ID: 962264810

View in Genome Browser
Species Human (GRCh38)
Location 3:133937316-133937338
Sequence TTATAAACACAGAGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 409}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962264810_962264817 5 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264817 3:133937344-133937366 GCAGCAGGAGCAGGGTCTGAAGG 0: 1
1: 0
2: 0
3: 84
4: 922
962264810_962264818 6 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264818 3:133937345-133937367 CAGCAGGAGCAGGGTCTGAAGGG 0: 1
1: 0
2: 0
3: 64
4: 543
962264810_962264821 17 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264821 3:133937356-133937378 GGGTCTGAAGGGGCTCTGCAGGG 0: 1
1: 0
2: 2
3: 20
4: 553
962264810_962264816 -3 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264816 3:133937336-133937358 TAATGCAGGCAGCAGGAGCAGGG 0: 1
1: 1
2: 2
3: 37
4: 333
962264810_962264822 25 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264822 3:133937364-133937386 AGGGGCTCTGCAGGGACTAGAGG 0: 1
1: 0
2: 1
3: 24
4: 257
962264810_962264820 16 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264820 3:133937355-133937377 AGGGTCTGAAGGGGCTCTGCAGG 0: 1
1: 0
2: 5
3: 22
4: 239
962264810_962264814 -10 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264814 3:133937329-133937351 GTGTTTATAATGCAGGCAGCAGG 0: 1
1: 1
2: 2
3: 16
4: 167
962264810_962264815 -4 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264815 3:133937335-133937357 ATAATGCAGGCAGCAGGAGCAGG 0: 1
1: 0
2: 2
3: 62
4: 533
962264810_962264819 7 Left 962264810 3:133937316-133937338 CCCTGCTTCCTCTGTGTTTATAA 0: 1
1: 0
2: 1
3: 36
4: 409
Right 962264819 3:133937346-133937368 AGCAGGAGCAGGGTCTGAAGGGG 0: 1
1: 0
2: 2
3: 99
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962264810 Original CRISPR TTATAAACACAGAGGAAGCA GGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
900839970 1:5040605-5040627 TAATAAAGGGAGAGGAAGCAAGG + Intergenic
900964721 1:5949981-5950003 TTTTAAACACAGAAGAAAAATGG + Intronic
901414338 1:9106344-9106366 TTCTCAACACAGAAGCAGCAGGG + Intronic
902242422 1:15097916-15097938 TTTTTAACACAAAGGCAGCATGG - Intronic
902744721 1:18466007-18466029 TTCAAAACTCAGGGGAAGCAGGG - Intergenic
902979121 1:20110373-20110395 TTAAAAAGACAGAGGAGGCCGGG + Intergenic
903317278 1:22518048-22518070 ATATACACACACAGGAAGGAAGG + Intronic
903597412 1:24505652-24505674 TTATAAATACAGAAAAACCAAGG + Intronic
904051603 1:27642937-27642959 ATATACATACATAGGAAGCACGG - Intergenic
905150175 1:35921036-35921058 TTATCTGCACAGAGGAAGGATGG - Exonic
905352975 1:37360273-37360295 TCATAAACAGAGAAGCAGCAAGG - Intergenic
905465749 1:38151794-38151816 CTATAAAGACGGAGGAAGCTGGG - Intergenic
907983240 1:59505531-59505553 TGCCAAGCACAGAGGAAGCAGGG + Intronic
907989049 1:59561265-59561287 TGGTAAACAAAGAGGAAGCGAGG - Intronic
908092859 1:60704903-60704925 TTATCAACATAGAGGAATCCTGG + Intergenic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908178685 1:61581844-61581866 TAATAGACAAAGAGAAAGCAAGG + Intergenic
908194849 1:61738672-61738694 TTAACAACACAAAGGAAGAAGGG + Intergenic
909248399 1:73320439-73320461 TCATAATCTCAGAGGAAGGATGG + Intergenic
909293599 1:73915014-73915036 TTATAAGCACAGGAAAAGCAAGG + Intergenic
909846888 1:80405908-80405930 TTTTAAAGACAGACAAAGCAGGG + Intergenic
909891270 1:81010171-81010193 TTAAAAAGACAGAAGGAGCAAGG + Intergenic
910315484 1:85877656-85877678 TTAAAAACACACATGAAGCTGGG - Intronic
910594060 1:88959610-88959632 TTAAAAACAAAGAAGAAGAAAGG - Intronic
910772671 1:90845593-90845615 TTAAATACACAGAGGAAAGAAGG + Intergenic
911183782 1:94883910-94883932 GAATATACACAGAGGAAGAAAGG - Intronic
911351254 1:96758746-96758768 TTAAAAACAGAAATGAAGCAAGG + Intronic
912982376 1:114387150-114387172 TAATAAGCATAGAGGAAGCAAGG + Intergenic
913243656 1:116852471-116852493 TGATTAACACAGAGGTATCAGGG - Intergenic
914736273 1:150420081-150420103 TTATACATAAAGAGGCAGCATGG - Intronic
915238813 1:154504776-154504798 TTAAAAACACAGATAAAGCCTGG + Intronic
915561459 1:156690560-156690582 GTAGAAACACAGAGGCAGAAAGG - Intergenic
