ID: 962269182

View in Genome Browser
Species Human (GRCh38)
Location 3:133965720-133965742
Sequence CCTGAGAAGAAGACAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 521}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962269182_962269188 4 Left 962269182 3:133965720-133965742 CCTCCCTCTGTCTTCTTCTCAGG 0: 1
1: 0
2: 3
3: 46
4: 521
Right 962269188 3:133965747-133965769 CCACCCTGACAGCACCGCACTGG 0: 1
1: 0
2: 0
3: 11
4: 141
962269182_962269192 15 Left 962269182 3:133965720-133965742 CCTCCCTCTGTCTTCTTCTCAGG 0: 1
1: 0
2: 3
3: 46
4: 521
Right 962269192 3:133965758-133965780 GCACCGCACTGGGCCCCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 100
962269182_962269195 20 Left 962269182 3:133965720-133965742 CCTCCCTCTGTCTTCTTCTCAGG 0: 1
1: 0
2: 3
3: 46
4: 521
Right 962269195 3:133965763-133965785 GCACTGGGCCCCCAAAGGGCTGG 0: 1
1: 0
2: 4
3: 156
4: 3445
962269182_962269189 5 Left 962269182 3:133965720-133965742 CCTCCCTCTGTCTTCTTCTCAGG 0: 1
1: 0
2: 3
3: 46
4: 521
Right 962269189 3:133965748-133965770 CACCCTGACAGCACCGCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 86
962269182_962269193 16 Left 962269182 3:133965720-133965742 CCTCCCTCTGTCTTCTTCTCAGG 0: 1
1: 0
2: 3
3: 46
4: 521
Right 962269193 3:133965759-133965781 CACCGCACTGGGCCCCCAAAGGG 0: 1
1: 1
2: 2
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962269182 Original CRISPR CCTGAGAAGAAGACAGAGGG AGG (reversed) Intronic
900149108 1:1170566-1170588 CCTGAGCAAAAGAAGGAGGGAGG - Intergenic
900348600 1:2224225-2224247 CCTGAGGAGGAGAGAGTGGGTGG + Intergenic
900721083 1:4176183-4176205 CAGGAGAAGAATAGAGAGGGAGG - Intergenic
901233450 1:7654024-7654046 CCTGAGAATGAGCCAGAGGCGGG + Intronic
902921282 1:19667224-19667246 CCTGGGAAGAAGGCAGCCGGGGG - Intronic
903468741 1:23569855-23569877 CCAGATAAGAAAACTGAGGGAGG - Intergenic
903874607 1:26464879-26464901 ACTGAGAGGAAGGCAGCGGGTGG + Intronic
904571482 1:31469341-31469363 CCTGTAAAGAAGCCAGATGGGGG - Intergenic
904919954 1:33999276-33999298 CCTGAGATGAACAAAGAGGCAGG + Intronic
904983556 1:34526350-34526372 GCTGAGATGAAGACAGAAAGAGG + Intergenic
905096355 1:35474610-35474632 CCTGACAGGAAGTCAGAGGAGGG + Intronic
905222923 1:36461216-36461238 CCAGAGGAGAAGACTGCGGGAGG + Intronic
905642005 1:39596539-39596561 CCTGAGCAGAAGATTGAGGAAGG + Intergenic
906554679 1:46699572-46699594 GCAGAGTAGAAGACAGAGGCCGG + Intronic
906664536 1:47610011-47610033 ACTGAGAATAAAACAGATGGAGG - Intergenic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907965291 1:59323002-59323024 CCGGAGAAGAAGGCAGAGAGAGG + Intronic
908774215 1:67624853-67624875 CCAGGCAAGAAGAGAGAGGGGGG + Intergenic
908809871 1:67969605-67969627 CATGGGAAGAACCCAGAGGGAGG - Intergenic
910188249 1:84568801-84568823 CCAGAGAAGGAGAAAGAGAGAGG - Intronic
910369243 1:86498496-86498518 TCTGATAAGAAAACAGACGGAGG + Intronic
910664559 1:89710162-89710184 CTTGGGAAGTAGGCAGAGGGAGG - Intronic
911054997 1:93701673-93701695 CCTGGGAAGCAGGCAGAGTGGGG - Intronic
911361550 1:96883263-96883285 GCTGAGTATAAGACAGAGGTGGG - Intergenic
911835385 1:102612293-102612315 CCTGAGTAAAAGACACAGAGTGG + Intergenic
914431040 1:147620355-147620377 CCTCAGAAGATGAGAGAGGCTGG + Exonic
915555741 1:156659834-156659856 CCAGAGAGGAAGGCAGAGGTTGG + Intergenic
915643719 1:157251695-157251717 TATCAGAAGAAGATAGAGGGAGG - Intergenic
916181934 1:162092759-162092781 CCTGAGAAGAAGATGCAGTGTGG + Intronic
917089764 1:171341391-171341413 CCTGAGAGGAAAAAAGAGGGAGG - Exonic
917176050 1:172236640-172236662 GTAGAGAAGAGGACAGAGGGAGG + Intronic
918424406 1:184393400-184393422 CCTGAGAAACAGGCAGAGGCAGG - Intronic
919013477 1:191996401-191996423 CCTGAGAAGAAGCCAAAGTTTGG - Intergenic
919216140 1:194557948-194557970 CCTGAGAAATAGGCAAAGGGAGG + Intergenic
920379912 1:205529302-205529324 CCTGGGGAGACGAGAGAGGGTGG - Exonic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
921177699 1:212608473-212608495 CCTGATATGGAGAGAGAGGGCGG + Intronic
921254409 1:213326087-213326109 CCTGAGAAAGAGAGAGCGGGAGG + Intergenic
921834101 1:219760195-219760217 GGTGACAAGTAGACAGAGGGAGG + Intronic
922163807 1:223097974-223097996 CCTGAGATTAGGACAGAGGTGGG + Intergenic
922331364 1:224579762-224579784 CCAGAGAGGAAGAAAGAGAGAGG - Intronic
922415157 1:225414817-225414839 TCTCAGCAGAAGACAGATGGAGG + Intronic
922471593 1:225880426-225880448 GCTGAGGAGAAGGCAGGGGGAGG + Intronic
922682412 1:227611546-227611568 CTTGAGAAGAACACAGATGAAGG - Intronic
922717510 1:227885108-227885130 CCCAAGGAGTAGACAGAGGGAGG - Intergenic
922944007 1:229494794-229494816 CCTGAGCAACAGAAAGAGGGTGG + Intronic
923134639 1:231107314-231107336 CCTGGGATGAAGGCAGAGTGTGG - Intergenic
923390434 1:233509848-233509870 ACTGAGAAGAGGTCAGAGAGTGG + Intergenic
924644279 1:245862964-245862986 CCAGAGAAGGAGGTAGAGGGAGG - Intronic
1062999843 10:1906129-1906151 CCTGAAAGGAAGAAAGAAGGAGG + Intergenic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063068982 10:2640173-2640195 CGTGAGAAGGAGCCAGTGGGAGG + Intergenic
1063865982 10:10366161-10366183 ACTGAGAAAGAGAGAGAGGGAGG + Intergenic
