ID: 962267653

View in Genome Browser
Species Human (GRCh38)
Location 3:133955150-133955172
Sequence CCGAGCTCTGCCAGAAGCAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962267653_962267659 20 Left 962267653 3:133955150-133955172 CCAATGCTTCTGGCAGAGCTCGG 0: 1
1: 0
2: 1
3: 12
4: 85
Right 962267659 3:133955193-133955215 CCTGCAACGAGAGTGCTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962267653 Original CRISPR CCGAGCTCTGCCAGAAGCAT TGG (reversed) Exonic
900345193 1:2207186-2207208 CCCAGCTCTGCCAGCAGACTGGG - Intronic
900804260 1:4756987-4757009 CCCGGCTCTGCCACAGGCATGGG - Intronic
900931300 1:5739605-5739627 CCCAGCTCTGCCAGCAGCTGGGG + Intergenic
902283942 1:15394235-15394257 CCCAGGGCTGCCAGAAGCATGGG - Intronic
902872543 1:19323207-19323229 CCCATCTCAGCCAGAAGCAGTGG - Intronic
903187492 1:21637003-21637025 CCGAGCTCTGCATCAAGCAAAGG + Intronic
904327389 1:29736154-29736176 CCCAGCTCTGCCTGAAGCCAAGG + Intergenic
906124547 1:43419687-43419709 CCTAGCTCTGACAGAGGCATAGG - Intronic
914320534 1:146555297-146555319 CCCAGCTCTGCCACAACCTTGGG - Intergenic
916581193 1:166110756-166110778 CAGAGCTCTGCCAGATGCTCTGG - Intronic
918390174 1:184051697-184051719 CCGCGCCCGGCCAGAAGCAGCGG - Exonic
924209247 1:241747992-241748014 ACGAGCTCTGTGAGGAGCATGGG - Intronic
1075791192 10:125085535-125085557 CCCAGCTCTGCCTGGAGCCTGGG - Intronic
1076979627 11:197620-197642 CAGTTCTCTGCCAGGAGCATGGG - Exonic
1078180399 11:9005543-9005565 CTGAGGTCTGGAAGAAGCATAGG - Intergenic
1079130093 11:17742257-17742279 CTGGCCTCTGCCAGAAGCTTTGG + Intronic
1079307958 11:19340902-19340924 CCAAGTGCTGCTAGAAGCATGGG - Intergenic
1080459255 11:32439050-32439072 CCGCGCTCTGTCAGATGCAGTGG - Intergenic
1085508689 11:77074445-77074467 CCGAGCAGGGCCAGAAGGATAGG - Intronic
1086200188 11:84193204-84193226 CCGAACTCTGGCAGGAGCTTAGG + Intronic
1089352738 11:117830695-117830717 CCTAGGTCTGCCTGCAGCATGGG - Intronic
1090892438 11:130936930-130936952 CTGAGCCCTGACAGAAGGATGGG - Intergenic
1096524723 12:52203683-52203705 CCCAGCTCTGCCAGAGACAGAGG - Intergenic
1100074144 12:90757838-90757860 CTGAGCTCTGGCAAAAGAATGGG + Intergenic
1102611377 12:114115384-114115406 CTTAGCTCTGTCAGAAGCCTGGG - Intergenic
1104017604 12:124971233-124971255 CCCAGCTCTGTCAGAGGCTTGGG - Intronic
1116447419 14:45026709-45026731 CCCAGCTCTGCCAGGTGCAGTGG + Intronic
1117653429 14:57929857-57929879 CTGAGCTCTCACAGAAGCTTTGG + Intronic
1118321168 14:64754141-64754163 CAGAGCTTTGCCAGCAGCATTGG - Intronic
1119902594 14:78274008-78274030 CAGAGCTCTTCCAGAGGCATGGG + Intronic
1122030323 14:98907354-98907376 CCCAGCCCTGCCGGCAGCATGGG + Intergenic
1122137628 14:99644147-99644169 CCCAGCTCTGCCAGGAGCATGGG + Intergenic
1127915278 15:63450259-63450281 CCAATCTCTGCAAGATGCATTGG + Intergenic
1128827835 15:70736914-70736936 CCAAGCCCTGCCATAAGCAAAGG - Intronic
1130234487 15:82121565-82121587 CACAGCTCTGGCAGCAGCATGGG + Intergenic
1137781398 16:51100641-51100663 CTGACCTCGGCCAAAAGCATTGG + Intergenic
1139551188 16:67673986-67674008 CCCAGCTCTGCCAGAGGCGGCGG - Intergenic
1140013000 16:71154809-71154831 CCCAGCTCTGCCACAACCTTGGG + Intronic
1140092094 16:71846624-71846646 CCGGGCTCTGCTAGCAGCGTTGG + Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1145077317 17:19867130-19867152 CGGAGCGCTGCCAGAGGCTTGGG + Intronic
1145853814 17:28132823-28132845 CTGAGCTCTGCCAGACACACAGG - Intronic
1146533431 17:33629778-33629800 CCCAGTTCTGCCAGAAGCTCTGG + Intronic
1152637821 17:81437371-81437393 CAGAGCTCTGCCAGTGGCCTGGG + Intronic
1158960622 18:62584916-62584938 CTGGGCTCTGCCAGAAGCACTGG - Intronic
1162332675 19:10039734-10039756 CCCAGCTCTGCCAGAAGACCAGG + Intergenic