916714466 1:167438009-167438031 AAATAAAGACAGAGGAAGGAAGG + Intronic
917988025 1:180341013-180341035 TTATAAACATGGAGTGAGCATGG + Intronic
917991539 1:180385232-180385254 TTATAAACACAAAAGAAGTCAGG + Intronic
918366551 1:183814099-183814121 GAATAAAAACAGAGGAAGAAAGG + Intronic
919541807 1:198856593-198856615 TTAGAAAAGGAGAGGAAGCAAGG + Intergenic
920280927 1:204843052-204843074 TCAGGAACACAGAGGAATCATGG - Intronic
920326228 1:205166815-205166837 TTATAAATACAAAGGAAGTATGG - Intronic
920809232 1:209266538-209266560 TTCTAAACTGAGAGGAAACAGGG - Intergenic
923243764 1:232111020-232111042 TTATAAACACAGACGCAGCATGG - Intergenic
923309470 1:232721885-232721907 TTATATACAAAGATGAAGCCAGG + Intergenic
924385353 1:243494431-243494453 TTAAAAACACTCAGGCAGCAGGG - Intronic
924531685 1:244899120-244899142 TTATAAAGACAAAGGAGGCTGGG + Intergenic
1063034571 10:2273093-2273115 TTTTAAATACACAGGTAGCATGG + Intergenic
1063377108 10:5561085-5561107 CTGTAAACACATAGGATGCAGGG - Intergenic
1063940342 10:11122093-11122115 TTAAAAACACAATGGAAGCCAGG - Intronic
1065550041 10:26860895-26860917 TTAAAGAGACAGAGGCAGCAAGG + Exonic
1065742626 10:28810994-28811016 CTATAAACTCCCAGGAAGCAAGG - Intergenic
1066114071 10:32224315-32224337 TTAGAAACACAGAGAAGGCCAGG - Intergenic
1066136078 10:32447334-32447356 TTATATATACATAGAAAGCAAGG - Intronic
1068761105 10:60710394-60710416 TTATAAACACAGACCATTCATGG - Intronic
1069263240 10:66426797-66426819 TTTTAAAGACAGAGGAAATATGG - Intronic
1071381089 10:85060976-85060998 CTATTAACAAAGAGGGAGCATGG - Intergenic
1071505778 10:86230652-86230674 TTATGCACATAGAGGAAACAGGG - Intronic
1072248395 10:93562871-93562893 TAACAAACACAAAGGAAGGATGG + Intergenic
1072348936 10:94538917-94538939 TTATAAAGAAATATGAAGCAGGG - Intronic
1072438493 10:95434457-95434479 TCACATACACAGAGGAAGTAAGG + Intronic
1072948765 10:99834561-99834583 TTATAGATAGAGAGGAAGGAAGG - Intronic
1073560208 10:104489775-104489797 TTGTTGACACAGAGGAAGGAGGG + Intergenic
1074989138 10:118687020-118687042 TTATAAATGCTGAGGAAGAAAGG - Intronic
1075386507 10:122059210-122059232 TTAAAAACACAGATGGAGCCCGG - Intronic
1076306924 10:129472021-129472043 TTACAAACACACGCGAAGCACGG + Intronic
1076432668 10:130417261-130417283 TTAGAAATACAGAGGAAGGTTGG - Intergenic
1076699468 10:132263892-132263914 TTATAAAAAAAGAAAAAGCATGG + Intronic
1077341072 11:2026605-2026627 AAATAAACACAAAGAAAGCAAGG - Intergenic
1077884656 11:6378001-6378023 TTTTAAACAGACAGGAAGCCAGG + Intergenic
1079433114 11:20416233-20416255 TTTTAAATAAAGAGGAAGAAGGG + Intronic
1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG + Intergenic
1080944887 11:36959829-36959851 TTCTAAACACAAAGGAAGACAGG + Intergenic
1081777512 11:45685578-45685600 TTAGAAAACCACAGGAAGCAGGG + Intergenic
1083508400 11:63183332-63183354 TAATAAGGACAGAGGAAGGAAGG - Intronic
1084929714 11:72545195-72545217 TTAAAAACATAAAGGATGCAGGG - Intergenic
1085253807 11:75160683-75160705 ATAAACACTCAGAGGAAGCAAGG - Intronic
1086025474 11:82284999-82285021 TTATTTACAGAGAGGCAGCAAGG - Intergenic
1086116164 11:83253262-83253284 GTATAAACAAAGAGAAAGAAAGG - Intronic
1087238104 11:95743053-95743075 TTTTAGGCACAGAGAAAGCATGG - Intergenic
1087708644 11:101523949-101523971 TTAAAACCACAGAAGAATCAGGG - Intronic
1088759868 11:112919200-112919222 TGATAAACAAAGGGGAAGCAAGG + Intergenic
1089885454 11:121817390-121817412 TTTAAAACAAAAAGGAAGCAGGG - Intergenic
1090393318 11:126403470-126403492 TTAGAATCACAGAGGAGGTACGG + Intronic
1090876926 11:130798470-130798492 TTATGACCACAGAGGACACAAGG - Intergenic
1202824057 11_KI270721v1_random:81794-81816 AAATAAACACAAAGAAAGCAAGG - Intergenic
1091835018 12:3579559-3579581 TCAGGAACACAGAGGAAGAAAGG - Intronic
1092596667 12:10013363-10013385 ATATAAACAAAGAGGAAGAGTGG + Intronic
1093118259 12:15237006-15237028 TTTTAACCACAGAGGAAACTGGG + Intronic
1093986092 12:25535364-25535386 TTAAAAGGAGAGAGGAAGCAGGG + Intronic
1095398404 12:41787431-41787453 TTATAAGCAGAGAAGTAGCAGGG - Intergenic
1095511732 12:42958412-42958434 GCATACACACAGAGGCAGCAAGG - Intergenic
1095524614 12:43110168-43110190 TAATAAACAATGAGGAAGTATGG - Intergenic
