ID: 962270056

View in Genome Browser
Species Human (GRCh38)
Location 3:133971037-133971059
Sequence GGCAAATGCCACTGGCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962270053_962270056 -3 Left 962270053 3:133971017-133971039 CCTGTGGCTGCTCAGTGTGAGGC 0: 1
1: 0
2: 1
3: 26
4: 225
Right 962270056 3:133971037-133971059 GGCAAATGCCACTGGCATGTGGG 0: 1
1: 0
2: 2
3: 11
4: 140
962270051_962270056 4 Left 962270051 3:133971010-133971032 CCAGTCTCCTGTGGCTGCTCAGT 0: 1
1: 1
2: 2
3: 29
4: 294
Right 962270056 3:133971037-133971059 GGCAAATGCCACTGGCATGTGGG 0: 1
1: 0
2: 2
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962270056 Original CRISPR GGCAAATGCCACTGGCATGT GGG Intronic
903850187 1:26301231-26301253 GGCCAATGCCAATGCCATGGTGG + Intronic
905918386 1:41701496-41701518 GACAAATGCCACAGGCTGGTGGG + Intronic
906142142 1:43540166-43540188 GGGAGATGCTACTGGCATCTAGG - Intronic
906618870 1:47257126-47257148 TGCAAATGCCAATGGCAAGTAGG + Intronic
908394462 1:63712864-63712886 GGCAAATGCCAGGGGTGTGTGGG - Intergenic
914521847 1:148424657-148424679 GGCAAAAGCCACTGGCTCCTAGG + Intergenic
917005230 1:170407838-170407860 AGCAACTGCCACAGTCATGTAGG + Intergenic
918553644 1:185773201-185773223 GGGGAAAGCTACTGGCATGTAGG + Intronic
1065797807 10:29323176-29323198 GGCAAATGACAGTGGCCTGATGG - Intergenic
1069568947 10:69482776-69482798 GGGAAATGCCACTGGCTGGAGGG - Intronic
1070716979 10:78729560-78729582 GGCAACCTCCACTGACATGTTGG + Intergenic
1074888393 10:117713648-117713670 GGCAACTGCCACTGCTTTGTTGG + Intergenic
1074928993 10:118104064-118104086 AGCAAATGCCACTGGCCCCTGGG + Intergenic
1077892605 11:6430349-6430371 AGCAAATGTCACTGGCAAGGAGG - Intergenic
1080295123 11:30717854-30717876 GGCAATTGCAAGTGGCAGGTTGG - Intergenic
1084603669 11:70160752-70160774 GGGACAAGCCACTGGCATGGCGG + Intronic
1085708181 11:78805423-78805445 GGCGAATGCCACTGCTCTGTGGG - Exonic
1088520993 11:110700469-110700491 AGTAAATGCTACAGGCATGTAGG - Intronic
1089166947 11:116484673-116484695 GGCGAATGCCACGGGCAGATTGG + Intergenic
1089981090 11:122773176-122773198 GGCCAATGCCAAGGGCAAGTGGG - Intronic
1094505977 12:31061398-31061420 GGAAATTGCCTCTGGGATGTTGG - Intergenic
1094519897 12:31175427-31175449 GGCAAAAGTCAGGGGCATGTGGG + Intergenic
1095054328 12:37581966-37581988 GGCAAATGCCTGGGGTATGTAGG - Intergenic
1095735560 12:45552847-45552869 GGCAACAGCCACTGGCTTGCAGG + Intergenic
1098562848 12:71896368-71896390 GGCAAATGCCACTGGAATGCAGG - Intronic
1098679262 12:73329433-73329455 GACAAGTGTCACTGGCATATCGG + Intergenic
1100112437 12:91261733-91261755 GGCAGATACCACTGGGATCTGGG + Intergenic
1104710746 12:130984084-130984106 GGCTGATGCCAATGGCCTGTGGG + Intronic
1106293722 13:28390736-28390758 GGCAAGTGACACTGGCAAGTGGG + Intronic
1106556999 13:30818437-30818459 GGAAAATGACTCTGGAATGTGGG - Intergenic
1107057628 13:36124359-36124381 GGCCAAGTCCACAGGCATGTTGG + Intronic
1108120414 13:47179648-47179670 TGCAAATGACCCTGGCATGTAGG - Intergenic
1109903413 13:68805617-68805639 GGCAAAAGCAATTGGCATATGGG - Intergenic
1110722983 13:78786547-78786569 GGCAAACTCCACAGGCATTTGGG + Intergenic
1120910772 14:89664713-89664735 GGCAACAGCCACTGGAATATAGG - Intergenic
1121902754 14:97708881-97708903 CCCATATGCCACTGGCATGCTGG + Intergenic
1123794472 15:23757662-23757684 GGCCAATGCCACTGATAAGTGGG - Intergenic
1124824882 15:33083970-33083992 TGCAAATGCCATGGTCATGTTGG + Intronic
1125159704 15:36628669-36628691 GGCAAATGTATCTGGCATGTGGG + Intronic
1127061605 15:55191881-55191903 GGCAGCTGCCACTTGCATTTGGG + Intronic
