ID: 962265163

View in Genome Browser
Species Human (GRCh38)
Location 3:133939517-133939539
Sequence GTTTGCTAGCAGAACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962265163_962265169 10 Left 962265163 3:133939517-133939539 CCATCACAGTTCTGCTAGCAAAC 0: 1
1: 0
2: 1
3: 12
4: 133
Right 962265169 3:133939550-133939572 CCTTTGCCCAGTCCCCCTGAGGG 0: 1
1: 0
2: 0
3: 22
4: 221
962265163_962265167 9 Left 962265163 3:133939517-133939539 CCATCACAGTTCTGCTAGCAAAC 0: 1
1: 0
2: 1
3: 12
4: 133
Right 962265167 3:133939549-133939571 ACCTTTGCCCAGTCCCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 162
962265163_962265170 14 Left 962265163 3:133939517-133939539 CCATCACAGTTCTGCTAGCAAAC 0: 1
1: 0
2: 1
3: 12
4: 133
Right 962265170 3:133939554-133939576 TGCCCAGTCCCCCTGAGGGATGG 0: 1
1: 0
2: 0
3: 32
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962265163 Original CRISPR GTTTGCTAGCAGAACTGTGA TGG (reversed) Intronic
902559063 1:17265670-17265692 GATTGCGACCTGAACTGTGAGGG + Exonic
904391207 1:30187378-30187400 GTCTGTTAGCAGAATGGTGATGG + Intergenic
905149319 1:35914768-35914790 GTGTGCTTACAGAAATGTGAGGG - Intronic
905387741 1:37615886-37615908 GTTTTTAAGCAGAAGTGTGATGG + Intronic
906762931 1:48394268-48394290 ATTTGCCAGCAGAACTGTTGTGG - Intronic
910853657 1:91672628-91672650 GCCTGTTAGCAGAGCTGTGAAGG + Intergenic
912230919 1:107791318-107791340 GTTTTCTAGGAGAACTGTGCTGG + Intronic
915205062 1:154264122-154264144 GTATGCTAGCTGGACTGGGAGGG - Intronic
916051579 1:161040154-161040176 AGTGGCTAGCAGAACTGAGAAGG + Intronic
916327562 1:163580112-163580134 GTTTGAAAGCAGAACTGGTAAGG - Intergenic
918713681 1:187763261-187763283 GTTTGCCAGGAGAAGTGAGAGGG + Intergenic
920221931 1:204410684-204410706 GTCAGCTATCAGAACAGTGATGG - Exonic
922007051 1:221541762-221541784 CTTTGCTAGCAGGAGTGTGAGGG + Intergenic
923200458 1:231705878-231705900 GTTTGCCAGAAGAAATGAGAGGG + Intronic
923387624 1:233480884-233480906 GTTTGCAAACAGAACTGAGAAGG + Intergenic
924672307 1:246141526-246141548 GTTGGCTACCATAACTGTGAAGG - Intronic
1064172873 10:13049686-13049708 GTTTGGCAGCTGAAATGTGATGG + Intronic
1064718435 10:18202264-18202286 GGTGTCAAGCAGAACTGTGAAGG + Intronic
1066523616 10:36251084-36251106 TTTTGCTATCAGGACTTTGAAGG + Intergenic
1068030447 10:51698805-51698827 TTTGGCTAGAAGACCTGTGAAGG - Exonic
1069009152 10:63351751-63351773 CTTTCCTTGCAGACCTGTGAAGG - Intronic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1076349567 10:129806742-129806764 GTTTGCAAGCAGAATTCAGAGGG - Intergenic
1079313465 11:19387514-19387536 CTTGGCTAGCAAAACTGGGAAGG - Intronic
1081896887 11:46594400-46594422 GTTTCCTAACAGAGCAGTGAGGG + Intergenic
1084172827 11:67408915-67408937 GTTTGGGTGCAGAACTGTGGAGG + Intronic
1085781378 11:79412154-79412176 ACTTGCTAGCAGAGCTGGGAAGG - Intronic