1095796195 12:46221447-46221469 TAATAATCACAGAGTCAGCATGG - Intronic
1096811342 12:54172511-54172533 TGAGGAAGACAGAGGAAGCAAGG - Intronic
1097012142 12:55960840-55960862 TTAAAAACACAGAGAAGGCCGGG - Intronic
1097316604 12:58178001-58178023 TAATGAACACAGATGAAGTAGGG - Intergenic
1098353564 12:69588069-69588091 TAGTAAAGACAGAGGAAGTAAGG - Intronic
1099601416 12:84743566-84743588 TTTTAAACACAGAGAATTCAGGG + Intergenic
1099839975 12:87953184-87953206 GCATAAAGCCAGAGGAAGCAGGG - Intergenic
1100541328 12:95560351-95560373 TTTTGAGCACAGAGGAAGAAAGG + Intergenic
1100618439 12:96249587-96249609 TTGTAAACACACAGGAGGCCAGG - Intronic
1102452859 12:113054736-113054758 CAACAAACACAGAGGCAGCATGG + Intergenic
1103870888 12:124090786-124090808 CTATAAAAACAAAGGAAGCCTGG + Intronic
1104258686 12:127162918-127162940 TTCAAAACACAGAGGCAGAATGG - Intergenic
1105748100 13:23395758-23395780 TCAGAAACACTTAGGAAGCAGGG + Intronic
1106259496 13:28053087-28053109 TTAGAAAGACAGAAGAAACATGG + Intronic
1106405099 13:29466353-29466375 GCATAGACACAGAAGAAGCAAGG - Intronic
1106429057 13:29662047-29662069 TAAGAAACACATAGAAAGCAAGG - Intergenic
1106783072 13:33079302-33079324 TTAAAAACACAGAGCAGGCTGGG + Intergenic
1106790608 13:33151959-33151981 CGTTAAACACAGAGGAAACAGGG + Intronic
1107533777 13:41308926-41308948 TTATAAACACTGAGTACCCATGG - Intergenic
1107739715 13:43436789-43436811 ATATAAACACACAGGTATCAGGG + Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108118277 13:47154381-47154403 TTATAGACATAGAGCAAGCAGGG + Intergenic
1108578158 13:51806854-51806876 TCATAAACTCATAGGAAGCTAGG + Intergenic
1111391885 13:87607033-87607055 TTCTATACACAGAATAAGCAAGG + Intergenic
1111625528 13:90779789-90779811 TTATTAACCAAGAGGATGCAGGG + Intergenic
1114629386 14:24149420-24149442 GCAGAACCACAGAGGAAGCAGGG - Exonic
1114717790 14:24845804-24845826 ATATAAACACAAAGGAAGGCAGG + Intronic
1116602844 14:46949130-46949152 TTTTACAGATAGAGGAAGCAAGG + Intronic
1116833778 14:49748406-49748428 TCAGAAAGTCAGAGGAAGCAGGG + Intronic
1117729934 14:58712249-58712271 TTCTTAACAAAGAGGTAGCAAGG - Intergenic
1119767406 14:77199078-77199100 TAAAAAACACAGAGAAAGAAAGG + Intronic
1120105721 14:80491905-80491927 ATATGAACACAGAGGAAGCTGGG - Intronic
1120307216 14:82785969-82785991 TTCTAAAAAGAGAGGAAGCCTGG - Intergenic
1120667527 14:87324461-87324483 TTACACACACAGAGGCATCACGG - Intergenic
1123838240 15:24219119-24219141 TTAAAATCATACAGGAAGCATGG - Intergenic
1124820280 15:33038315-33038337 TTTTAAACACAGAAGATGCAGGG - Intronic
1126499869 15:49333880-49333902 TTATATGCATAGAGGAAGAAGGG + Intronic
1126707084 15:51415728-51415750 TTATAGGCTCAGAGGAAGAAGGG - Intergenic
1126940721 15:53762365-53762387 GTGTAATGACAGAGGAAGCAAGG - Intronic
1128131665 15:65231736-65231758 TTAAAAACACAGGCCAAGCATGG - Intergenic
1130231504 15:82100745-82100767 TTTTAATCACTGAGGAGGCAGGG - Intergenic
1130666184 15:85871883-85871905 ATATGAACACAGAGGATCCAGGG + Intergenic
1131657570 15:94477482-94477504 CTATAAATCCAGAGGAAGGAGGG + Intronic
1131715902 15:95110514-95110536 TTATAAAGAAAGAGGCAGCCGGG - Intergenic
1132290143 15:100694333-100694355 TTACTAACAGAAAGGAAGCAAGG + Intergenic
1134432092 16:14219391-14219413 TTATAAAGCCAAAGGAAACATGG - Intronic
1134612529 16:15621032-15621054 TTAGAAACATAAAAGAAGCAGGG - Intronic
1134806256 16:17127984-17128006 TCATAGATACAGAGGACGCAAGG - Intronic
1135068522 16:19332205-19332227 TTAAAAACAGAAAGGAAGGAAGG + Intergenic
1136231914 16:28890998-28891020 TTAAAAATACATAGGAAGCTGGG + Intronic
1136519842 16:30788139-30788161 TTACAAACACAGAGGAATCCTGG + Intergenic
1138863428 16:60788232-60788254 TTTTAGAGACAGAGGAGGCAGGG + Intergenic
1138967373 16:62100769-62100791 TTATAATCAGACAGAAAGCAGGG - Intergenic
1138971417 16:62148750-62148772 TTAAAGACATAGAGGAATCACGG + Intergenic
1139207617 16:65044516-65044538 TGATAGACACTGAGGAATCAAGG + Intronic
1139482783 16:67239904-67239926 TAATAAACACAGATGAGGAAGGG + Intronic
1139837361 16:69849995-69850017 TTATAAACTAGGAGGAAGGAAGG + Intronic
1140085717 16:71794523-71794545 TGATAAAAACAGAGGAAAAAAGG + Intronic