1067205435 10:44208301-44208323 CCAGAGAAGATGACCAAGGGTGG - Intergenic
1067270942 10:44790809-44790831 CCTGAGATGGACACAGAGGTTGG - Intergenic
1067932225 10:50574068-50574090 TCTTAGAAGAAAACACAGGGGGG + Intronic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1068901857 10:62278530-62278552 CCTATGAAGCAGACAGAGGAAGG - Intergenic
1069234614 10:66055163-66055185 CCTGAGAAAAAGACTGAAGCTGG - Intronic
1069343197 10:67437314-67437336 CCTGAGAGGAAGACTGGGAGTGG + Intronic
1069633063 10:69909313-69909335 CCGGAGAAGAGCAGAGAGGGTGG - Intronic
1070127614 10:73634733-73634755 CCTGAAAAGAAGACAAAGTGAGG + Exonic
1070166608 10:73903509-73903531 CCGGAGGAGAACACAGAGGTGGG - Intergenic
1070209872 10:74305584-74305606 CAAGAGAAGAACACAGAGAGTGG - Intronic
1070366800 10:75744606-75744628 CCTGAGATGGAGACAGAAGGAGG + Intronic
1070430127 10:76329241-76329263 CCTTAGAAGAAAGCAGATGGTGG + Intronic
1071054690 10:81495490-81495512 GCTGTGAAGAACATAGAGGGTGG + Intergenic
1072237883 10:93468854-93468876 CCTGGGACAAGGACAGAGGGTGG + Intronic
1072423385 10:95308648-95308670 CTTGACAAGAATACAGTGGGAGG - Intergenic
1073633670 10:105175382-105175404 CCTGAGAATGAGACAGAGAGAGG + Intronic
1074164253 10:110860855-110860877 CCAGAGAAGCAGACTCAGGGAGG + Intergenic
1074757089 10:116632131-116632153 GCTGAGAAGAAGACAAAGGAGGG + Intronic
1074896584 10:117782448-117782470 CCTGAAAAGAGGCCCGAGGGAGG + Intergenic
1076095665 10:127733553-127733575 CCCGAGAAGAAGCCAGAGAAGGG + Intergenic
1076180805 10:128405688-128405710 CCTGGGCACCAGACAGAGGGAGG - Intergenic
1076203386 10:128575858-128575880 GCAGAGAAGAAGCCAAAGGGTGG - Intergenic
1076390943 10:130101420-130101442 ACTGAGGAGCAGAGAGAGGGTGG + Intergenic
1076670551 10:132118505-132118527 CCCGGGAAGCAGGCAGAGGGAGG - Intronic
1076797150 10:132803915-132803937 CCTGGGAACAGGACAGAGGTGGG + Intergenic
1077549127 11:3192095-3192117 CCGGAGAAGAAGAAAGGTGGCGG - Intergenic
1078135033 11:8644705-8644727 CCTGAGAAGATGGCAGAGTTGGG - Intronic
1078619712 11:12895932-12895954 ACTGAAAGGAAGACGGAGGGGGG - Intronic
1078619723 11:12895989-12896011 ACTGAAAGGAAGACGGAGGGGGG - Intronic
1079012469 11:16840618-16840640 ACTGAAAAGTAGACAGAAGGGGG + Intronic
1079247249 11:18761657-18761679 CCTGAGAAGAGGACAGAGAATGG + Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079915843 11:26367498-26367520 GCTCAGAAGAAGACAGATGAGGG - Intronic
1080197419 11:29628752-29628774 CCTGAGGAGAGGAGAGAGGGGGG + Intergenic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1081245880 11:40765299-40765321 CTGGAGAAGAAGAAAGAGAGAGG - Intronic
1081605980 11:44527238-44527260 GCTGAGAGGAAGCCAGAGGGAGG - Intergenic
1081736384 11:45407523-45407545 CCTGGGGAGGAGTCAGAGGGAGG - Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1082904670 11:58292822-58292844 CCTGAGTAAAATAAAGAGGGAGG + Intergenic
1083253452 11:61482599-61482621 CCTTAGCAGAGGACAGAGGCAGG + Intronic
1083400674 11:62421286-62421308 CCTGAGAAGAAAACAGAGTCTGG + Intronic
1083544223 11:63537163-63537185 CCTGAGGAGAAGCCAGAGTGTGG + Intronic
1083546725 11:63554302-63554324 CCAGAGGAGAAGACTGAGGATGG + Intronic
1084071655 11:66740468-66740490 CCTGATAAGAAAGCAGAGGGAGG + Intergenic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1086241609 11:84700646-84700668 CCAGAGGAGAAAACAGAGAGAGG + Intronic
1086404728 11:86489813-86489835 CCTGTGAAGAATAAAGGGGGAGG - Intronic
1087211504 11:95449886-95449908 CATGAGAAAGATACAGAGGGAGG + Intergenic
1088297785 11:108319353-108319375 CCTGACAAGAAAACACAGAGAGG - Intronic
1088838425 11:113600634-113600656 CCTAATAAGAATAGAGAGGGGGG + Intergenic
1089999385 11:122941550-122941572 CCTTAGAAGAATATAGAGGGAGG - Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090383951 11:126345769-126345791 CCTGGGAGGCAGACAGATGGTGG + Intergenic
1091174728 11:133547760-133547782 CCTGAGAAGCAGTCAGCTGGAGG - Intergenic
1091307065 11:134543050-134543072 CCTGGGAAGGAGGCAGAGAGGGG - Intergenic
1091456887 12:614545-614567 AAGGGGAAGAAGACAGAGGGAGG - Intronic
1091710969 12:2740331-2740353 CCTGAAAAGATGTCAGAGTGAGG + Intergenic
1091903953 12:4167873-4167895 CCTGAGCAGAAGGCTGAGGCAGG - Intergenic
1092240513 12:6833474-6833496 CCAGAGAGGAAGACGGAGGTAGG - Intronic
1092747796 12:11689824-11689846 TCAGAGAAAAAGACAAAGGGGGG - Intronic
1094268811 12:28588706-28588728 CTTGAGAAGATGACAGATGGAGG + Intergenic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1095108877 12:38268857-38268879 AGTGAGAATAAGAGAGAGGGAGG + Intergenic
1096195724 12:49647731-49647753 ACTGGGAAGAATACAGAAGGAGG + Exonic
1096987466 12:55770179-55770201 CCTCAGAAGAAAAAAGAGAGAGG + Intronic
1097618366 12:61910169-61910191 CCTGAGTAGCTGAAAGAGGGAGG - Intronic
1097641840 12:62191861-62191883 CCAGAGAACAAGAGGGAGGGCGG - Exonic
1100218962 12:92483138-92483160 CATGCGAAGAAGACACAGAGAGG + Intergenic
1100606310 12:96154681-96154703 CCTTATAAGAAGAAAGAGAGAGG + Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1102546979 12:113664384-113664406 TCTGAGCAGAAGAAAGAAGGTGG + Intergenic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1102812762 12:115838622-115838644 CCTTAAAAGAAGACAGAGAAAGG + Intergenic
