ID: 962265872

View in Genome Browser
Species Human (GRCh38)
Location 3:133943936-133943958
Sequence CTGTGCAGTTAGTGTAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962265872_962265876 24 Left 962265872 3:133943936-133943958 CCTAGCTTACACTAACTGCACAG 0: 1
1: 0
2: 2
3: 3
4: 104
Right 962265876 3:133943983-133944005 AAGCCTGGCCTGCCTGGCTCTGG 0: 1
1: 0
2: 2
3: 45
4: 405
962265872_962265873 9 Left 962265872 3:133943936-133943958 CCTAGCTTACACTAACTGCACAG 0: 1
1: 0
2: 2
3: 3
4: 104
Right 962265873 3:133943968-133943990 TGCTCAGCAGTTCCTAAGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 155
962265872_962265874 18 Left 962265872 3:133943936-133943958 CCTAGCTTACACTAACTGCACAG 0: 1
1: 0
2: 2
3: 3
4: 104
Right 962265874 3:133943977-133943999 GTTCCTAAGCCTGGCCTGCCTGG 0: 1
1: 0
2: 0
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962265872 Original CRISPR CTGTGCAGTTAGTGTAAGCT AGG (reversed) Intronic
900709834 1:4106855-4106877 CTCTGCTGTTACTGTAGGCTGGG + Intergenic
905598591 1:39230652-39230674 ATGTGCAGTGGGGGTAAGCTGGG + Intronic
905722819 1:40221080-40221102 CAGTGCAGTTAGGGTAATCACGG - Intronic
905876349 1:41434260-41434282 CTGTGCAGTGAGTGGAGGGTGGG - Intergenic
913334850 1:117700045-117700067 TTGTGGAGGTAATGTAAGCTAGG + Intergenic
915196695 1:154194851-154194873 CTGTGGAGTTGGTATATGCTGGG - Intergenic
918427907 1:184428961-184428983 CTGTGCAAGGAATGTAAGCTGGG - Intronic
920362853 1:205431078-205431100 CTGTGCAGTGAAAGTGAGCTGGG - Intronic
920536652 1:206741725-206741747 CTTTGGAGTTACTCTAAGCTGGG + Intergenic
922512424 1:226180246-226180268 CTAAGCAGTTAGTATATGCTAGG - Intronic
1065981167 10:30899080-30899102 ATGTGAAGTTAATGTAAGTTTGG - Intronic
1069633180 10:69910046-69910068 CTGTGCAGTTAGCTTAGCCTGGG - Intronic
1072096764 10:92189564-92189586 CTTTGCAGTCAGTGAAACCTGGG - Intronic
1074140707 10:110669778-110669800 CTGTCCAGTTAGTAAAAGGTAGG + Intronic
1075652315 10:124136010-124136032 TTGTGAAGCTAGTGTAACCTTGG + Intergenic
1077730294 11:4722910-4722932 CTATGCAGGTGGTCTAAGCTCGG - Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1082124555 11:48416434-48416456 TTGTGCAGTCAGTGGAGGCTTGG + Intergenic
1082558217 11:54587676-54587698 TTGTGCAGTCAGTGGAGGCTTGG + Intergenic
1082804254 11:57437440-57437462 ATGTGCATTTTGTGGAAGCTTGG - Intergenic
1082846003 11:57726086-57726108 ATGTGGAGCTACTGTAAGCTTGG - Intronic
1089452820 11:118609308-118609330 CTGGGCTGTGTGTGTAAGCTGGG - Intronic
1092529945 12:9335808-9335830 CTGTTGAGTTAGTGTCAGCATGG + Intergenic
1095830408 12:46579773-46579795 CTGTGAGGTTAGTGCAAGCCTGG - Intergenic
1097330288 12:58325471-58325493 CTGTGCAGATAGCTTGAGCTAGG + Intergenic
1105593540 13:21815575-21815597 CTGAGCAGGGAGTGAAAGCTAGG + Intergenic
1105614230 13:21998104-21998126 CAGTGCTGTTAGTGTGAGTTGGG - Intergenic
1105885866 13:24640520-24640542 GTGTTGAGTTACTGTAAGCTTGG + Intergenic