1140675383 16:77323608-77323630 TTAAAAACACAGAGGAAAGACGG + Intronic
1140822647 16:78677764-78677786 GTATTAAAACAGAGGAAACATGG + Intronic
1142593746 17:1019620-1019642 ATTTAAACACAGAGGAGGGAGGG + Intronic
1143970879 17:10794740-10794762 TGATAAAGACAGAGCAAGGATGG - Intergenic
1145984092 17:29032708-29032730 TTAGAAGGACAGAGGAAGAAAGG - Intronic
1146468668 17:33107434-33107456 TTATGAACAAAAAGGATGCAGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148002355 17:44397330-44397352 TTAGAAACACAGAAGAGGGAGGG + Intronic
1149442863 17:56689972-56689994 ACATAGACACAGAGGAGGCATGG + Intergenic
1149812451 17:59690423-59690445 TTATAAACCCTCAGGAAGGAGGG - Intronic
1150508209 17:65720527-65720549 TGGTAAAGACAGAGGCAGCAAGG + Intronic
1150856905 17:68761745-68761767 TTATAGACACTCAGAAAGCACGG + Intergenic
1151404688 17:73878696-73878718 GGGTAAATACAGAGGAAGCAAGG + Intergenic
1152067837 17:78121301-78121323 TTCAAACCACACAGGAAGCAGGG + Intronic
1152496341 17:80675415-80675437 TAATAAACAGAGAGGAGGGATGG - Intronic
1152928886 17:83100082-83100104 TTATAAAGACAGCGGAGGCTTGG + Intergenic
1153420757 18:4902263-4902285 TTATAAACAAAAAGGAAGAAAGG - Intergenic
1153877487 18:9387099-9387121 TGATAAGCACACAGGAGGCATGG + Intronic
1154276233 18:12963110-12963132 TTATATACAAAAAGAAAGCATGG - Intronic
1155631491 18:27898847-27898869 TTTTAAACACACAGGATACAAGG + Intergenic
1155915182 18:31550653-31550675 TTATAAACAGAGATGAAGAGAGG - Intergenic
1156067631 18:33163985-33164007 CTATAAACCAAGTGGAAGCAGGG - Intronic
1156105222 18:33651276-33651298 TATTAGACACAGAGTAAGCAAGG - Intronic
1156178265 18:34573184-34573206 TTTTAAACACAGAGGAATAAAGG - Intronic
1156588328 18:38457701-38457723 ATATAAACTAAGAGGAAACAGGG - Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1156990506 18:43402265-43402287 TTATAAAGACAGAAAAATCATGG - Intergenic
1157253762 18:46119369-46119391 GTATAAGCACTGGGGAAGCAGGG + Intronic
1157401143 18:47389561-47389583 CTAGAAACACCCAGGAAGCAGGG - Intergenic
1158199893 18:54928434-54928456 TAATAAACACAGAAGCATCAGGG + Intronic
1158310967 18:56157813-56157835 TTAAGAACTCAGAAGAAGCAGGG + Intergenic
1158385702 18:56988701-56988723 TTATAAATTCAGAAGAAGCATGG + Intronic
1158476946 18:57788669-57788691 TGAGAAACACAAGGGAAGCAGGG - Intronic
1158564013 18:58538902-58538924 GTATGGACAGAGAGGAAGCAGGG - Intronic
1158817221 18:61116361-61116383 TTAGAAACACATAGAAAACAAGG + Intergenic
1159395800 18:67854450-67854472 ATATAAACACAGAAGATGAATGG - Intergenic
1159682940 18:71377786-71377808 TAATTAACACAGAGAAAGCATGG - Intergenic
1161041049 19:2110968-2110990 TAATGACCACAGAGGCAGCAGGG + Intronic
1161903108 19:7134468-7134490 TTATAAAAACAGTTGAAGCCCGG + Intronic
1163137388 19:15322412-15322434 TTAAAAACACAAAGAAAGCCAGG + Intronic
1163177735 19:15576247-15576269 TTATGTAGACAGAGGAAGCAAGG + Intergenic
1163814987 19:19459653-19459675 TGATAAACACTGTGGAAGAAGGG + Intronic
1164504082 19:28843802-28843824 ATATAAACACTGATGAACCAGGG + Intergenic
1164945343 19:32288561-32288583 TGGGAAAAACAGAGGAAGCAGGG - Intergenic
1166215596 19:41332407-41332429 TTATTAACACAGTGGGTGCAAGG - Intronic
1166563539 19:43749230-43749252 TGACTAGCACAGAGGAAGCAGGG + Intronic
1168461850 19:56566511-56566533 TTATTAAAAAAGAGGAAGGAGGG - Intergenic
925107513 2:1305504-1305526 TTGTAAACATAGAGGAAGCCTGG + Intronic
925238404 2:2299145-2299167 TAATAAACACAGAGTTGGCAGGG - Intronic
925801287 2:7604532-7604554 TTTTAAACACAGAGAAAGAAGGG + Intergenic
928367376 2:30713237-30713259 TCATAAACACAGACCAAACACGG + Intergenic
929407253 2:41656945-41656967 ATATAAACAGAGTGGATGCAAGG + Intergenic
929622072 2:43365218-43365240 TTAAAAACACAGATGAGGCCAGG - Intronic
929657607 2:43749707-43749729 TTATAAACACCGGCAAAGCACGG - Intronic
930188164 2:48430618-48430640 TTATAAATACTGAGGAGGAAGGG + Intergenic
930944314 2:57053444-57053466 TTATAAACAAAGACTCAGCATGG - Intergenic
933252175 2:80041225-80041247 TTATAATCATAGAGGAAGGTAGG + Intronic
933698900 2:85240292-85240314 TTGTGAACACAGAGGAAGCCGGG + Intronic
934632647 2:95945885-95945907 TTTTAAACAAAGGGGAAGGAGGG + Intronic