1103059496 12:117847410-117847432 CAAGAGAAGAAGCCAGAGGAGGG + Intronic
1103060035 12:117851216-117851238 CCTGGGAAGAGTCCAGAGGGAGG + Intronic
1103298773 12:119910697-119910719 ACTGAGAAGATGAGGGAGGGAGG - Intergenic
1104232407 12:126898055-126898077 CATGAGAACAAGTCAGAGGAAGG + Intergenic
1104404195 12:128504053-128504075 CCTGAGATGACGTGAGAGGGAGG - Intronic
1104686440 12:130788026-130788048 CCTGTGAAAAAGACGGACGGAGG - Intergenic
1104892201 12:132145451-132145473 GCTGAGTAGAAGACAATGGGAGG + Intronic
1106008445 13:25794083-25794105 GATGGGGAGAAGACAGAGGGAGG + Intronic
1106469740 13:30043690-30043712 CCTGAGCATCAGTCAGAGGGAGG + Intergenic
1106497506 13:30294054-30294076 CCCGAGGAGAAGAGAGAGAGAGG - Intronic
1106704602 13:32267201-32267223 GCTGAGAAGAAGGGCGAGGGAGG - Exonic
1108504161 13:51095431-51095453 CCAGAGAAGAAGAAATAGAGAGG - Intergenic
1108678720 13:52761073-52761095 CCTGAGGAGAAGAGAGAGAAAGG + Intergenic
1110242245 13:73282295-73282317 AGTGAGAAGAAGGCAGAAGGAGG - Intergenic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1112012759 13:95305814-95305836 CCTGTGAAGAAGGAAGAGTGGGG - Intergenic
1112354456 13:98662173-98662195 CTGGAGAAGAAGCCAGAGCGTGG + Intergenic
1113074353 13:106453222-106453244 CCAGAGAAGAAGACAGAGGCAGG + Intergenic
1113106279 13:106775054-106775076 CCTGGGAGGAAGAGAGTGGGAGG - Intergenic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1114539846 14:23446736-23446758 CCTGAGAAGTAGACAGGGCCAGG - Intergenic
1114663983 14:24368017-24368039 ACTGAAGAGAGGACAGAGGGAGG + Intronic
1114764934 14:25360215-25360237 CCTGTGAAGAAGGTAGAGGAAGG + Intergenic
1115724569 14:36199026-36199048 CCAGGGAAGAAGACAAAAGGGGG - Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116739400 14:48735329-48735351 GCTCAGAAGAAGACAGAAAGAGG - Intergenic
1116759084 14:48988376-48988398 CCGGAGGAGAACACAGAGGCAGG + Intergenic
1117109063 14:52429802-52429824 CCTGAAAAGGATACAGAGGATGG + Intergenic
1117249090 14:53917456-53917478 TCTGTGAAGAAGACAGAAGATGG - Intergenic
1117680296 14:58197025-58197047 CCTCAGAAGAAGAGGGAGGCCGG + Intronic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1118198101 14:63646990-63647012 CCAGAGAACAAAACAGAGAGAGG - Intergenic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118656387 14:67954499-67954521 CCAGAGGAGAAGACAGATGAAGG + Intronic
1119797495 14:77412311-77412333 CCTGAGATGAAAACAGAGAAAGG + Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120204271 14:81571022-81571044 ACTGATAAGTAGAGAGAGGGAGG - Intergenic
1120329609 14:83074523-83074545 CCAGAGAGCAAGAAAGAGGGGGG + Intergenic
1120513038 14:85438485-85438507 TCTGAGAAGAAGGAGGAGGGCGG + Intergenic
1120780634 14:88482662-88482684 CCTGGGAAGCTCACAGAGGGAGG + Intronic
1120848894 14:89150782-89150804 CAGGAGAAGAAGACAAAGGCTGG + Intronic
1121021367 14:90582213-90582235 CCTCAGAGGCAGAGAGAGGGGGG - Intronic
1121257207 14:92539725-92539747 CCAGAGAAGATTCCAGAGGGAGG + Intronic
1121264555 14:92591570-92591592 CTTGAAAAAAAGCCAGAGGGGGG + Intronic
1122889732 14:104726731-104726753 GCTGAGCAGAGGACAGAGCGAGG + Intronic
1123629789 15:22253701-22253723 CCTCAGAAGAAGACTCAGAGTGG - Intergenic
1125541027 15:40470392-40470414 CATGAGGAGAAGGCAGAGGAGGG + Intergenic
1125812233 15:42551267-42551289 CCTGATAAGAAGAAAAAGGCTGG - Intronic
1126362422 15:47860112-47860134 CCTGAGAAGCAGAAACAGCGAGG - Intergenic
1126944016 15:53797840-53797862 CTTGAGGAGAAGAAAGAGAGGGG + Intergenic
1127395579 15:58541763-58541785 CCTGAGGAGGGGACAGAGGGAGG - Exonic
1127434083 15:58939223-58939245 CCAGAGAACAAGACAGAAGAGGG + Intronic
1127521487 15:59747094-59747116 TCTCAGAAGAAGAAAGTGGGAGG - Intergenic
1127956607 15:63859298-63859320 GCAGAGAAGAAGACAGAAGCAGG - Intergenic
1128735160 15:70049473-70049495 CCTGGGAAGAGGAGACAGGGAGG - Exonic
1130689146 15:86065332-86065354 CCTGAAAAGAGGAGATAGGGAGG + Intergenic
1130726660 15:86445987-86446009 CTTGAGATGGAGAGAGAGGGAGG + Intronic
1131029992 15:89178526-89178548 CGGGAGGAGAAGCCAGAGGGAGG - Intronic
1131356842 15:91752579-91752601 CCTTAGAAGAGGACAGTAGGTGG - Intergenic
1131506157 15:93021458-93021480 CCAAAGAAGAAGAGAGAGTGGGG - Intronic
1131726819 15:95235339-95235361 GCTCAGAAGAAGACAGATGAGGG - Intergenic
1131843962 15:96469164-96469186 CCTGAGATTCAGAAAGAGGGTGG + Intergenic
1132311679 15:100862074-100862096 CCCTGGAGGAAGACAGAGGGTGG + Intergenic
1132415390 15:101615365-101615387 CCTGAGTAGAAGAGGGAGGCTGG + Intergenic
1132716519 16:1292713-1292735 CCTGGGAAAAGGAGAGAGGGAGG - Intergenic
1132740018 16:1407411-1407433 TCTGGAAAGAAGACAGAGGCCGG + Intronic
1133102222 16:3486400-3486422 CCTGAGGAGGAGGGAGAGGGAGG + Exonic
1133988767 16:10688850-10688872 CCTTGGGAGATGACAGAGGGTGG - Intronic
1134096832 16:11423938-11423960 CTGGAGAGGAAGGCAGAGGGTGG - Intronic
1134279045 16:12802044-12802066 CCTGAGAAGAAATCAGAGCAGGG - Intronic
1135820732 16:25683218-25683240 CCTTACAAGAAGACAAAGGCAGG + Intergenic
1135899566 16:26444408-26444430 CCAGAGAAGAAGTTAGAGTGTGG + Intergenic