1087472867 11:98600189-98600211 GTTTGCTTGCAGAAAAGTAAAGG - Intergenic
1088608062 11:111550328-111550350 GTTTGCTTCCAGATCTGTTAGGG + Intronic
1088625034 11:111723869-111723891 GTCTGATAGGAGAACTGTAAGGG - Exonic
1089135121 11:116242749-116242771 TTTGGCTTCCAGAACTGTGAGGG + Intergenic
1090311922 11:125748541-125748563 GTTTTTTAGCAGAACTTTCATGG + Intronic
1093918836 12:24836678-24836700 TGTTGCTAGCAAAATTGTGATGG - Intronic
1095215513 12:39542797-39542819 GTTTGGTGGCAGAAATGTAAAGG + Intergenic
1097372074 12:58796440-58796462 GTTTGATGGCAGAAAAGTGAAGG + Intronic
1097588412 12:61542968-61542990 GTTTGCTAGAAGAACTGAAATGG - Intergenic
1099136659 12:78912485-78912507 ATTTCCTAGCAGCTCTGTGAAGG + Intronic
1099531249 12:83784318-83784340 ATTTTCTAGGAGAGCTGTGATGG + Intergenic
1099562779 12:84198734-84198756 GATTGTTGGCAGAAATGTGAGGG - Intergenic
1101179004 12:102190232-102190254 ATATGCAAGCAGAGCTGTGAGGG - Intronic
1102514902 12:113439867-113439889 GCTTCCCAGCAGAGCTGTGAGGG - Intergenic
1108256668 13:48617972-48617994 GTTTTCTTCCAAAACTGTGATGG - Intergenic
1116633001 14:47357453-47357475 ATTTACTAGCAGAACAGGGAGGG + Intronic
1118065566 14:62186880-62186902 GTTGGCTATTAGAATTGTGATGG + Intergenic
1125770467 15:42162143-42162165 GTTTGCTGGCAGAAGGTTGAGGG + Exonic
1128397235 15:67240573-67240595 GTTTGCTACTAGAACTGGGTTGG - Intronic
1133403549 16:5505871-5505893 GTTTGCTGGTAGAAATGTCATGG - Intergenic
1137586238 16:49665402-49665424 GTTTGCTAGGAGAAGTGTGTGGG + Intronic
1141192441 16:81834332-81834354 GGCTGCTGGCAGAATTGTGAGGG + Intronic
1144390576 17:14789906-14789928 GTTCACTAGCAGAACTCTGATGG - Intergenic
1148510616 17:48166154-48166176 AATTGCTAGCAGAGCTGAGAAGG + Intronic
1149138707 17:53402914-53402936 TTTTGCTTTCAGAACTGAGAAGG + Intergenic
1155039706 18:22054727-22054749 GTTTGCAAGCAGAATTTGGAGGG - Intergenic
1155185044 18:23380161-23380183 GTTAGCTAACTGAACTGTGAGGG + Intronic
1158515992 18:58130606-58130628 GTGATCTAGCAGAACTGTGGCGG + Intronic
1158516047 18:58130950-58130972 GTGATCTAGCAGAACTGTGGTGG + Intronic
1158516126 18:58131436-58131458 GTGATCTAGCAGAACTGTGGTGG + Intronic
1158516143 18:58131532-58131554 GTGATCTAGCAGAACTGTGGCGG + Intronic
1158516156 18:58131635-58131657 GTGATCTAGCTGAACTGTGATGG + Intronic
1160306021 18:77737791-77737813 GTTTGTTTGCATCACTGTGATGG + Intergenic
1162395449 19:10415936-10415958 GTTATCTAGCAGGACTGTGTGGG + Intronic
1162576015 19:11499266-11499288 GTGTCCCAGCAGAACTGTGGGGG - Intronic
1165827616 19:38714200-38714222 GTTTGCGAGCAGCAGTGGGAGGG + Intronic
1168699987 19:58432108-58432130 GTTGGCCAGCAAGACTGTGAAGG + Intergenic
928058530 2:28084462-28084484 GTTTGAAAGCAGAACTTGGATGG + Intronic
928744440 2:34395028-34395050 GTTTTCTATCAGAACTGAGCAGG - Intergenic