934800859 2:97157377-97157399 TTTTAAACAAAGGGGAAGGAGGG - Intronic
935117686 2:100151115-100151137 TGCTAAACATAAAGGAAGCAGGG - Intergenic
935517987 2:104067575-104067597 TTACAATCACGGAGGAAACAAGG + Intergenic
935807536 2:106763644-106763666 TTACAAACAAAGTGGAAGCAGGG - Intergenic
937327087 2:120996482-120996504 TTCTAAACCCAGAAGAAGCCAGG + Intergenic
937551069 2:123092782-123092804 TTAAAAACACTGAGCAAGAAAGG - Intergenic
937828169 2:126390295-126390317 TTCTACACACAGTTGAAGCAGGG - Intergenic
937936748 2:127251753-127251775 TGAAAAACACAAAGGAAACAGGG + Intergenic
938300400 2:130207199-130207221 TCATTAACACAAAGGAAGCACGG - Intergenic
938653765 2:133410237-133410259 TAATAAACATACAGGTAGCAGGG + Intronic
939535373 2:143421388-143421410 TTATAAACAGAGAGGCAGGGAGG + Intronic
939560867 2:143730013-143730035 TTAGAAAAACAGAAGAGGCAAGG + Intronic
939889986 2:147724985-147725007 TAATAATGACAGAGGAAGAAAGG + Intergenic
941296416 2:163744382-163744404 TAATAAACACACTCGAAGCAGGG - Intergenic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
942517499 2:176769208-176769230 ATATAAAGACAGAGGAAGTGGGG + Intergenic
943034231 2:182721065-182721087 TTGTAAACACACAGGTATCAAGG + Intronic
943854595 2:192773091-192773113 TTAAGAATACAGAGGAAACAGGG + Intergenic
945112685 2:206377840-206377862 TTATAAAAGCAGAGCAAACATGG + Intergenic
945194583 2:207226416-207226438 TTATCAACAAGGAGGAAGGAAGG + Intergenic
946125524 2:217559188-217559210 TTATAGACACACAGGATGGAAGG - Intronic
947976326 2:234369365-234369387 TTAAGAAAACAGAGGAAGAAAGG + Intergenic
1169718585 20:8647150-8647172 GTAAAAACATAGAGGAAGAAAGG - Intronic
1170799656 20:19580506-19580528 ATATACAGAGAGAGGAAGCATGG - Intronic
1173847780 20:46198995-46199017 CTATCAACAGAGAGAAAGCACGG - Intronic
1174729801 20:52904755-52904777 TTATAACTACTGAGGAAGAAAGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176512755 21:7760973-7760995 TTAGAAACAGAAAGGAAGAAAGG + Intronic
1177403182 21:20632667-20632689 TTTTAAAAAAAGAGGAAGCAAGG - Intergenic
1177734699 21:25074010-25074032 TTATATAGTAAGAGGAAGCAAGG + Intergenic
1178197156 21:30359093-30359115 TTAAAAAGACAGAGGAGTCAGGG - Intronic
1178646868 21:34391497-34391519 TTAGAAACAGAAAGGAAGAAAGG + Intronic
1178986405 21:37307423-37307445 TAAAAAAGACAGAGGAAGCTAGG + Intergenic
1179406386 21:41129553-41129575 TTAAAAACAGAGAGGAAAAAGGG + Intergenic
1181955326 22:26584097-26584119 TTAAAAACACACACGTAGCATGG + Intronic
950775586 3:15347173-15347195 TGAGAAAAAGAGAGGAAGCAAGG + Intergenic
950975765 3:17242315-17242337 AAATAAACATAGAGGAAGAAAGG - Intronic
951111814 3:18812800-18812822 TTCCAAACAGAGAGGAAGGAAGG - Intergenic
952206885 3:31189207-31189229 TCATAATTACAGAGGAAGCCAGG - Intergenic
952953343 3:38541944-38541966 TGAGAAACAGAGAGGAGGCAAGG + Intronic
952954010 3:38545419-38545441 TTATAAACACAGACTCAGCCAGG - Intergenic
953097118 3:39789029-39789051 TTATTCACACAGCAGAAGCATGG - Intergenic
953123471 3:40069029-40069051 TTAGAAACACAGGGCAAGCCAGG - Intronic
953353602 3:42234700-42234722 TTAGAAAAGCAGAGGAGGCAGGG - Intergenic
953857152 3:46508139-46508161 TGATAAACACAGAGAGAACATGG + Intergenic
955627839 3:60938152-60938174 TGAGAAAAGCAGAGGAAGCAAGG + Intronic
956031701 3:65044549-65044571 TTATGAACCCAGAGGCAGGAAGG - Intergenic
956368827 3:68536013-68536035 GTCTCAAAACAGAGGAAGCAGGG + Intronic
957502055 3:81069775-81069797 TTATAAAAGCAGATGAAGGATGG - Intergenic
957957866 3:87211829-87211851 TTATGAACATAGATGAAGAAAGG - Intergenic
958702339 3:97609300-97609322 ATAGAAACACTGAGGTAGCAAGG - Intronic
960084310 3:113574132-113574154 TTATAAACAAAGAGGTAGAAAGG + Intronic
960254902 3:115501514-115501536 TTGTAAACACTGAAGAACCAAGG + Intergenic
960722971 3:120642754-120642776 TCCTAAACAGCGAGGAAGCAGGG + Intronic
960760201 3:121064749-121064771 TTTTAGACAGAGAGGATGCATGG + Intronic
961115357 3:124324365-124324387 TTAGAAATAGAGAGGAAGAATGG - Intronic
962264810 3:133937316-133937338 TTATAAACACAGAGGAAGCAGGG - Intronic
962392087 3:134981014-134981036 ATATAAGCACAGGGCAAGCAGGG + Intronic
962976145 3:140447689-140447711 TTATAAAACAAAAGGAAGCATGG - Intronic
