ID: 962268837

View in Genome Browser
Species Human (GRCh38)
Location 3:133963254-133963276
Sequence CAGATCTACCCCATCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962268837_962268843 -10 Left 962268837 3:133963254-133963276 CCTCCAGAGATGGGGTAGATCTG 0: 1
1: 0
2: 1
3: 7
4: 121
Right 962268843 3:133963267-133963289 GGTAGATCTGGGGCAGGCCAAGG 0: 1
1: 0
2: 2
3: 29
4: 290
962268837_962268844 4 Left 962268837 3:133963254-133963276 CCTCCAGAGATGGGGTAGATCTG 0: 1
1: 0
2: 1
3: 7
4: 121
Right 962268844 3:133963281-133963303 AGGCCAAGGTCTAGCCATGCCGG 0: 1
1: 0
2: 0
3: 14
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962268837 Original CRISPR CAGATCTACCCCATCTCTGG AGG (reversed) Intronic
901852920 1:12027502-12027524 CGGTTCTCCCCCATCTCTGTTGG + Intronic
904803348 1:33113137-33113159 CATCTCTACCCCATCTCTCCAGG - Intronic
907531809 1:55106842-55106864 CATATGTACCCCACCACTGGAGG + Intronic
910025511 1:82646462-82646484 CAGATCTTTCCCAGCTCTTGAGG + Intergenic
912067310 1:105759440-105759462 CAGATCTACCCTTAATCTGGTGG + Intergenic
915936997 1:160095466-160095488 CAGATGCATCCCATTTCTGGCGG + Intronic
919607656 1:199705808-199705830 CAGATCTACCCCATCATAGCTGG - Intergenic
924359239 1:243218500-243218522 CAGAACAACCTCATTTCTGGTGG + Intronic
1062977658 10:1697433-1697455 CAAACCTGCCCCATCACTGGAGG + Intronic
1063623396 10:7667718-7667740 CAGAGCTAGCCCAGCACTGGGGG - Intergenic
1066072328 10:31831327-31831349 CATATATATCCTATCTCTGGAGG + Intronic
1069356342 10:67590391-67590413 CAGATCAATTCCATTTCTGGTGG - Intronic
1069803453 10:71099536-71099558 CAGATCTACCCTTCATCTGGTGG + Intergenic
1074761681 10:116671098-116671120 CCTCTCTACCCCATCTCAGGTGG - Intergenic
1079308046 11:19341937-19341959 CAGATATTCCCCAGCTCTGAAGG + Intergenic
1082490876 11:53532126-53532148 CAGATGTACCCCAACCCTGCAGG - Intergenic
1083533529 11:63447492-63447514 CAGATCTTCCCCTTCTCTACAGG - Intergenic
1085320392 11:75570502-75570524 TCAATCTACCCCATATCTGGGGG - Intronic
1085435209 11:76493592-76493614 CAGATCTTCCCCACGTCTGTTGG - Intronic
1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG + Intronic
1089864055 11:121616489-121616511 CAGAGACACCCCATCCCTGGCGG + Intronic
1091411555 12:243678-243700 AAGATCTGCCCCATCTTTGAGGG - Exonic
1092040743 12:5381970-5381992 CAGATCTACCCTTAATCTGGTGG - Intergenic
1092697880 12:11193535-11193557 CAGATCTTCATCATCTCTTGGGG + Intergenic
1093036657 12:14338164-14338186 CAGATCTACCCTTAATCTGGTGG + Intergenic
1097284115 12:57864694-57864716 CAGATCTACCTCGTTTGTGGTGG + Intergenic
1100765056 12:97854785-97854807 CAGATCTACCCCATCTAATAGGG + Intergenic
1104112156 12:125714304-125714326 CAGATCTAAGCCATATCAGGCGG - Intergenic
1105006379 12:132723436-132723458 CAGCGCTGCCCCATCCCTGGAGG - Intergenic
1111760974 13:92463448-92463470 CAGATCTCTCCCATTTCTGAAGG + Intronic
1116951317 14:50881265-50881287 CAGATCTCCACCATCTTGGGAGG + Intronic
1119320163 14:73725866-73725888 GAGAGCTACCCCAGCTTTGGTGG + Intronic
1121312763 14:92944129-92944151 CAGAGCCAGCCCCTCTCTGGAGG + Intronic
1123150027 14:106171601-106171623 CAGATCTACACCTTGTCAGGAGG + Intergenic
1123474796 15:20582059-20582081 CCGCTCAACCCCATCTCTGTAGG - Intergenic
1123643215 15:22418298-22418320 CCGCTCAACCCCATCTCTGTAGG + Intergenic