930460844 2:51673527-51673549 TTTCTCAAGCAGAACTGTGAAGG + Intergenic
932967629 2:76496041-76496063 GTTTGCCAGCAGAGCTGGGGAGG + Intergenic
935245979 2:101219149-101219171 TTTTGCCAGCAGATCTGAGAAGG + Intronic
937398148 2:121556948-121556970 ATTTGGTAGCAGAACTAGGATGG - Intronic
940655999 2:156488788-156488810 GTTTGCTATCAGAATGCTGAAGG + Intronic
941226297 2:162853686-162853708 GTTTTATATCAGAACTGTGGTGG + Intergenic
943066499 2:183092020-183092042 GTTTGCTACCAGACCTCTGCAGG + Intronic
944495107 2:200299279-200299301 GTTTGTTCTGAGAACTGTGAAGG - Intergenic
947000341 2:225448066-225448088 TTTTGCCAGCAGAGCTGAGAAGG - Intronic
949074020 2:242043920-242043942 CTCTGCTAGCAGAACTGGGGCGG + Intergenic
1173511354 20:43631496-43631518 GTTTTCTAGCTTAACTTTGAAGG + Intronic
1174582171 20:51579770-51579792 ATTTGGTAGGAGAACAGTGAGGG - Intergenic
1175591677 20:60197893-60197915 TTTTGGTATCAGAACTGTGCTGG + Intergenic
1175679314 20:60974171-60974193 GTCTCCTAGCAGCACTGTGGAGG - Intergenic
1175851554 20:62096781-62096803 GTCTGCCAGCAGATCTGAGAGGG - Intergenic
1181137665 22:20780212-20780234 GTTTGCTGTGAGAACTGTAAAGG - Intronic
1181720674 22:24772027-24772049 GTTGGCCAACAGAACTGTGTTGG + Intronic
1184904164 22:47468659-47468681 GCTTGCTCTAAGAACTGTGAAGG + Intronic
951172790 3:19561738-19561760 TTTGGCTTCCAGAACTGTGAAGG + Intergenic
953849971 3:46458268-46458290 GTTAACTAGCAGAACTGTAGAGG - Intronic
960146730 3:114211803-114211825 GGTTGCTAGCAGAACAGAGAGGG - Intergenic
962265163 3:133939517-133939539 GTTTGCTAGCAGAACTGTGATGG - Intronic
962428915 3:135301542-135301564 GTTTCCAAGCAAAACTGGGATGG - Intergenic
965005861 3:163021737-163021759 GTTTGATTGCCAAACTGTGAGGG - Intergenic
968056759 3:195697635-195697657 GTTTGGTGGCAGGACTTTGAAGG - Intergenic
969206750 4:5652936-5652958 GTTGGCCTCCAGAACTGTGAGGG - Intronic
972889084 4:43532859-43532881 CTTTTCTAGTAGAAATGTGATGG + Intergenic
974628098 4:64449620-64449642 GTCTGCTTACAGAACTGGGATGG + Intergenic
981693826 4:147539131-147539153 GTTTGCAAGCAGAAGGATGAGGG - Intronic
983380975 4:166993131-166993153 TATTGCAAGCAGAACTGCGAAGG + Intronic
984672077 4:182502086-182502108 ATTTGCTCTCAGAATTGTGAAGG + Intronic
993115457 5:83715023-83715045 GTTTCCTTCCAGAAATGTGAAGG - Intronic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998601178 5:143586842-143586864 GTTTCCTGACAAAACTGTGAGGG - Intergenic
1002164886 5:177337991-177338013 GTTTGAAGGCTGAACTGTGAGGG + Intronic
1004340367 6:14803074-14803096 GTTTGCTAGCACAGGTGTGCAGG - Intergenic
1005598842 6:27406223-27406245 GTTTGACAACAGAACTGGGATGG - Intergenic
1005810086 6:29508738-29508760 CTTTGCTTTCAGAACTGTGAAGG - Intergenic
1013293919 6:108742045-108742067 GTTTCTAAGCAGAACTATGAGGG + Intergenic
1016577303 6:145583998-145584020 GTTTGCTAGCAGGAGTGGGTGGG + Intronic