963577849 3:147084280-147084302 TTATTTACAGAGAGGCAGCAAGG - Intergenic
963868987 3:150393434-150393456 TTATAATTACAGAGGCAGCAAGG + Intergenic
965991437 3:174823734-174823756 TTTTAATCTCAGAGGAAGCCAGG + Intronic
966156566 3:176922821-176922843 TGATAAAGAAAGTGGAAGCAAGG - Intergenic
968074288 3:195808069-195808091 TTGCAAACCCACAGGAAGCACGG + Intronic
968560851 4:1280988-1281010 CTATAAACACAAAAGAAACAGGG + Intergenic
970810918 4:20093174-20093196 ATAGCAACACAAAGGAAGCATGG + Intergenic
970829172 4:20315490-20315512 TTATGAACATAGAGAAAGAAGGG + Intronic
970839036 4:20444948-20444970 TTATAAATACAAAGAAAGTATGG - Intronic
970897418 4:21119922-21119944 TTAGAAACACAGAAGAGGAAAGG + Intronic
970985784 4:22156013-22156035 GTATACACACATAGGAAACAGGG + Intergenic
971017232 4:22500904-22500926 GAATAAACAAAGAGGCAGCAGGG + Intronic
971508359 4:27391732-27391754 TTATATACACAAAGGAATCCAGG - Intergenic
972450314 4:39191327-39191349 ATAACAACCCAGAGGAAGCAAGG - Intronic
973638298 4:52879776-52879798 TGCTGAACACAGAGGAAGCAGGG + Intronic
975139361 4:70903530-70903552 TTCTAAACACAGACTAAACATGG - Intronic
975253076 4:72201863-72201885 TTAAAAACACAAGTGAAGCAGGG + Intergenic
975825399 4:78314556-78314578 TTCTAAACACAGTAGAAACACGG - Intronic
976496781 4:85739333-85739355 TGAGAAACAGAGAGGATGCAAGG - Intronic
980424763 4:132613670-132613692 TTAGAAACACAGAGGGGGAAAGG + Intergenic
981652004 4:147070666-147070688 TTATACAAACAGAGGATGGATGG + Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982216404 4:153086159-153086181 TTACAAAAACAGAGGCAGCCAGG - Intergenic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
984574393 4:181430068-181430090 TTAAAAACACATAGCAAGTAAGG - Intergenic
984923129 4:184783303-184783325 GTATAAGCACAAAGGAAGCTGGG - Intronic
985127110 4:186705622-186705644 TGCTAAACACAGAAGATGCAGGG + Intronic
986548207 5:8923231-8923253 TCATAAACACACAAGAAGCACGG + Intergenic
986828845 5:11552061-11552083 AAATAAAGACAGAGGCAGCAGGG - Intronic
987224813 5:15829473-15829495 TTATAAAAACAAACAAAGCATGG + Intronic
987867007 5:23555186-23555208 TTTTAAAGATAGATGAAGCAAGG - Intergenic
988235781 5:28542185-28542207 TTGTTCACACAGAGGAGGCAAGG + Intergenic
988265938 5:28951228-28951250 TTATAGCCACAGTGGAAGCCTGG - Intergenic
990128068 5:52543506-52543528 TTGTAAAGACAGAGAAAGCCAGG - Intergenic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
992283420 5:75206080-75206102 TTATAAACATATAGTAAGCCAGG + Intronic
992792024 5:80222224-80222246 GAACAAACACAGAGGACGCAGGG + Intronic
993313358 5:86366960-86366982 TTATAAATATAGTGGAAACATGG + Intergenic
993626638 5:90233062-90233084 ATATAAACACAGAGGAATTCAGG + Intergenic
994057804 5:95438932-95438954 TTATATGTATAGAGGAAGCATGG + Intronic
995746501 5:115409381-115409403 GAAGAAACAAAGAGGAAGCAAGG + Intergenic
995750697 5:115450637-115450659 TTTTAAACAGAGGGGAAGAAAGG - Intergenic
995752034 5:115462182-115462204 TTAGTAAGACAGAGGAAGCAAGG + Intergenic
996415780 5:123208744-123208766 TTAGAAACACAGGGGTAACAGGG - Intergenic
996735668 5:126756000-126756022 TTAAAAAGAGAGAGGAACCAGGG - Intergenic
998823613 5:146079217-146079239 TTATGAACATAAAGGATGCATGG - Exonic
999128046 5:149261143-149261165 TTGTAAACATAGAGGACACATGG - Intergenic
999131847 5:149289633-149289655 TTGTAAATTCAGAGGAAGGAAGG + Intronic
999897490 5:156051171-156051193 TTAAAAACAGAGAGAAACCAAGG + Intronic
1000172844 5:158720415-158720437 GAATAAACACAAAGGAAGCTGGG - Intronic
1000716557 5:164651581-164651603 TTATAAACACTGAGAATGCCGGG - Intergenic
1000879007 5:166675090-166675112 CTATACACACAAAGGAATCAAGG - Intergenic
1001209270 5:169795078-169795100 TTAGAAACACAGAGACAGCAGGG - Intronic
1002651194 5:180696503-180696525 TTGTTAACAGATAGGAAGCAAGG - Intergenic
1003183307 6:3810203-3810225 CTATAAACACAGAGCTTGCAAGG - Intergenic
1003289598 6:4768302-4768324 TTTTCAACAAAGAGGAACCAAGG + Intronic
1003648077 6:7932412-7932434 ACATAAACAGAGAGGAAGAAAGG - Intronic
1004507116 6:16255896-16255918 TTTCAAACACATAGGAAGAAAGG + Intronic
1004558000 6:16718492-16718514 TTATACCCACAGAAGAACCAAGG + Intronic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005151300 6:22754333-22754355 TTACAAAAACACAGGCAGCAGGG - Intergenic