1136109183 16:28054017-28054039 TCTGAGAAGGATGCAGAGGGAGG - Intronic
1137264220 16:46855478-46855500 TCTGGGAAGAAGGGAGAGGGAGG - Intergenic
1137680165 16:50335385-50335407 CTTGAGGAGAAGACAGTTGGTGG + Intronic
1137936532 16:52640232-52640254 TGTGAGAAGAAGGAAGAGGGAGG + Intergenic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138423911 16:56917670-56917692 CTTGAGCAAAAGACAGAGTGAGG + Intergenic
1138895567 16:61199547-61199569 CATGAGAGGAAGCCAGTGGGAGG + Intergenic
1139073272 16:63410711-63410733 GCTGAGAAGAAGGCAGAATGAGG + Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1140109803 16:71994302-71994324 CCTAAGAATGAGACTGAGGGAGG - Intronic
1140110119 16:71997005-71997027 CCTAAGAATGAGACTGAGGGAGG + Intronic
1141132055 16:81444071-81444093 CCTGGGCAGAAGAAAGAAGGGGG + Intergenic
1141256969 16:82411540-82411562 CCAGAGAATAGGTCAGAGGGTGG + Intergenic
1141806353 16:86344289-86344311 AGGGAAAAGAAGACAGAGGGGGG + Intergenic
1141973353 16:87497055-87497077 CCTCAGAAGAAGACTCAGAGTGG + Intergenic
1142108144 16:88317297-88317319 CCTGGGGAGAAGGCAGAAGGAGG - Intergenic
1142527856 17:557253-557275 CGTGAGAAGGAGGCAGAGGCTGG - Intronic
1142887354 17:2921033-2921055 CGGGAGAAGAAGCCAGCGGGAGG - Intronic
1143141405 17:4743745-4743767 CCTGAGAGGATGAAAGAAGGAGG - Exonic
1143268998 17:5661826-5661848 CCTGAGACGGAGAGAGAGAGAGG + Intergenic
1143274953 17:5703475-5703497 TGAGAGAGGAAGACAGAGGGAGG + Intergenic
1143645792 17:8229206-8229228 CCTGGGATGAAGACAGTGGTTGG + Exonic
1143855446 17:9844607-9844629 CCTGAGAAGGATACAGGGAGAGG + Intronic
1144622063 17:16824079-16824101 CCAAAGAAGAAGCCAGAGAGGGG + Intergenic
1144863336 17:18319337-18319359 CCTGAGAAGCACTCAGAGGGTGG + Intronic
1144884360 17:18448634-18448656 CCAAAGAAGAAGCCAGAGAGGGG - Intergenic
1145279652 17:21458086-21458108 ACTGAGGAGAAGACAGAGCAGGG + Intergenic
1145312757 17:21709342-21709364 GCTGAGAACAAGACTGAGGCTGG - Intergenic
1145884890 17:28375033-28375055 CCTGAGAAGAAGAAAGCAAGAGG - Intronic
1146584405 17:34069802-34069824 AATGATATGAAGACAGAGGGAGG + Intronic
1146765152 17:35513646-35513668 CCTGAAAAGAATGGAGAGGGTGG - Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1147041868 17:37725773-37725795 CCTGGGCAGCAGACAGCGGGAGG - Intronic
1147650242 17:42057972-42057994 CCTGGGCAGGAGACAGATGGGGG + Intronic
1147904820 17:43816079-43816101 TCTGGGAAGCAAACAGAGGGAGG + Exonic
1147970264 17:44215646-44215668 CCGGAGAAGAAGAAGGTGGGGGG - Exonic
1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG + Intronic
1150439467 17:65179526-65179548 CCTGGGGAGGAGAGAGAGGGTGG + Intronic
1151143310 17:72016160-72016182 CCTGGGGAGCAGACTGAGGGTGG - Intergenic
1151309014 17:73282176-73282198 CAAGGGAAGAAGAGAGAGGGAGG - Intergenic
1151352438 17:73539782-73539804 CCTGAGAAGAAGAGAGAACGTGG + Intronic
1151482998 17:74381105-74381127 CCTGGGAAGAAGAAGAAGGGAGG - Intergenic
1152409409 17:80115168-80115190 CCAGAGTAGAAGACAGAAAGGGG - Intergenic
1153434909 18:5058902-5058924 CCCGACAGGAAGCCAGAGGGTGG - Intergenic
1153675914 18:7455465-7455487 CCTGAGAGGAAGGGAGAAGGTGG - Intergenic
1153701069 18:7693816-7693838 CCTGAGATGCAGACACAGGGTGG + Intronic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1153963225 18:10157843-10157865 CCTCTGCAGAAGTCAGAGGGCGG + Intergenic
1155881732 18:31157658-31157680 CATGAGAAGCAGAAAAAGGGAGG + Intronic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1156401618 18:36745040-36745062 CATGAGAGGAAGAGAGAGAGTGG + Intronic
1156468667 18:37363840-37363862 CCTGAGCATAAGACAGGGGCTGG - Intronic
1157069713 18:44391754-44391776 CCTGTGTAGTAGACAGAGGAGGG + Intergenic
1157717255 18:49896509-49896531 GCAGAGATGAAGTCAGAGGGTGG - Intronic
1157820638 18:50765867-50765889 GCTCAGAAGAAGACAGAAAGTGG - Intergenic
1158792766 18:60802082-60802104 CCTGTGAAGAAAATAGAGAGGGG - Intergenic
1159990396 18:74899954-74899976 CCAGAGGGAAAGACAGAGGGTGG + Intronic
1160981223 19:1817483-1817505 CTTGCCAAGAAGACACAGGGAGG + Intronic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1162081463 19:8220301-8220323 CCAGAAAAGAAGAGAGAGGGAGG - Intronic
1163267383 19:16229153-16229175 CCTGAGGTGAAGACAGAGGCTGG - Intronic
1163550908 19:17966182-17966204 GCTGGGAAGAAAACAGATGGAGG + Intronic
1164210396 19:23093381-23093403 CCTCAGAAGATGACACAGGATGG - Intronic
1164322669 19:24163982-24164004 CCTTAGAAGGAGACAGTGTGTGG - Intergenic
1164441299 19:28282538-28282560 GTTGGGAAGAAGACAGTGGGGGG - Intergenic
1165717382 19:38055242-38055264 CATGAGAAGAAAAGGGAGGGAGG + Intronic
1165943753 19:39428890-39428912 CCTGAGAAGGCGACAGAGCTGGG - Intergenic
1166305234 19:41933799-41933821 TCAGAGAAAAAGACAGATGGAGG + Intergenic
1166729301 19:45049612-45049634 GCTGAGATGGAGACAGAGTGAGG + Intronic
1166766062 19:45252447-45252469 GCTGAGAAGTTGATAGAGGGCGG - Intronic
1166924447 19:46257230-46257252 ACTGTGAAGAACGCAGAGGGCGG - Intergenic
1167030229 19:46954031-46954053 CCTTAGAAGAAGAGACAGGAGGG + Intronic
1168082240 19:54018718-54018740 CCTGATAAGAAGCTAGAAGGAGG + Intergenic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