1162534502 19:11254793-11254815 CTGAGCTCAGCCAGAGGAATTGG - Intronic
1164246988 19:23439378-23439400 CAGATCTCAGCCACAAGCATTGG - Intergenic
1164304905 19:23997513-23997535 CCCATCTCAGCCAGAAGCATTGG - Intergenic
925392410 2:3505515-3505537 CCTCCCTCTGCCAGAAGCACAGG - Intronic
927726947 2:25432895-25432917 CGCAGCTCTGCCAGCAGCGTGGG + Exonic
938415874 2:131103280-131103302 CCGAGCTCATCCAGAAGCAGCGG + Intergenic
939065940 2:137483473-137483495 CTGGGCTCTGCCAGGAGCAATGG + Intronic
939801866 2:146720685-146720707 CCAAGGACTGCCAGAAGCCTGGG + Intergenic
941356326 2:164497210-164497232 CAGAGCTCTGCCACAAACATGGG - Exonic
941902394 2:170691003-170691025 GCGAGCCTTGCCAGAATCATAGG + Intergenic
946287393 2:218714523-218714545 CCCAACTCTGCCAGAAGAAAAGG - Intronic
946334333 2:219027468-219027490 CCGAGCTAGGCCAGGAGCTTTGG + Intronic
947286625 2:228523821-228523843 CCGTCCTCTGTCAGATGCATAGG - Intergenic
1168975851 20:1965391-1965413 CCCAGCTCTGCCTGAAGCTCTGG - Intergenic
1169219806 20:3815440-3815462 CCCAGCTCTGCCACAAGCCCTGG + Intergenic
1170734205 20:18999833-18999855 CCCAGCTTTGCCAGCAGCAATGG + Intergenic
1175345338 20:58268944-58268966 CCAAGCTCGGCCACAAGCAGTGG + Intergenic
1178018670 21:28382919-28382941 AATAGCTCTGCCAGAAGCAATGG - Intergenic
1185154621 22:49185801-49185823 CAGAGCTCTCCCAGAGGCAAAGG + Intergenic
950662721 3:14476707-14476729 CCGAGCCCTGCCAGACACATTGG - Intronic
961864027 3:129940518-129940540 CAGAGCTCTGCCACAGGCAGAGG - Intergenic
962267653 3:133955150-133955172 CCGAGCTCTGCCAGAAGCATTGG - Exonic
963625382 3:147665362-147665384 GGGAGCCCTGCCAGAAGCTTGGG + Intergenic
972187118 4:36542849-36542871 CCAAGCTCTCCAAGAAGCTTCGG + Intergenic
982459655 4:155652824-155652846 CCAAGCATTGCCAGCAGCATCGG + Intergenic
984226129 4:177036989-177037011 CCTGGCTCTCCCAGAAGAATAGG - Intergenic
986256175 5:6102762-6102784 CACAGCTGTGCCAGAAGCATGGG + Intergenic
988821801 5:34894008-34894030 CCCAGCTCTGTCAAAAGTATGGG + Intronic
991177186 5:63702962-63702984 TTGAACTCTGCCTGAAGCATAGG - Intergenic
1001152203 5:169241805-169241827 CCTAACTCAGCCAGAGGCATAGG + Intronic
1002597846 5:180335657-180335679 CAGAGCTCTGCCAGTGGCCTGGG - Intronic
1002823800 6:754612-754634 CTGAGCTCTGCCTGATGTATGGG + Intergenic
1004549895 6:16636522-16636544 CCCTGCTCTGCCTGATGCATGGG + Intronic
1006377238 6:33678338-33678360 CTGAGCTCTGACAGGAGCAGGGG - Intronic
1018675817 6:166221496-166221518 CCCAGCTTTGCCTGACGCATGGG + Intergenic
1019800851 7:3087329-3087351 CCGAGTTTTGCCAGAAGCTCAGG + Intergenic
1020281606 7:6652985-6653007 CCGAGCTCTGGCTGAAGCTGCGG - Exonic
1020281881 7:6654023-6654045 CCGCGCTCTGCCCGAAGCGCCGG - Exonic
1020281939 7:6654359-6654381 GCGAGCTCTGCGAGAAGCGGCGG - Exonic
1022747305 7:33185335-33185357 CATAGCTTTGTCAGAAGCATCGG - Intronic
1029214915 7:98940795-98940817 CTGTGCTCTGCCAGAGGCAGTGG + Intronic
1032182179 7:129689767-129689789 CCAAGCCCTACCAGAAGCAAGGG + Intronic
1033411285 7:141119886-141119908 CAGAGCTCTGCCATCACCATGGG + Intronic
1037478280 8:19278845-19278867 CCAAGCTCTGCCCAAAGCAGAGG - Intergenic
1049320219 8:141992255-141992277 CCTAGCTATCCCAGAAGCATGGG - Intergenic
1050302578 9:4274512-4274534 CCCATCCCTGCCAGAAGCAGAGG + Intronic
1050365159 9:4867394-4867416 CCTAGCTGTGTCAGTAGCATTGG + Intronic
1057070892 9:92099147-92099169 CTGAACTCTGCCAGAAGAAAGGG + Intronic
1059066587 9:111091992-111092014 CCCTGCTCTGCCAGAGGCAATGG + Intergenic
1060668452 9:125447633-125447655 CTGGGCTCTGCCAGGAGCATGGG + Intronic
1189633021 X:42975131-42975153 CCTAGCTCCTCCAGATGCATAGG - Intergenic
1190319843 X:49173550-49173572 ACGATTTCTGCCAGAAGCAAAGG - Intronic
1193886691 X:86991105-86991127 CCCAGCTCTTCGGGAAGCATAGG - Intergenic