1111491353 13:88979969-88979991 GTGTGCAGTTCTTCTAAGCTTGG - Intergenic
1113502949 13:110792938-110792960 CTGTGAAGTTGGTGGGAGCTGGG + Intergenic
1117394689 14:55297501-55297523 CTGTGCACTTACTATATGCTAGG - Intronic
1119927990 14:78515212-78515234 CTGTGCAGGAAGAGTATGCTAGG + Intronic
1125450233 15:39800144-39800166 ATGGAGAGTTAGTGTAAGCTGGG - Intronic
1125450625 15:39803171-39803193 CTGTGCAGTCAGTTAATGCTGGG + Intronic
1125881838 15:43202083-43202105 CTGTGAAGTTTGAGTCAGCTTGG - Intronic
1127066047 15:55239903-55239925 CAGTCCAGTTAGTGAAAGCCTGG + Intronic
1129207566 15:74046039-74046061 CTGTGCAGTGAGTGTGGCCTAGG + Exonic
1131980427 15:97989329-97989351 CTGTGAAGTCAGTGAAAGATGGG - Intergenic
1132593310 16:736034-736056 CTGTGCACTTTCTCTAAGCTGGG - Intronic
1139067481 16:63336137-63336159 CTGTGCATTTAATGTAAGTGTGG - Intergenic
1139477271 16:67208951-67208973 CTGTGCTGGTAGTGAAAGTTGGG + Intronic
1151460586 17:74252004-74252026 CTGAGCACTTACTGTGAGCTGGG - Intronic
1153610695 18:6881326-6881348 TGGAGCAGTTAGTGTCAGCTGGG + Intronic
1154315268 18:13299105-13299127 CTGCCCAGTTAGTGTGAGATCGG + Intronic
1157904360 18:51555142-51555164 CTGTGCAGTGAGCGGCAGCTTGG + Intergenic
1158026039 18:52898560-52898582 CTATGCAGTGTGTGTATGCTTGG + Intronic
1158277719 18:55786692-55786714 CTCTGCAGTAAGTGTAACTTGGG - Intergenic
1162571740 19:11478424-11478446 CTGTGCACTTACTGCAGGCTGGG - Intronic
1165181226 19:33972753-33972775 CAGTGCAGTAAGGGTAAGCATGG - Intergenic
934605828 2:95694498-95694520 CAGTGCAGGAAGTGTAAGGTAGG + Intergenic
935346734 2:102115177-102115199 CTGTGCAGTTAGTGTAATGTGGG + Intronic
938400788 2:130989659-130989681 CTGTGCATTTAGTCATAGCTGGG + Intronic
940392212 2:153145676-153145698 CAGTGCAGTTACTCTAAACTTGG + Intergenic
947859642 2:233349356-233349378 CTGAGCAGAAAGTGGAAGCTTGG + Intergenic
1169421685 20:5465585-5465607 CTGGGCTGGTAGTGCAAGCTGGG + Intergenic
1169974499 20:11308576-11308598 TTGTGCATATAGTGTAAGATAGG - Intergenic
1173903462 20:46607932-46607954 CTGTGCACTTAGTTTATGCGCGG - Intronic
1178662550 21:34519711-34519733 CTTTGCAGTTCGGGTAAGCGAGG + Intronic
1181020008 22:20094848-20094870 CTGCCCTGTTAGTGTGAGCTGGG + Intronic
953160033 3:40410388-40410410 CAGTGCAGTTGGTGTGATCTCGG - Intronic
955784292 3:62520300-62520322 CTGAACATTTAGTGTATGCTTGG + Intronic
958900698 3:99882772-99882794 TTTTGCAGTTAGTATAAGCTAGG - Intronic
960259272 3:115547122-115547144 CTGAGCATTTACTGTATGCTGGG + Intergenic
961224577 3:125230085-125230107 CTGAGCATTTAGGGTGAGCTTGG - Exonic
961870531 3:129984481-129984503 CTGTGCAGTTAGTATAACCTGGG + Intergenic
962265872 3:133943936-133943958 CTGTGCAGTTAGTGTAAGCTAGG - Intronic
964971360 3:162567195-162567217 CTGTTAATTTAGTGTATGCTTGG - Intergenic
965189651 3:165511844-165511866 CTCTGCTCTAAGTGTAAGCTGGG - Intergenic
966267183 3:178060606-178060628 TTGGGCAATCAGTGTAAGCTTGG - Intergenic