1168344196 19:55642535-55642557 CCGGAGAGGAGGACCGAGGGTGG - Exonic
925841089 2:7993098-7993120 CGTGAAAAGAAGCCAGAGGCAGG - Intergenic
926372774 2:12197167-12197189 CCTGGGAAGAACCCAGTGGGAGG - Intergenic
927446180 2:23163954-23163976 CCTGAGGAGTAGGAAGAGGGGGG - Intergenic
927476896 2:23420479-23420501 CCTGAGATGAAGACGCATGGAGG - Intronic
927607757 2:24503364-24503386 ACTGTTAAGAAGACAGAGGAAGG - Intronic
927960212 2:27236565-27236587 GATGGGAAGAAGAAAGAGGGAGG + Intronic
927971203 2:27307179-27307201 CCTGGGAAGAGGGCCGAGGGCGG + Exonic
928155855 2:28875809-28875831 CCTGAGAAAGAGATGGAGGGTGG - Intergenic
928247103 2:29640073-29640095 GCTGCGAATTAGACAGAGGGAGG + Intronic
928322689 2:30296000-30296022 CCTTTCTAGAAGACAGAGGGGGG - Intronic
929776570 2:44934238-44934260 GCTCACAAGAGGACAGAGGGAGG + Intergenic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931133410 2:59366292-59366314 AAAGAGAAGAAGAGAGAGGGAGG + Intergenic
931707300 2:64957849-64957871 TCTGAGAAGAAGATTCAGGGAGG + Intergenic
931916542 2:66962782-66962804 CCTGAGAGGCAGAGAGGGGGTGG - Intergenic
933155780 2:78972283-78972305 CCTGAGTAGAATAATGAGGGTGG - Intergenic
933857984 2:86436451-86436473 ACTGAGGTGAAGACAGATGGAGG - Intergenic
934117814 2:88812873-88812895 CCTGTCAAGATGACAGAAGGAGG + Intergenic
935070361 2:99688679-99688701 CCTCAGAAGAAAACTGAGGCTGG - Intronic
935562888 2:104576864-104576886 TCTGGGAAGAAGACAGGTGGTGG - Intergenic
936161523 2:110087130-110087152 CCTGTCAAGAGGACAGAAGGAGG - Intronic
936183140 2:110284224-110284246 CCTGTCAAGAGGACAGAAGGAGG + Intergenic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936727320 2:115335218-115335240 CATGAGAAGAACCCAGTGGGAGG - Intronic
937189381 2:120079747-120079769 CTTGAGGAGAAGACAAAGGCAGG - Intronic
938364086 2:130720266-130720288 GCTGAGCAGAGGACAGTGGGTGG + Intergenic
939192182 2:138929983-138930005 TCCCAGAAGAAGACACAGGGAGG - Intergenic
939624263 2:144457536-144457558 CCTGGGCAGAAGAGAGAAGGAGG + Intronic
939673460 2:145042545-145042567 CCTAAGAAGAAGATAAAAGGAGG + Intergenic
940346884 2:152637624-152637646 ACAGGAAAGAAGACAGAGGGTGG - Exonic
941262166 2:163311024-163311046 AATAATAAGAAGACAGAGGGAGG + Intergenic
941902466 2:170691569-170691591 CCTGAGCAGAAGGCAGAGCCTGG - Intergenic
942807649 2:179951807-179951829 GCTGAGGAGAAGACTGAGAGAGG + Intronic
942845221 2:180416380-180416402 CCTAAGTGGAAAACAGAGGGGGG - Intergenic
943631945 2:190263715-190263737 ACTGAGATGAAGACAGAGAGAGG - Intronic
944882434 2:204027071-204027093 CCTGAGAAAAAGATATAGAGTGG + Intergenic
945122200 2:206468618-206468640 GCTCAGAAGAAGACAGAAGATGG - Intronic
945848407 2:214976008-214976030 CCTGACAAGAGGAGAGAGGCTGG - Exonic
946203688 2:218088072-218088094 ACTGAGAACAAGAAAGAGAGGGG + Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947354262 2:229275839-229275861 GATGAGAACAACACAGAGGGAGG + Intergenic
948296282 2:236863050-236863072 CCTGAGAAGAAGGCAGGGCAGGG - Intergenic
948322553 2:237082331-237082353 ACAGGGAACAAGACAGAGGGAGG + Intergenic
948390006 2:237605148-237605170 CCCGAGAAGAGGCCAGAAGGTGG + Intergenic
1169046820 20:2539864-2539886 AGTGAGAAGAAGAAAGAGGTTGG + Intronic
1169220275 20:3818576-3818598 CCTGAGGAGTGGACAGAGGCTGG + Intergenic
1169524266 20:6406314-6406336 CCTGAGAAGAATAAAGTTGGAGG - Intergenic
1169811305 20:9611830-9611852 CCTGGGAATCAGACAGAGGTGGG + Intronic
1171255818 20:23688370-23688392 CCTGAGGAGAGGACTCAGGGAGG + Intronic
1171272242 20:23826166-23826188 CCTGAGGAGAGGACTCAGGGAGG + Intronic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1172057035 20:32161254-32161276 CCTGAGGAGGAAACAGAGGAAGG - Exonic
1172116737 20:32577390-32577412 CCTGGGAAGAATTCAGAGGCAGG + Intronic
1172156124 20:32826163-32826185 GCTGAGAGGAAGAAACAGGGTGG - Intronic
1172307998 20:33895366-33895388 CCTTAAATGAAGACACAGGGTGG + Intergenic
1172817789 20:37702685-37702707 GATGAGAAGAACGCAGAGGGAGG - Intronic
1173019394 20:39254411-39254433 CACGAGAAGAAGAAGGAGGGAGG - Intergenic
1173078543 20:39844316-39844338 ACAGAGAATAAGACAAAGGGTGG + Intergenic
1173216895 20:41093591-41093613 GGTGAGAAGAAAACAGTGGGGGG - Intronic
1173728207 20:45311602-45311624 CCCGAGAGGTAGACACAGGGCGG - Exonic
1175088380 20:56480753-56480775 ACTGAGAAGGAGAGAGATGGGGG + Intronic
1175273804 20:57753875-57753897 CCTGAGAGCAGCACAGAGGGAGG - Intergenic
1175394386 20:58649012-58649034 CCAGAGAAGTAGACAGGGCGCGG + Intergenic
1175780814 20:61680825-61680847 GATGAGAAGAAGACACAGGGGGG - Intronic
1175963065 20:62646787-62646809 TTTGAGAAGAAGACGGAGGCTGG - Intronic
1176019943 20:62957419-62957441 CCTGGAGGGAAGACAGAGGGAGG - Exonic
1176261850 20:64185995-64186017 CATTAGGAGAAGACAGACGGGGG + Intronic
1177780305 21:25615002-25615024 CCTGGGAAGAAGACACAGATGGG + Intergenic
1178976512 21:37225626-37225648 TCTGAGAAGAGAAGAGAGGGTGG + Exonic
1179022748 21:37655006-37655028 CCTGAGAAGATGTGAGAGAGAGG + Intronic
1179540862 21:42082610-42082632 CATGAGGAGGACACAGAGGGAGG - Intronic
1179650955 21:42808341-42808363 CCTCATACGGAGACAGAGGGAGG - Intergenic
1179837808 21:44049032-44049054 CCTGAGATGAAGCAAGAGGAGGG - Intronic
