intronic
1183077660 22:35436983-35437005 CACCTCCTTCAGAGGACATGAGG + Intergenic
949722032 3:7000596-7000618 AAGCAGTTCAAGAGGAAATGAGG - Intronic
953034710 3:39201714-39201736 CAGGAGTCCCAGAGGCCATGTGG + Intergenic
953546317 3:43866089-43866111 CAGCTGGCCCAGAGGTCCTGTGG + Intergenic
954283617 3:49602209-49602231 CAGCAGGTCAAGAGGACCTGAGG - Intronic
954428662 3:50457554-50457576 CAGCTGGACCAGAGCACCTGGGG - Intronic
954475932 3:50745698-50745720 CCGCTGTTGCAGAGGGGATGAGG + Intronic
954755152 3:52835217-52835239 CAGCTGTCCCAGAGGGCAAAGGG - Exonic
955043080 3:55335586-55335608 CAGCACTTCCAGAAGAGATGAGG + Intergenic
956623310 3:71242682-71242704 CAGTTGTCTCAGAGGACATATGG - Intronic
957966259 3:87324760-87324782 CAGCTGTCTCAGAGCCCATGGGG + Intergenic
961503447 3:127354428-127354450 CAGCTTTTCCAGAGGACCGTTGG + Intergenic
962264035 3:133933172-133933194 CAGCTGTTCCAGAGGACATGGGG + Exonic
962548003 3:136457131-136457153 TTGCTGTTCCAAAGGCCATGAGG - Intronic
963560148 3:146854811-146854833 CATCTCTTCCAGGGGACATGTGG - Intergenic
963727088 3:148934832-148934854 CCGTTTTTCCAAAGGACATGAGG + Intergenic
965063213 3:163807291-163807313 CAGATGGTCCAGAGGAGATTTGG - Intergenic
965229988 3:166038284-166038306 CAGCAATTCTAGAGGACATTTGG - Intergenic
966692435 3:182755681-182755703 CAGCTGTACCTGGGAACATGGGG - Intergenic
968980892 4:3848832-3848854 CAGCTGTGCCTGGGAACATGGGG + Intergenic
969640024 4:8392098-8392120 CAGCTGTGACAGAGACCATGTGG - Intronic
970209486 4:13694003-13694025 CAGCAGGTCCAGATTACATGGGG - Intergenic
973577253 4:52302804-52302826 AAGCTGAGCCAGAGTACATGGGG + Intergenic
973701507 4:53541959-53541981 CAGCTGCTCCAGATGACACATGG + Intronic
975147156 4:70980840-70980862 CAGCTGTTTCTGAGGGCATGTGG + Intronic
977495162 4:97766185-97766207 CAGTTGGTCTATAGGACATGGGG - Intronic
980108207 4:128608471-128608493 CAACGGTTCCAGAAGGCATGTGG + Intergenic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
980784159 4:137530996-137531018 CTTCTTTTCCAGGGGACATGAGG + Exonic
981318077 4:143361541-143361563 CAGCTTTTCCAGAGAAACTGTGG - Intronic
982540678 4:156666230-156666252 CTGCTGTTCCAGAGGACAGGAGG + Intergenic
982573550 4:157079335-157079357 CAGATGTTCCATAAGAGATGAGG + Intronic
986408193 5:7447912-7447934 AAGCTTTTCCTGAGGACCTGGGG + Intronic
987810866 5:22834141-22834163 CACCTATTCCAGAGGAAAAGAGG - Intronic
988527472 5:31999642-31999664 CAGGTGCCCCAGAGGACATCTGG + Intronic
988586375 5:32511076-32511098 AAGCTGCTCCAGATGACAAGTGG + Intergenic
995126387 5:108580626-108580648 CAGCTGACCCAATGGACATGTGG + Intergenic
997242482 5:132318023-132318045 CAGCTGTCACTGTGGACATGGGG + Intronic