967808260 3:193734061-193734083 CTGTGTGGTTAGTGTCTGCTTGG - Intergenic
969990488 4:11257378-11257400 CTTTGCAGTCAGGGAAAGCTGGG + Intergenic
970036921 4:11746701-11746723 CTGTGCAGTTACTGAAACATCGG - Intergenic
982890325 4:160840652-160840674 TTGTGAAGTTATTGTAAGATGGG - Intergenic
983842517 4:172474489-172474511 CTGTACAGTTAGTATATGCCAGG - Intronic
986098856 5:4586782-4586804 TTGTGCAGATAGGGTGAGCTGGG + Intergenic
990699737 5:58461203-58461225 CTGTGCAGTTTGACTAATCTAGG + Intergenic
998078832 5:139258088-139258110 CTGGGCAGTAACTGTAAGCCTGG - Intronic
998887147 5:146706377-146706399 CTATGCAGGTGGTGTGAGCTTGG - Intronic
999149152 5:149415255-149415277 CTCTGCAGTCAGTGTGAGGTGGG - Intergenic
1000360566 5:160442912-160442934 CTGTGCTGGCTGTGTAAGCTAGG - Intergenic
1002596570 5:180327634-180327656 CTGTGCACTTACTGTGTGCTGGG - Intronic
1011449124 6:87473748-87473770 CTGAGCAGTGTGTGTAAGTTGGG + Intronic
1011731026 6:90263774-90263796 ATGGGCAGTTAGTGTAAACATGG - Intronic
1015696468 6:135985718-135985740 CTGTTCAGTTAGTTCAAGCCTGG + Intronic
1015841375 6:137480690-137480712 CAGTGAAGTGAGAGTAAGCTGGG + Intergenic
1016439911 6:144072295-144072317 AAGTGCACTTAGAGTAAGCTTGG + Intergenic
1018434047 6:163745102-163745124 CTGAGCAGTTGGTGGAGGCTCGG + Intergenic
1019979132 7:4608096-4608118 CTCTGCAATTAGTGTGATCTTGG + Intergenic
1020260732 7:6529486-6529508 CTGTGCAGTTGGTGACAGCCTGG - Intronic
1020756227 7:12207188-12207210 CTGTGGAGATATTGGAAGCTAGG - Intergenic
1032354894 7:131201825-131201847 CTGAGCAGTTACTATATGCTTGG + Intronic
1035559764 8:595487-595509 CTGAGCAGTTAGTGGAACCCAGG + Intergenic
1038245024 8:25847390-25847412 CTGTGCATTAAATGTCAGCTTGG + Intronic
1041561844 8:59226774-59226796 CTGTGCTGTGAGTCTAAGCCAGG - Intergenic
1043582258 8:81727695-81727717 CTGTGCAATGAGAGTATGCTTGG + Intronic
1043590355 8:81825081-81825103 CTGTGCACTTCTTGTAATCTAGG + Intronic
1044817941 8:96132006-96132028 CTGGGCAGTAAGTATAAACTGGG + Intergenic
1045246301 8:100444401-100444423 CTGTGCAGTCAAGGGAAGCTAGG - Intergenic
1046843284 8:118885442-118885464 CTGGGCAGTAAGAGTATGCTAGG - Intergenic
1047227681 8:122970538-122970560 CTGTGGAGTTGGAGAAAGCTGGG - Intronic
1053300036 9:36942370-36942392 CTGTGAAGCAAGTGTAAGCCAGG - Intronic
1056016367 9:82392480-82392502 CTGGGCACTTAGTGTATGCCAGG + Intergenic
1059217558 9:112580138-112580160 CTATGTAGTTTGTGTAGGCTTGG - Intronic
1061663580 9:132147261-132147283 CTGTGCAGTTAGTTTGTGCCGGG - Intergenic
1188869659 X:35358864-35358886 CTGTGCTGTGAGTGCAAGCTGGG + Intergenic
1190244390 X:48681637-48681659 CTGAGCAGTCAGTGTGTGCTAGG - Intronic
1191220798 X:57985935-57985957 CTATGCAGGTAGTCTGAGCTCGG + Intergenic
1193497182 X:82229773-82229795 CTGGGCAGTTAGTGTGATTTTGG + Intergenic
1193960138 X:87914813-87914835 CTATGCAGTTAGTGTAAGGGTGG - Intergenic
1201633418 Y:16095440-16095462 TTGTGCAGTAATTCTAAGCTGGG + Intergenic