1179917023 21:44484412-44484434 CCTGAAAAGGAAACAGTGGGGGG - Intergenic
1180716952 22:17878285-17878307 CCTGGGAAGAAGAGAGAAAGAGG + Intronic
1181277531 22:21696009-21696031 CCTGAGAAGATGACAGAAGTAGG - Intronic
1181921816 22:26326760-26326782 CCTGGGAGGAAGGCAGAGGTGGG + Intronic
1182018861 22:27064035-27064057 GGTGAGAAGAAGAAAGAAGGAGG + Intergenic
1182546406 22:31079274-31079296 GCAGAGAGGAAGACAGAGGCAGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183004738 22:34891700-34891722 ACTGAGAAGAAGAAAGCAGGTGG - Intergenic
1183093357 22:35538587-35538609 CAGGAGCAGAAGACAGAGGCTGG + Intergenic
1183267338 22:36836801-36836823 GCTAAGATGAAGACACAGGGTGG - Intergenic
1183280005 22:36926994-36927016 GCTGAAACGGAGACAGAGGGAGG + Intronic
1183478068 22:38046788-38046810 CCTGAGAAAGAGACAGAGACCGG + Intergenic
1183739242 22:39661078-39661100 AGTGAGATGGAGACAGAGGGAGG - Intronic
1183897810 22:40983181-40983203 GCTGAGAAGCAGAGAGATGGGGG + Intergenic
1184244828 22:43230672-43230694 CCTGAGGAGAAGACAGGGCCAGG + Intronic
1184783509 22:46660732-46660754 CCTGAGAAGAGAACAGAGGGCGG - Intronic
1184961368 22:47931218-47931240 CCTGAGTAGAAGAGATAGGATGG + Intergenic
1185077085 22:48689358-48689380 CCTGAGGACAAGGCAGACGGGGG - Intronic
1185156040 22:49194100-49194122 CCTGAGAAGGAGGCATAGGAAGG + Intergenic
949754977 3:7398881-7398903 TCAGAGAAGTAGAAAGAGGGAGG - Intronic
950798466 3:15530513-15530535 CATCAGAAGAAGACAGGGGAGGG - Intergenic
951530076 3:23690608-23690630 CCTGAGAGGGAGAGAGATGGGGG + Intergenic
951933191 3:27992943-27992965 CCTTAGAAGAAGGCATGGGGGGG + Intergenic
952420195 3:33123452-33123474 CCAGAGAAGAAGGAAGAGAGCGG - Intronic
952730144 3:36629900-36629922 CCTGAGAAGAAGAGAGCAGCTGG + Intergenic
952890472 3:38037024-38037046 GCTGAGATGAGGACTGAGGGGGG + Intergenic
953381155 3:42473768-42473790 CCTGAGAGGAAGACGGAAGCTGG + Intergenic
953955426 3:47228108-47228130 CCAGTGAAGAAGACAGGAGGAGG - Exonic
954039877 3:47877412-47877434 CCAGAGAAGAAAACAAAGGTAGG - Exonic
955025375 3:55162542-55162564 CATGAGAAGAACATAGAGGTGGG + Intergenic
955299782 3:57766519-57766541 CCTGAGAAGAGGAAAGAGTCTGG - Intronic
956483394 3:69695751-69695773 CCTGAGGATAAGTCAGAGGAAGG + Intergenic
956727374 3:72167639-72167661 GCAGATAAGAAGACAGAAGGTGG - Intergenic
957434417 3:80154991-80155013 CCTGAGAAGAGGAGAGAGAAGGG - Intergenic
957994663 3:87673733-87673755 CTTGGGAAGGAGACAAAGGGCGG - Intergenic
958936430 3:100260890-100260912 CCAGAGGGGAAGAAAGAGGGAGG - Intergenic
961399044 3:126621448-126621470 GCTGAGCAGAAGGCAGAGTGTGG - Intronic
961609795 3:128127571-128127593 GCAGTGAAGAAGGCAGAGGGAGG - Intronic
961813700 3:129536636-129536658 CCTGAGATGATGAGGGAGGGAGG - Intergenic
961965122 3:130894185-130894207 CGTGAGAAGAAGCGAGCGGGAGG - Intronic
962269182 3:133965720-133965742 CCTGAGAAGAAGACAGAGGGAGG - Intronic
962378011 3:134874884-134874906 CCTGGTATGAAGGCAGAGGGAGG - Intronic
962801473 3:138894562-138894584 ACTGAGATGAAGAAAGAGAGGGG + Intergenic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
964171865 3:153779983-153780005 CCTGTAAAGAAGAATGAGGGGGG + Intergenic
964469130 3:157033105-157033127 CCTGAGCAGAAGAGAGATGGAGG - Intronic
965422086 3:168473427-168473449 CTTGAGAAGATTAGAGAGGGTGG + Intergenic
966450185 3:180050241-180050263 CCTGAGGAGATAAAAGAGGGTGG - Intergenic
967000567 3:185330276-185330298 TCTGAGATGAAGACAGAGGAAGG - Intronic
967055381 3:185825229-185825251 CTTGAGAGGGAGAGAGAGGGAGG - Intergenic
967218010 3:187226568-187226590 CCTCAGCTCAAGACAGAGGGAGG - Intronic
967850625 3:194080162-194080184 CCGAAGAAGAACAGAGAGGGCGG - Intergenic
968623924 4:1618111-1618133 CCTGGAAGGAAGACAGAGGCAGG + Intronic
968870695 4:3240592-3240614 CCTGAGAAGAAAAGAGAGAAGGG - Exonic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
969780699 4:9400595-9400617 CTGGAGAAGAAAACACAGGGTGG + Intergenic
970511887 4:16789122-16789144 CCTGAGAAGATGCCAGGAGGTGG + Intronic
971476537 4:27077833-27077855 CCTAAGAAGAAGTCAGTTGGAGG + Intergenic
972388010 4:38586521-38586543 CCTTAAAAGAAGGAAGAGGGAGG - Intergenic
974186292 4:58451401-58451423 CCTGATAAGATGACTGATGGAGG + Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974781874 4:66562607-66562629 GCTGAGTATAAGCCAGAGGGGGG + Intergenic
975234526 4:71976746-71976768 CCTGAGGAAAAGACAGAGAGAGG - Intergenic
975940777 4:79643025-79643047 ACTCAGAAGAGGACAGAGGATGG - Intergenic
978992618 4:115104317-115104339 CTTGAGAAGGAGACAGATGGTGG + Intronic
979211117 4:118104310-118104332 ACAGAGAAGGAGACAGAGAGAGG + Intronic
980723581 4:136728190-136728212 CTTGAGGAGAAGAAAGAGTGGGG - Intergenic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
984729587 4:183055201-183055223 GCTGAGAGGAAGAAAGAGGAGGG - Intergenic
985991474 5:3565458-3565480 CCTGGCCAGAATACAGAGGGTGG + Intergenic
986644263 5:9901110-9901132 CCTGAGAAGACCACAGAGAAGGG + Intergenic
987098030 5:14567176-14567198 CCTCAGAAGAAGACAGGAAGAGG - Intergenic
987377317 5:17248010-17248032 ACTGAGAACAAGACAGAGAGGGG - Intronic
987782321 5:22455020-22455042 CCTGAGAGGTAAACAGAGTGAGG + Intronic