1124223445 15:27869642-27869664 CAGCTGAACCCCACCTCTGGGGG - Intronic
1124438997 15:29673892-29673914 CAGATCTACCATTTCTCTGAAGG + Intergenic
1124853760 15:33366925-33366947 AAGAGCTACTCCATCTCTAGGGG + Intronic
1125092914 15:35815678-35815700 CAGATGTACTGCATCTCTGGAGG + Intergenic
1126214856 15:46143372-46143394 CAGACATACCCAATCTCTTGAGG + Intergenic
1127292362 15:57581915-57581937 AAGATCTACCCCAGCTGCGGGGG - Intergenic
1131519567 15:93103296-93103318 AGGATCTACCCAATGTCTGGAGG + Intergenic
1133239769 16:4407569-4407591 CAGTTCCACCCCACCTCTGACGG - Exonic
1134451795 16:14368288-14368310 CAGCTCTTCCCCAGGTCTGGGGG - Intergenic
1139448203 16:67011594-67011616 CAGAGCTGCCACATCTCTGGTGG - Intergenic
1140044781 16:71433075-71433097 CAGATCTACCCAGGCCCTGGAGG + Intergenic
1144849176 17:18235467-18235489 CAGAGCTGGCCCATCACTGGGGG + Exonic
1145760472 17:27422692-27422714 CTGGTTTACCCCATCTCTGCTGG - Intergenic
1146569614 17:33941312-33941334 CAGATCTGCCCCATCCCAGTGGG + Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1147994919 17:44355075-44355097 CAGCTCCACCTCATCTGTGGGGG - Exonic
1148793658 17:50187163-50187185 CCGAACAACCCCAGCTCTGGAGG + Intronic
1151161272 17:72167797-72167819 CAGGTCTTCCCTGTCTCTGGAGG + Intergenic
1152300896 17:79494970-79494992 CAAGTCTGCCCCATCTTTGGGGG + Intronic
1152558419 17:81066113-81066135 CAGCCCTTTCCCATCTCTGGAGG + Intronic
1155691971 18:28635620-28635642 CAGAACTAGCCCATCACTGGTGG + Intergenic
1157271977 18:46283170-46283192 CACATCTCCCCCGTCTCTTGGGG - Intergenic
1159960530 18:74552064-74552086 CAGATCCAGCCCAGCTCTGTGGG - Intronic
1163444654 19:17339357-17339379 AGGTTCTACCCCATGTCTGGAGG - Intronic
1163697324 19:18770437-18770459 CAGGTCTGGCCCACCTCTGGGGG - Intronic
1168369348 19:55819201-55819223 CAATTCTACCCCACCTCTGCAGG + Intronic
928173952 2:29021813-29021835 CAAACCTGCCCCATCTGTGGTGG - Intronic
929897735 2:45976336-45976358 GAGAGCTACTCCATCCCTGGGGG - Intronic
932877175 2:75464993-75465015 CAGATCTACCTCTTCCCTGTAGG - Intergenic
933450628 2:82445683-82445705 CAGTTCTTTCCCATCTCTTGAGG - Intergenic
941576116 2:167232418-167232440 TAAATCTACACCTTCTCTGGTGG + Intronic
945642499 2:212446321-212446343 CAGATCTACCCTTAATCTGGTGG + Intronic
946332726 2:219019357-219019379 CAGTTCTCGCCCATCCCTGGAGG - Intronic
947543396 2:230993822-230993844 CACTCCTACCCCATCTCTAGGGG + Intergenic
1172582964 20:36063295-36063317 CAAACCTGCCCCATCTCCGGGGG - Intergenic
1174378507 20:50141722-50141744 CAGGTCTCTCCCATCCCTGGGGG + Intronic
1176266315 20:64211331-64211353 CAGAGCTACTCACTCTCTGGGGG - Exonic
1176611830 21:8990907-8990929 CAACTCTCCCCCAGCTCTGGGGG + Intergenic
1178796654 21:35751207-35751229 CAGCTCAACCCCATCTCCAGAGG - Intronic
1180352920 22:11818871-11818893 CAGCTCACCCCCAGCTCTGGGGG + Intergenic
1180385320 22:12173486-12173508 CAGCTCACCCCCAGCTCTGGGGG - Intergenic
951559005 3:23946843-23946865 CAGATCTACCTCATCATTTGGGG - Intronic
959803407 3:110523074-110523096 CAGAGTTACCCCATCACTGGAGG + Intergenic
960691699 3:120352807-120352829 CAGATGAACCCCATCACTGTGGG - Intergenic
962003086 3:131320497-131320519 CTCCTCTTCCCCATCTCTGGAGG - Intronic
962268837 3:133963254-133963276 CAGATCTACCCCATCTCTGGAGG - Intronic
962652261 3:137508801-137508823 CAGAGGCACCCCATCTTTGGAGG + Intergenic