1006081322 6:31568850-31568872 TGAGAGACACAGAGGAAGGAAGG - Intergenic
1006795286 6:36728529-36728551 TTATCAGCAGAGAGGAAGGATGG + Intronic
1006884918 6:37373366-37373388 TTATGAACACTGAGGGAGGAGGG + Intronic
1007740745 6:44008170-44008192 TTATAAACAGAGAAGTAGCAGGG + Intergenic
1008448815 6:51625267-51625289 TTAAAAACACAGAGGGAAAAGGG + Intronic
1010528434 6:76934181-76934203 TTATGAAGAAATAGGAAGCATGG + Intergenic
1010536210 6:77034407-77034429 TGATAAACACAGAAATAGCAAGG + Intergenic
1011237231 6:85230847-85230869 TTCTGATCAGAGAGGAAGCAAGG - Intergenic
1011381834 6:86750307-86750329 TTATAAACTCAGTGGGGGCAGGG + Intergenic
1013168450 6:107615225-107615247 ACATAAACACAGAGGAAGGAAGG + Intronic
1014759203 6:125337194-125337216 TTGAAAAAAAAGAGGAAGCAAGG + Intergenic
1014988777 6:128048020-128048042 TTATAAACAGAGAGGTGGGAAGG - Intronic
1015171302 6:130257175-130257197 TTATAAGGACAGAGGAATAAGGG + Intronic
1015570866 6:134619999-134620021 GTCAAAACACAGAGAAAGCACGG + Intergenic
1019913348 7:4115104-4115126 TTAGAAACCCAAAGGAAGGACGG + Intronic
1020018911 7:4850301-4850323 ATATAAGCACAGAAAAAGCATGG + Intronic
1020612000 7:10409596-10409618 TTATTACCAAAGAGAAAGCATGG - Intergenic
1021027007 7:15681659-15681681 TTTGAAACACAGAGGGAGAATGG + Intronic
1021073750 7:16274893-16274915 TCATAAAAACAGAAAAAGCAAGG + Intronic
1021247040 7:18275810-18275832 CTATAAACAAAAACGAAGCATGG - Intronic
1021463055 7:20910847-20910869 TTATAAATACAGAATAATCATGG + Intergenic
1021960489 7:25867652-25867674 TTAAAAGCACAAAGAAAGCAGGG + Intergenic
1022297590 7:29070575-29070597 TTGTAAACACAAAGGAAGAGGGG - Intronic
1022495025 7:30847506-30847528 AAATAAACACTGAGGAAGGAAGG - Intronic
1024915001 7:54488970-54488992 TTTTAAACAAAGAGAAAGGAAGG - Intergenic
1025048566 7:55714300-55714322 AGTTAAACACAGAGGCAGCATGG + Intergenic
1025763649 7:64419338-64419360 ATATAAAGACACAGGAAGCATGG + Intergenic
1026073568 7:67144763-67144785 TTAAAAACAAAGAGGAGGCCAGG - Intronic
1026363760 7:69627131-69627153 ATGTAAATACAGAGGAGGCAAGG + Intronic
1026703317 7:72667417-72667439 TTAAAAACAAAGAGGAGGCCAGG + Intronic
1026875593 7:73877329-73877351 TCAAAAGCACACAGGAAGCATGG - Intergenic
1028399550 7:90409829-90409851 CTATAAACACATTGGGAGCAAGG + Intronic
1028470125 7:91196979-91197001 TTATAAAAACAGAGGTAACAAGG - Intronic
1028972922 7:96878765-96878787 TTATAAAAAGGAAGGAAGCAAGG + Intergenic
1030632521 7:111911455-111911477 TTAAAAAGCCAGAGGAAGAAAGG + Intronic
1030925414 7:115447529-115447551 TTATAAACCCAAAGGAAGCTAGG - Intergenic
1031059657 7:117036621-117036643 TTAAAAAGAGAAAGGAAGCAGGG + Intronic
1031171262 7:118294812-118294834 TGAAAAACATACAGGAAGCATGG + Intergenic
1031986929 7:128169276-128169298 TTAGAAAAAGAGAGGAAGGAGGG - Intergenic
1032626886 7:133601069-133601091 ATATAAACAAAGGGGAAGCTGGG - Intronic
1032759197 7:134922827-134922849 TTAAATACACTGAGGCAGCAAGG + Intronic
1033067533 7:138170503-138170525 TTCCAAACACAAAGGCAGCAGGG + Intergenic
1033881442 7:145888264-145888286 TAACAAACACACAGGAAGGAGGG + Intergenic
1034233246 7:149548873-149548895 TCATAAACACAGAAGGGGCAGGG - Intergenic
1034321286 7:150185103-150185125 TTATCAACTGAGAGGAATCATGG + Intergenic
1034651162 7:152691337-152691359 TTGTAATCTTAGAGGAAGCATGG + Intergenic
1035829180 8:2676152-2676174 TTAAAAACACAGGGGAGGCCAGG - Intergenic
1038452389 8:27648309-27648331 TTAAAAACAAAAAGGAGGCAGGG + Intronic
1039240936 8:35556053-35556075 TTTTACACACGGAGGAACCAAGG - Intronic
1039717356 8:40124074-40124096 TTTTAAAAACATATGAAGCAAGG + Intergenic
1040535698 8:48307687-48307709 TTATAAACAAACAGGAGGCTTGG - Intergenic
1041309764 8:56503798-56503820 TTCAAAACACAGAGGCAACAAGG - Intergenic
1041690708 8:60684265-60684287 TGACATGCACAGAGGAAGCAAGG - Intronic
1041789965 8:61684176-61684198 TTCTAAACAGAGACAAAGCATGG - Exonic
1042120231 8:65479472-65479494 TTAGAAAAACAGAGGAAGTATGG + Intergenic
1043115113 8:76241265-76241287 TTGTAACCACAGATGAAACATGG - Intergenic
1043966303 8:86481619-86481641 TGAAAAACACTGAGGAAGGAAGG + Intronic