988628517 5:32902640-32902662 CATGAGAGCAACACAGAGGGTGG - Intergenic
989606161 5:43246203-43246225 ACTGAGAAGACCACAGAAGGCGG - Intronic
990352803 5:54935573-54935595 CCTGAGAAGGAGAAAAAGTGAGG + Intergenic
990494708 5:56335654-56335676 GCTCAGAAGAAGACAGGGAGAGG - Intergenic
990550820 5:56876413-56876435 CATTAGAAAAAGACTGAGGGAGG - Intronic
991515560 5:67431299-67431321 TCTGAGGAGAAGACATAGGGAGG + Intergenic
992083713 5:73259349-73259371 ACTGAGTAGGGGACAGAGGGTGG + Intergenic
992369689 5:76130119-76130141 ACTGAGAGGAAGAGAAAGGGAGG - Intronic
995021669 5:107373685-107373707 CTTGACAAGAAAACAAAGGGAGG - Intergenic
997343062 5:133161692-133161714 CATGAGAAGGAGGCAGAGGGAGG + Intergenic
997368852 5:133343231-133343253 TCTGTGAGGAGGACAGAGGGAGG + Intronic
997481114 5:134185244-134185266 ACTGAGAAGAAAACAAAGTGGGG + Intronic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997716387 5:136046309-136046331 CAGGAGCAGAAGACAGAAGGAGG - Intronic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
1000505997 5:162118905-162118927 ACTCAGAGGAAGACAGAGGAAGG + Intronic
1000585771 5:163096795-163096817 ACAGAGAAAAAGACAGAGGGAGG + Intergenic
1001426097 5:171623691-171623713 GCTGGGGAGAAGACAGAGGAGGG + Intergenic
1002718722 5:181245449-181245471 GCTGTGAACAAGACAGAGGGGGG + Intronic
1002765253 6:233598-233620 CCAGGGAAGAAAACAGAGAGAGG + Intergenic
1002985067 6:2181770-2181792 CCTGAGGAGAGGGAAGAGGGAGG - Intronic
1003331115 6:5129537-5129559 TCTAAGAGGAAGGCAGAGGGAGG - Intronic
1004557892 6:16717353-16717375 CCTGAGATGAACAGAGAGGCAGG + Intronic
1004602413 6:17163045-17163067 CCGGAGAAGTAGACCAAGGGAGG + Intergenic
1006113486 6:31762949-31762971 CCTGAGAGGCTGACAGAGGCAGG + Exonic
1006548901 6:34804080-34804102 CCTGAAAGGAAGACAGTGTGGGG - Intronic
1007341294 6:41192901-41192923 CCTGAGAAGAAGGGACAGGGTGG + Exonic
1007697602 6:43743731-43743753 CCAGAGCAGAAGACACAGAGAGG + Intergenic
1008097316 6:47352077-47352099 CCTAAAAAGAGCACAGAGGGAGG + Intergenic
1008268586 6:49462938-49462960 CCTAAGGAGAAGGCAGAGAGTGG + Intronic
1008775659 6:55034504-55034526 CCTGATAAGAAAAGAGAGGCCGG - Intergenic
1008798658 6:55339493-55339515 CCTGGGAAAAACACAAAGGGAGG + Intronic
1009026238 6:58003710-58003732 CCTGAAAAAATGAAAGAGGGAGG - Intergenic
1009201790 6:60755183-60755205 CCTGAAAAAATGAAAGAGGGAGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009994542 6:70883948-70883970 CCTGAGATGGACACAGGGGGTGG + Intronic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011570107 6:88725753-88725775 CCTGAGAAGAAAGGAAAGGGGGG - Intronic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1011753116 6:90473100-90473122 GCTGAGCAGAAGGAAGAGGGAGG - Intergenic
1011956022 6:93026364-93026386 GCTGAGAAGAAGAAAGATGAGGG - Intergenic
1012338752 6:98092058-98092080 CGTGAGTGAAAGACAGAGGGAGG + Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1014656279 6:124108636-124108658 CCTTAGAAGAAAACATAGGGAGG - Intronic
1015350547 6:132212959-132212981 CCAGACATGAAGACAGAAGGTGG + Intergenic
1015478419 6:133679604-133679626 ACAGAGAATAAGACAAAGGGTGG + Intergenic
1015970917 6:138741798-138741820 CCAGAGGGGAAGACTGAGGGTGG - Intergenic
1016202219 6:141426508-141426530 CTGGAGAAGAAGACACATGGAGG - Intergenic
1016460508 6:144276130-144276152 AAAGAGGAGAAGACAGAGGGTGG + Intergenic
1017126865 6:151073114-151073136 CCTGAGTTGAAGACAGAGCTGGG + Intronic
1017188215 6:151624002-151624024 GGGGAGAAGAAGACAGAGGTAGG - Intergenic
1017234889 6:152109045-152109067 CAGGAGGAGAAGGCAGAGGGAGG + Intronic
1019180792 6:170186388-170186410 CCCGGGAGGAAGACTGAGGGAGG + Intergenic
1020050889 7:5080857-5080879 CCGGAGGAGAGGACAGAGGCTGG - Intergenic
1021409955 7:20319231-20319253 CTTGAGAAGACAACAGAGAGTGG + Intergenic
1022356057 7:29615630-29615652 CCAGAGAGGAAGACAGAGGTAGG - Intergenic
1023623100 7:42092348-42092370 CCTGAGAAAAACACACAGGCTGG + Intronic
1024090721 7:45937711-45937733 CCTGGGGAGAACACAGAGGTTGG - Intergenic
1025247500 7:57328402-57328424 AGAGAGAAGAAAACAGAGGGAGG - Intergenic
1025736331 7:64150455-64150477 CCAGAGAAGAAGAAAGATGTTGG + Intronic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026500994 7:70943287-70943309 CCTGAGAAGAGCAAAGAGGTTGG + Intergenic
1026509477 7:71016306-71016328 CCTGAGCAGAGGGCAGAGCGTGG - Intergenic
1028136066 7:87224073-87224095 CATAAGAAGAAGCCAGAGGTGGG - Intergenic
1028363394 7:89996151-89996173 CCTGAGAGGAAACCAGTGGGAGG - Intergenic
1030633306 7:111919274-111919296 CTTTAGAAAAAGACAGATGGAGG + Intronic
1030803597 7:113886263-113886285 CATGGGAAGAACCCAGAGGGAGG + Intronic
1031657792 7:124379845-124379867 CCTGGGAAGAGGAGAGAGGAGGG + Intergenic
1032604604 7:133336279-133336301 TCTCAGAAGAAAACACAGGGGGG - Intronic
1033966986 7:146987593-146987615 CCTGCGAAGAAGATAGAATGAGG - Intronic
1034336808 7:150329255-150329277 CCTGAGAAGAGTAAAGAGTGAGG + Intronic
1034526315 7:151665269-151665291 CCTGGGGAGACGACAGAGGCAGG + Intronic
1034703248 7:153115774-153115796 CATGAGTAGATGAGAGAGGGTGG + Intergenic
1035110784 7:156479888-156479910 AAGGAGATGAAGACAGAGGGAGG + Intergenic