1000224869 5:159250778-159250800 CAGTTGTTACAGAGGAAATCTGG + Intergenic
1001199121 5:169699854-169699876 CGCCTGTTCCAGAGGCCCTGTGG + Intronic
1001524555 5:172419366-172419388 CAGCTGTTGCCGAGGAGGTGGGG - Intronic
1001952711 5:175827293-175827315 CAGCTTCCCCAGAGGAAATGGGG + Intronic
1002028263 5:176410284-176410306 CAGCTGGTTCTGAGGACATGGGG - Exonic
1002607072 5:180389847-180389869 CAGCAGGTCCAGGGGACAGGAGG - Intergenic
1003072602 6:2956880-2956902 CAGCTGTTTCAGTGGACACCTGG - Intronic
1006455024 6:34126717-34126739 CAGCTGTTGCTGCAGACATGGGG + Intronic
1007030512 6:38622122-38622144 CAGATGGTCCAGAGGAGATTTGG - Intronic
1007571726 6:42896446-42896468 CAGCTGCTCCTGCAGACATGGGG + Intergenic
1008377569 6:50809733-50809755 CAGATGTTTCAGAGAGCATGGGG + Intergenic
1010393479 6:75363239-75363261 AACCTGTTCCAGTGCACATGAGG + Intronic
1011144431 6:84196942-84196964 GAGATTTTCAAGAGGACATGAGG + Intronic
1012507026 6:99958971-99958993 CTGCTGCTCCAGAGGACCTGTGG + Intronic
1013027091 6:106286291-106286313 CAACCGTTCCAAAGCACATGGGG + Intronic
1013464855 6:110409135-110409157 CACCTCTGCCAGAGCACATGGGG + Intronic
1014715006 6:124853834-124853856 CAGCTGTGCTAGAGGAAAGGCGG - Intergenic
1015043599 6:128751859-128751881 CAGCTGTGCCAAAGGAAGTGCGG + Intergenic
1015770781 6:136766062-136766084 CAGCTGCACCACAGGTCATGAGG + Intronic
1016845362 6:148563529-148563551 GAGCTATTCCAGAGGACAAAGGG - Intergenic
1017131981 6:151115339-151115361 GAGGTGTTCCAGAGGAAACGAGG + Intergenic
1017647343 6:156551396-156551418 CAGCACTTTCAGAGGCCATGGGG + Intergenic
1019032047 6:169022236-169022258 CAGCCGTTCCAGTGGGCAGGGGG + Intergenic
1019037613 6:169074646-169074668 CAGCAGTTCCAGGGGACTAGAGG - Intergenic
1019723821 7:2589574-2589596 CGGCAGTTCCAGGGGACAGGAGG + Intronic
1019946797 7:4336368-4336390 CAGGAGGTCCAGACGACATGTGG + Intergenic
1023113773 7:36840436-36840458 AGGCTTTTCCAGAGGTCATGGGG + Intergenic
1024037608 7:45522162-45522184 CAGCTGTAAATGAGGACATGAGG - Intergenic
1024280384 7:47713868-47713890 CAGCTGGAACAGAGGCCATGTGG + Intronic
1024870326 7:53956984-53957006 CAGATGGTCCAGAGGAGATTTGG + Intergenic
1025068196 7:55875388-55875410 CAGCCGTCCAGGAGGACATGAGG + Intergenic
1025083850 7:56006814-56006836 CAGCTGTTAAAGAGGACAGCAGG + Intergenic
1025143565 7:56485072-56485094 CAACTGTCCCTGAGGACATATGG - Intergenic
1025932497 7:66007449-66007471 CAGCTGTTTCTGCAGACATGAGG + Intergenic
1027446883 7:78284339-78284361 CAGCTGTTCCTGAGGACTTTTGG + Intronic
1027791439 7:82641875-82641897 CAGATGATCCAGAGGAGATTTGG - Intergenic