1044265096 8:90172685-90172707 TTACTAACAGAGAGAAAGCATGG - Intergenic
1044818535 8:96138414-96138436 CTATAACTACTGAGGAAGCAGGG - Intergenic
1045475891 8:102551941-102551963 TTATAATCACACAGGCAACATGG - Exonic
1045638408 8:104220404-104220426 TTATTAACACAGACAAGGCAGGG + Intronic
1045680315 8:104652423-104652445 TTCTTATCACAGATGAAGCATGG + Intronic
1045832457 8:106480030-106480052 TTAAAAACATAGAGAAATCAGGG - Intronic
1046073904 8:109293767-109293789 CTAGAAACTGAGAGGAAGCAAGG - Intronic
1046476104 8:114745897-114745919 ATAGAAAAACAGAGGAAGGAAGG + Intergenic
1048558969 8:135511852-135511874 TTATAAACACAGAGCAGGGCTGG - Intronic
1049996427 9:1039106-1039128 TTATTAACACACAGGAATCTAGG + Intergenic
1050775639 9:9256813-9256835 TTATAAGCAGAGAGGCAGCTGGG - Intronic
1050845076 9:10206050-10206072 TTAGAAACTCAGAGGTATCAGGG + Intronic
1051172414 9:14332035-14332057 TTAAAAACCAAGAGGAAGCCAGG + Intronic
1051503511 9:17803624-17803646 TTATCAGCCCAGAGGCAGCAGGG + Intergenic
1051732155 9:20155332-20155354 GTATACACATAGAGAAAGCAAGG + Intergenic
1051831040 9:21277084-21277106 TAAGAGACACAAAGGAAGCAAGG - Intergenic
1052318590 9:27143116-27143138 TTATCAACCCACAGGAAGCATGG + Intronic
1052444122 9:28537513-28537535 TTATAAACAGAGAGGAATGCTGG + Intronic
1052874579 9:33545799-33545821 TTATAAAAAGAGAAGCAGCAAGG - Intronic
1052918064 9:33939492-33939514 TTAAAAACACATAGGAATCTGGG - Intronic
1053456626 9:38238084-38238106 CCATATACACAGAGGAATCAGGG - Intergenic
1055881097 9:81004523-81004545 TTAGGAACACAAAGAAAGCAGGG + Intergenic
1056616286 9:88169196-88169218 TGATAAAATCAGAGGAAGGAAGG + Intergenic
1057989507 9:99753445-99753467 TTATAATCACAGATGTAGGATGG - Intergenic
1058105663 9:100968538-100968560 TTGTTAACACTGAGGAGGCAGGG + Intergenic
1058458728 9:105162853-105162875 TTATAACCAGAAAGGAACCAAGG + Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1059837780 9:118176456-118176478 CTATAAATATAGAGAAAGCATGG - Intergenic
1060773884 9:126354708-126354730 ATATAAATACAGAGAAAGAAGGG + Intronic
1061753537 9:132797287-132797309 TAATAAACACGAAGGAAGGAAGG + Intronic
1185851038 X:3488983-3489005 TTAGAAACACAAGGGAAGCTTGG + Intergenic
1187021791 X:15390709-15390731 TTATAAAAACAGAGCATCCAAGG + Intronic
1187077448 X:15949035-15949057 TTATAGCCACTGATGAAGCAGGG + Intergenic
1188417117 X:29949075-29949097 TTAAAATGACTGAGGAAGCAAGG - Intronic
1189266956 X:39724502-39724524 TGAGGAAAACAGAGGAAGCAGGG - Intergenic
1190027125 X:46934729-46934751 TTATAAACATAGAAGAAGGCCGG - Intronic
1190081928 X:47363417-47363439 TTAGAAACACAAAAGAAGCTGGG + Intergenic
1192108596 X:68341382-68341404 CTATAAACATATAGGAAACAGGG + Intronic
1192403273 X:70858619-70858641 TTTTAAACATAGAGGATGCTTGG - Intronic
1193678696 X:84489416-84489438 TTAACAACACAGAGCAAGCGGGG + Intronic
1194222546 X:91213611-91213633 ATATAGAGACAGAGGAAGGAGGG + Intergenic
1194275891 X:91881136-91881158 TTATGAACACATAGCAAGGAGGG + Intronic
1194313049 X:92338818-92338840 TTAGAAATAGAGAAGAAGCAAGG - Intronic
1194862037 X:99011413-99011435 TTGTAAGCACTGAGGAAGCAGGG - Intergenic
1195164654 X:102207256-102207278 TAGTTAACACAGAGGTAGCAAGG + Intergenic
1195194205 X:102479835-102479857 TAGTTAACACAGAGGTAGCAAGG - Intergenic
1197637262 X:128929004-128929026 GAATGAGCACAGAGGAAGCATGG - Intergenic
1197823025 X:130560632-130560654 ATATACACACAGAGAAAGAAAGG - Intergenic
1198401766 X:136275554-136275576 CTCTGAACACAGAGAAAGCAGGG - Intergenic
1198562760 X:137868662-137868684 GGAAAAACACAGAGGAAACAAGG + Intergenic
1199304154 X:146247514-146247536 TTATAAAAAGAAAGGAAGAAAGG + Intergenic
1199378496 X:147140490-147140512 ATATAAACAGAAAGAAAGCAGGG - Intergenic
1199622660 X:149713899-149713921 GGATGAAAACAGAGGAAGCAAGG - Intronic
1199685818 X:150264299-150264321 TTTTTACCACAGAGAAAGCAGGG + Intergenic
1200328011 X:155263234-155263256 GTATGAACACAGAGGAGGAAAGG - Intronic
1200419717 Y:2951800-2951822 ATATAAACAAAGAGGTAGGAGGG + Intronic
1200593138 Y:5102575-5102597 TTATGAACACATAGCAAGGAGGG + Intronic
1200621316 Y:5452932-5452954 TTAGAAATAGAGAAGAAGCAAGG - Intronic
1200712877 Y:6504932-6504954 GTATTAACACAGTGGATGCAGGG + Intergenic