1035117966 7:156540757-156540779 CATGAGAAGCAGGGAGAGGGTGG + Intergenic
1036115408 8:5954794-5954816 CCTAAGAAGAAGAGAGATGGGGG - Intergenic
1036147277 8:6266004-6266026 ACAGATAAGAAAACAGAGGGGGG + Intergenic
1036148220 8:6274616-6274638 CTTGAGAAGAGAACAGGGGGCGG - Intergenic
1036548168 8:9792148-9792170 CCAGAGAAGAACACAGTTGGAGG + Intergenic
1037883535 8:22584799-22584821 CCTGAGAAGGCAACAGAGGGAGG - Exonic
1039241979 8:35567203-35567225 CCTGAGAAGAGAACCCAGGGAGG - Intronic
1039350491 8:36758845-36758867 ACTGAGAATAAGACTGAGGGAGG - Intergenic
1039476048 8:37839934-37839956 CCTGGGGTGAAGGCAGAGGGTGG + Intronic
1041190924 8:55353374-55353396 CCTGTGAAGAAGACAGAAATTGG + Intronic
1041706163 8:60848492-60848514 CTGGAGAGGAAGACAGAGGGGGG - Intronic
1041719901 8:60966148-60966170 CCTTAGAAGAAGAAAGAAAGAGG - Intergenic
1042037944 8:64557570-64557592 CCTGAGAAAATGAGAGAGGCTGG + Intergenic
1042442901 8:68848534-68848556 CCCGATACAAAGACAGAGGGAGG - Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1042948854 8:74180356-74180378 CTTAAGAAGATGGCAGAGGGGGG + Intergenic
1043296057 8:78665452-78665474 CAAGAGTAGAAGACAGAGGGAGG + Intergenic
1043625550 8:82253464-82253486 CCTGAGAAAAAGAGAGAATGAGG - Intergenic
1044077848 8:87845709-87845731 CCTGAAAAGAAGAAAAAGGTTGG + Intergenic
1046208105 8:111030527-111030549 CAAGAGAGGAAGAAAGAGGGAGG + Intergenic
1047560323 8:125980612-125980634 CCTGAAAAAAAAAAAGAGGGGGG - Intergenic
1049433066 8:142574214-142574236 CCAGGGCAGAAGGCAGAGGGTGG - Intergenic
1049514380 8:143045659-143045681 GCTGAGAATCAGCCAGAGGGAGG - Intronic
1049946151 9:597963-597985 TCTTAGAAGAAAACATAGGGAGG - Intronic
1050096302 9:2070421-2070443 GCTGAGGAGAATGCAGAGGGTGG + Exonic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1050365656 9:4871257-4871279 CCTGAGAAGAAGAGTGAGAAAGG + Intronic
1050430694 9:5558780-5558802 CAAAAGAAAAAGACAGAGGGAGG + Intronic
1051190609 9:14507723-14507745 AGTGAGAAGAAGAAAGAGGTTGG + Intergenic
1051254131 9:15194865-15194887 CCTGAGGAGGAGAGAGATGGAGG - Intronic
1051372843 9:16372984-16373006 CCAGCAGAGAAGACAGAGGGCGG + Intergenic
1051385396 9:16502554-16502576 CCCAAGAAGAAGTAAGAGGGGGG - Intronic
1051738153 9:20224683-20224705 GCAGAGAAGAAGAGGGAGGGAGG + Intergenic
1052081623 9:24213140-24213162 CCTGAGAAGAAGAGAAAGCATGG - Intergenic
1052542345 9:29827329-29827351 TCTCAGAAGAAGACAGGGTGAGG + Intergenic
1052899670 9:33781523-33781545 CTTGAGGGGAAGAGAGAGGGAGG + Intronic
1055018063 9:71640405-71640427 CCTGAGAAGGGGAGAGTGGGTGG - Intergenic
1055920872 9:81459642-81459664 CATGAGAAGAAGAAACAGTGTGG - Intergenic
1056403312 9:86249241-86249263 CCTGGGAGTAAGACAGAGTGTGG + Intronic
1056798921 9:89677925-89677947 CCTAAGAAGAAGAAAGAGAGAGG + Intergenic
1056963618 9:91148092-91148114 CCCGAGAAGGAGAGAGAGAGAGG - Intergenic
1057307890 9:93922759-93922781 ACAGAGAAGAAGGAAGAGGGAGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1058328205 9:103725116-103725138 ACTGAAAAGAAGAGAGAAGGTGG + Intergenic
1059450556 9:114368785-114368807 CCTGAAAGGAAGACAGGGTGGGG + Intronic
1060481923 9:124021395-124021417 ACAGAGAAGCAGACACAGGGTGG - Intronic
1061604649 9:131699655-131699677 CCTGAGGAGGAGGCAGAGAGGGG - Intronic
1061728300 9:132593798-132593820 CCTGGGGAGACCACAGAGGGCGG + Exonic
1185516930 X:707048-707070 CCTCAGAGAAAGAGAGAGGGGGG + Intergenic
1186481078 X:9896204-9896226 CCTGAGAAGATGAACGAGGTGGG + Exonic
1187030185 X:15478774-15478796 TGTGAGCAGAAGGCAGAGGGAGG - Intronic
1188262084 X:28034183-28034205 CCTGAAAAGAGGACAGAATGGGG + Intergenic
1188331380 X:28875972-28875994 CAAGAGAAGAAGAAAGAGAGAGG - Intronic
1188607158 X:32045374-32045396 CCAGAGCAGAAGCCAGGGGGAGG - Intronic
1188651191 X:32633472-32633494 GCTCAGAAGAAGACAGATGAGGG - Intronic
1189208121 X:39259310-39259332 GCTGAGAAGAAGGAAGGGGGAGG - Intergenic
1189320320 X:40083568-40083590 CCGGCGAAGAAGAAAGGGGGAGG + Intronic
1189382063 X:40509055-40509077 CCTGAGAGGAAGACAGACCTGGG + Intergenic
1190931994 X:54956713-54956735 CCTGAGATGAGGACTGTGGGAGG - Intronic
1193066174 X:77262985-77263007 TCTTAAAAGAAGCCAGAGGGGGG + Intergenic
1194281926 X:91963566-91963588 GCTCAGAAGAAGACAGAAAGAGG - Intronic
1194704802 X:97162506-97162528 TGTGAGAAGAAGAGAGGGGGAGG - Intronic
1194848361 X:98839482-98839504 CATGAAAAGTAGACAGAGGGAGG - Intergenic
1195705388 X:107734532-107734554 CCCCAGCAGCAGACAGAGGGAGG - Intronic
1195961466 X:110391539-110391561 CCTGAGCAAAAGCCAGAGGTAGG - Intronic
1197193869 X:123678805-123678827 GCTGAGAGGATGAGAGAGGGAGG - Intronic
1198709972 X:139491014-139491036 CCAGAGCAGAAGTAAGAGGGAGG + Intergenic
1198769836 X:140118709-140118731 CATGAGAAAAACCCAGAGGGTGG - Intergenic
1199637830 X:149830158-149830180 CCTGAGAAGAAAGGAAAGGGGGG - Intergenic
1199713997 X:150492939-150492961 GGTCAGAAGAAGACAGAAGGTGG + Intronic
1200599522 Y:5188222-5188244 GCTCAGAAGAAGACAGAAAGAGG - Intronic
1200710072 Y:6475436-6475458 TCTGAGAAGAAAACAAATGGTGG - Intergenic
1200734791 Y:6782648-6782670 CCTGAGAAGAAAGGAAAGGGGGG - Intergenic
1201024043 Y:9689272-9689294 TCTGAGAAGAAAACAAATGGTGG + Intergenic