1027846953 7:83392211-83392233 CAGCTGGTAGAGAGGACATGGGG + Intronic
1033369598 7:140696501-140696523 AAGCTGTTTCAGAAGGCATGGGG + Intronic
1034545534 7:151786344-151786366 CAGGTGTGCAAGCGGACATGCGG + Intronic
1036437041 8:8743958-8743980 CACCTGCTCCAGAGGTCATGTGG - Intergenic
1036644347 8:10602432-10602454 CAGCTGTGCCTGTGGACACGGGG + Intergenic
1037553360 8:19996837-19996859 TGGCTACTCCAGAGGACATGGGG + Intergenic
1039022479 8:33223091-33223113 CAGCTGTTCTGGAGTGCATGCGG + Intergenic
1043522747 8:81063878-81063900 CACATGCTCCAGAGGAAATGAGG + Intronic
1043888614 8:85631393-85631415 CAGCTTTTCAAGGTGACATGTGG + Intergenic
1044736292 8:95282593-95282615 CACCTATGCCAGAGGAGATGGGG + Intergenic
1045518773 8:102884857-102884879 CAGCTGTACAAGATAACATGAGG + Intronic
1049496685 8:142938946-142938968 CAGCTGTTCCTGGGGGCCTGTGG + Intergenic
1050356050 9:4783327-4783349 CAGGTATTCAAGAGGACTTGGGG - Intergenic
1052855369 9:33403277-33403299 CAGCAGTCCCAGAGGACTTTTGG + Intergenic
1058798747 9:108523996-108524018 CAGCTGGTCCCTAGGACAAGGGG + Intergenic
1058896010 9:109401263-109401285 ACGCTGTTCCAGAGGAGAGGAGG - Intronic
1059496681 9:114715680-114715702 CTGGTGTTGAAGAGGACATGGGG + Intergenic
1059927262 9:119222395-119222417 CAGTTGCTACAGAGAACATGCGG + Intronic
1060119415 9:120974229-120974251 CAGCAGTAGCAAAGGACATGGGG + Intronic
1060419719 9:123459230-123459252 CAGCTGCTCTGGAGGACCTGGGG + Intronic
1061233177 9:129326809-129326831 AAGCTGTCCTCGAGGACATGTGG - Intergenic
1061712805 9:132499291-132499313 CAGCTGATCGAGAAGAAATGGGG - Intronic
1061997869 9:134196583-134196605 CAGAGGTGCCAGAGCACATGTGG - Intergenic
1062694695 9:137867440-137867462 CAGAGGTTCCAGAGGACTGGAGG + Intronic
1186900468 X:14049902-14049924 CAGCAGTTTCAGAGCTCATGTGG - Intergenic
1187055584 X:15738632-15738654 CAGCTGTTCCAGAGAAAAGGGGG + Intronic
1191137721 X:57083393-57083415 CAGCTGCTCCAGAGCACTAGTGG - Intergenic
1191579121 X:62740725-62740747 CAGCTGCTCCTGTAGACATGGGG - Intergenic
1191895171 X:65985078-65985100 GCCCTGTTCCAGATGACATGGGG + Intergenic
1192292770 X:69815235-69815257 CAGATGTTCCAGAGGAGGAGAGG + Intronic
1192503968 X:71669829-71669851 CAGCTGTCCCACAGGAAATGGGG + Intergenic
1198280106 X:135133411-135133433 CATCTGTTACAGAGGACTGGAGG + Intergenic
1198290852 X:135239103-135239125 CATCTGTTACAGAGGACTGGAGG - Intergenic
1198506711 X:137308629-137308651 CTGCTGTTTCACAGGAGATGAGG - Intergenic
1199976968 X:152899827-152899849 CAGCAGCTCCAAAGGACGTGCGG - Intergenic
1200260202 X:154611187-154611209 CAGCTGCTCCTGCAGACATGGGG + Intergenic
1200835805 Y:7729977-7729999 CAGGTGTCCCTGAGGACACGGGG - Intergenic