1020086064 7:5311432-5311454 TTTTGCTAGCAAACCTGGGAAGG + Intronic
1020616750 7:10468013-10468035 ATTTGTTAGCATAACTGAGATGG - Intergenic
1022423223 7:30243923-30243945 GTTTGCATGCAGGAATGTGAAGG - Intergenic
1023826476 7:44013369-44013391 ATTTACTAGCAGAACACTGAGGG + Intergenic
1026090053 7:67292239-67292261 ATTTACTAGCAGAACACTGAGGG + Intergenic
1026666421 7:72343714-72343736 GTTTTTTAGCAGAATTGAGATGG + Intronic
1026746395 7:73016619-73016641 ATTTACTAGCAGAACACTGAGGG - Intergenic
1026750046 7:73044762-73044784 ATTTACTAGCAGAACACTGAGGG - Intergenic
1026753694 7:73072872-73072894 ATTTACTAGCAGAACACTGAGGG - Intergenic
1026757345 7:73100908-73100930 ATTTACTAGCAGAACACTGAGGG - Intergenic
1027032498 7:74901177-74901199 ATTTACTAGCAGAACACTGAGGG - Intergenic
1027090059 7:75292578-75292600 ATTTACTAGCAGAACACTGAGGG + Intergenic
1027093704 7:75320506-75320528 ATTTACTAGCAGAACACTGAGGG + Intergenic
1027097347 7:75348473-75348495 ATTTACTAGCAGAACACTGAGGG + Intergenic
1027119644 7:75507558-75507580 ATTTACTAGCAGAACACTGAGGG + Intergenic
1027272181 7:76528053-76528075 ATTTACTAGCAGAACACTGAGGG - Intergenic
1027322000 7:77019199-77019221 ATTTACTAGCAGAACACTGAGGG - Intergenic
1027325634 7:77047119-77047141 ATTTACTAGCAGAACACTGAGGG - Intergenic
1029398454 7:100325467-100325489 ATTTACTAGCAGAACACTGAGGG + Intergenic
1029717852 7:102342470-102342492 ATTTACTAGCAGAACACTGAGGG - Intergenic
1029754762 7:102566773-102566795 ATTTACTAGCAGAACACTGAGGG + Intronic
1029772712 7:102665853-102665875 ATTTACTAGCAGAACACTGAGGG + Intronic
1033820689 7:145131067-145131089 GTTTGCAAGCTGAACTGTGATGG + Intergenic
1041334139 8:56760726-56760748 TCTGGCTAGCAGAACTGTGAGGG - Intergenic
1046892580 8:119439060-119439082 GTTTGCCTCCAGAACTGTTAGGG + Intergenic
1047467442 8:125131302-125131324 GTTTGCTGGCAGCAGTGTTAAGG + Intronic
1048132446 8:131712644-131712666 GTTTTCTAGCAGTACTGTGTAGG - Intergenic
1053468851 9:38330934-38330956 GCTTGCTAGGAGAACTCTCAGGG + Intergenic
1055192157 9:73538279-73538301 GAAGGCTAGCAGAAGTGTGAAGG + Intergenic
1055993040 9:82128624-82128646 GTTCTCTAGTATAACTGTGAGGG + Intergenic
1186225524 X:7395267-7395289 CTTTGCTAGTAGAAAAGTGAAGG - Intergenic
1187920966 X:24201320-24201342 GTTTGCTTTCACAAATGTGAGGG - Intronic
1189746614 X:44174819-44174841 ATTTGCTAGCAGCCGTGTGAGGG - Intronic
1190989443 X:55530581-55530603 GTTAGCTAGGAGAAGAGTGAGGG + Intergenic
1194696540 X:97059036-97059058 GTTTGACAGCAAAAATGTGAAGG + Intronic
1195536853 X:106018304-106018326 ATTTGCTAGCAGATTTGAGAAGG - Intergenic
1197019634 X:121671140-121671162 GTTTGCTATGAGAACTGACACGG + Intergenic
1197679640 X:129368623-129368645 GTTTGCTATCAGGAAGGTGAGGG - Intergenic
1197819840 X:130531511-130531533 GTTTGCTGGCAGGGCTGAGAGGG - Intergenic
1201931821 Y:19358751-19358773 TTTTGCTATCAGAACTATGCTGG - Intergenic