966487845 3:180491066-180491088 AAGATCAACAGCATCTCTGGTGG - Intergenic
967832106 3:193928473-193928495 CAGATCTACCCTTAATCTGGTGG + Intergenic
972466609 4:39363345-39363367 CACATATTTCCCATCTCTGGAGG + Intronic
973027246 4:45288150-45288172 CAGATCTACCCTTAATCTGGTGG + Intergenic
974255770 4:59452543-59452565 CAGATCTACCCTTAATCTGGTGG + Intergenic
975029805 4:69600982-69601004 CAGATCTAAACCATCTCAGTGGG + Intronic
975695728 4:77011146-77011168 CAGACAGCCCCCATCTCTGGAGG + Intronic
977910978 4:102535952-102535974 CAGATTTTCCCCAGCTCTGACGG + Intronic
983730845 4:170991780-170991802 CAGATGTACCCCAACCCTGCAGG + Intergenic
987078628 5:14406566-14406588 CAGATCCTCTCCATCCCTGGCGG - Exonic
988818513 5:34857958-34857980 CAGAGCTACCCAATCTTTGGAGG - Intronic
989189591 5:38657468-38657490 CAGATCAACACCATCTATGAAGG + Intergenic
996293945 5:121889756-121889778 CAAATCTTCCCCAACTATGGAGG + Intergenic
996689743 5:126327697-126327719 CTGATCTAATACATCTCTGGTGG - Intergenic
1001326999 5:170736205-170736227 CAGATGCACACCATCTCTGATGG + Intronic
1002085628 5:176773607-176773629 CAGATGTATCCTCTCTCTGGAGG - Intergenic
1003299117 6:4860896-4860918 CAGATCTACCCTTCATCTGGTGG - Intronic
1004028572 6:11843389-11843411 AAGATCTTCACCCTCTCTGGAGG + Intergenic
1005849751 6:29812788-29812810 CAGATTTACCCTTTCTCTGACGG + Intergenic
1006831610 6:36971498-36971520 CAGTTCTGCCCCTTCTCGGGGGG - Intronic
1007209116 6:40177513-40177535 CAGATCTAAACCATATCAGGAGG + Intergenic
1009477151 6:64107550-64107572 CAGATCCACCCTTTATCTGGTGG - Intronic
1011765588 6:90616055-90616077 CAGATCTTCCCCATCTTCAGAGG - Intergenic
1011842549 6:91519824-91519846 AAGACCTAACACATCTCTGGAGG + Intergenic
1013697047 6:112715948-112715970 CTGATCTGCCACATTTCTGGAGG + Intergenic
1026508566 7:71007789-71007811 CAGATCAACTCCATCTCAGCAGG + Intergenic
1027048118 7:75004467-75004489 CAGAGCCACTCCATCTCGGGGGG - Intronic
1029613535 7:101641532-101641554 CAGATCACCCCCATCTCTGGTGG - Intergenic
1035109067 7:156465223-156465245 CAGATCAGCCCCGTCTCTGCTGG + Intergenic
1035374336 7:158397458-158397480 CAGATCGAGACCAGCTCTGGAGG + Intronic
1038311736 8:26450141-26450163 CAGATCTCCCCCATCTTTCCAGG - Intronic
1042808595 8:72798978-72799000 CAGAGCACCACCATCTCTGGGGG + Intronic
1043321825 8:78996255-78996277 CAGATCTAAACCATATCAGGAGG + Intergenic
1047448348 8:124939451-124939473 CACATCTACCCTCTCTCTGAGGG - Intergenic
1048846958 8:138611189-138611211 CAGGTCTTCTCCATTTCTGGAGG - Intronic
1052442339 9:28512941-28512963 CAGATCCACCCCCAATCTGGTGG - Intronic
1054866339 9:70006173-70006195 CTGCTCTACCTCCTCTCTGGAGG + Intergenic
1056302803 9:85259062-85259084 ACGATCTTCCCCATCCCTGGAGG - Intergenic
1059107121 9:111521488-111521510 CACATCTTCCCCATCTCTAGAGG - Intergenic
1061864137 9:133483827-133483849 GGGTTCTACCCCATCCCTGGGGG - Intergenic
1061938582 9:133872115-133872137 CACAGCTATGCCATCTCTGGGGG - Intronic
1187290523 X:17949029-17949051 CCACTCTTCCCCATCTCTGGTGG + Intergenic
1191758919 X:64626288-64626310 CAGATCAACCCCTAATCTGGTGG + Intergenic
1195975758 X:110524504-110524526 GTAATCTACCCCATGTCTGGAGG - Intergenic
1198685105 X:139220557-139220579 CAAATCTACCCCATTTCTCATGG - Intronic
1200228559 X:154432665-154432687 CACATCTGCCTCATCTCTGGAGG - Intronic
1201548548 Y:15194221-15194243 CAGATTTCCCCCATGGCTGGAGG + Intergenic