1127297724 15:57624487-57624509 GCCCATTCCCACTGGCATGTGGG + Intronic
1128254443 15:66186409-66186431 GGCAAATTCCAATGGCTTGGGGG - Intronic
1129689449 15:77705125-77705147 GGCAGAGGCCAGTGGCATGAGGG - Intronic
1131484834 15:92811073-92811095 TGCAAATGCCATTGGCATACCGG + Intergenic
1132077148 15:98831330-98831352 GGAGTATGCCACTGGCAGGTGGG - Intronic
1140230256 16:73112097-73112119 GGGAGATGCCCCGGGCATGTTGG + Intergenic
1140838458 16:78817379-78817401 GGCAAATGCTTCTGGCAGGCTGG - Intronic
1140866499 16:79066925-79066947 GGCAGATGGGACTGGCTTGTTGG + Intronic
1141367308 16:83455687-83455709 CGCCAATGCCACTGACATATAGG - Intronic
1141396526 16:83710077-83710099 GGGGAATGCCACTGGCATCTAGG + Intronic
1144790557 17:17856235-17856257 TGCAAAGGCCCCTGACATGTGGG + Intronic
1145374868 17:22338030-22338052 GGCAAATGCCTGGGGTATGTAGG - Intergenic
1146415906 17:32632723-32632745 GGCAAATGACAGTGTTATGTTGG + Intronic
1147596482 17:41721305-41721327 CACAGATGCCACTGGCCTGTGGG - Intronic
1147910775 17:43854652-43854674 GGCTGGTGTCACTGGCATGTGGG - Intronic
1152530022 17:80912816-80912838 GGCAAATGCCACTTTTATGGCGG - Intronic
1155368222 18:25070691-25070713 GGAAGATGCCACTAGCATGTTGG - Intronic
1157084827 18:44569170-44569192 TTCAAATGCCACTGGCCTGAGGG + Intergenic
1157168836 18:45383749-45383771 AGCACATGCCACTGGGATGGTGG - Intronic
1158951486 18:62499398-62499420 GGCAAAAGCCACTGGCCTGTGGG + Intergenic
1164895481 19:31873631-31873653 GGTAAGTGCCACTGGAAGGTGGG - Intergenic
1165045327 19:33100302-33100324 AGCCAATGCACCTGGCATGTTGG - Intronic
1165632369 19:37312586-37312608 GGCAAATGCCTGGGGTATGTAGG + Intergenic
927861200 2:26561352-26561374 GGCAAATGCCAATGAAATGAAGG - Intergenic
929096598 2:38268382-38268404 TGGAAATGCGACTGGAATGTTGG - Intergenic
931766419 2:65460672-65460694 AGCAAATGCCTCTTGCATATGGG + Intergenic
932574950 2:72957636-72957658 GGCAAATCCCACTGGCTTCTGGG + Intronic
936040099 2:109143024-109143046 GGAAAGTGCCACTGGGATGCTGG + Intronic
938200800 2:129371526-129371548 GCCCAATGCCACTGGCAAGTAGG - Intergenic
940043014 2:149380057-149380079 GGCAAATGCCACAGGTATCTGGG + Intronic
941633925 2:167915014-167915036 GGTAAATCCCAGTGGTATGTTGG - Intergenic
941748461 2:169111366-169111388 TGCTAGTGCCACTGGCAGGTTGG - Intergenic
946428598 2:219613123-219613145 TGCCAATGCCACTGGCACCTGGG - Exonic
947377394 2:229510469-229510491 GGCAAAGGCCACTAGCCTGAAGG + Intronic
948545860 2:238728186-238728208 GGCAAATTCCACTCCCAAGTTGG + Intergenic
948907841 2:240988250-240988272 TGCCAATGCCACAGGCTTGTTGG + Intronic
1169806986 20:9569584-9569606 GTCAAATGCCACTGAGAAGTGGG + Intronic
1170171351 20:13416887-13416909 GACGAGTGCCACAGGCATGTGGG + Intronic
1171253124 20:23665221-23665243 GGCAGGTGCTACTGGCATTTAGG + Intergenic
1171259614 20:23720534-23720556 GGCAGGTGCTACTGGCATTTAGG + Intergenic
1173650821 20:44663043-44663065 GGCAGCTGCCCCTGGCCTGTGGG - Intergenic
1173811402 20:45957968-45957990 GGCAAATGGCACTTGAATCTGGG - Intronic
1176658292 21:9609048-9609070 TGCTAATGCCACTGACATGATGG - Intergenic
1179018424 21:37615868-37615890 GGCAAATGTGACTGGAGTGTGGG + Exonic
1180100131 21:45579965-45579987 GTCAGATGCCTCTGGGATGTCGG + Intergenic
1180169460 21:46050375-46050397 GGCCAATGCTCCTGGCTTGTGGG - Intergenic
1182796850 22:32997133-32997155 AGCAAATGCTACTGACATCTGGG - Intronic
1184524213 22:45012157-45012179 TGTAAATGCCACTGGCTTCTTGG + Intergenic
1184728987 22:46362965-46362987 GCCAAAGGCCACAGGCATGAGGG - Exonic
1185049099 22:48544354-48544376 AGCCAATGCCACTGGCTTGGGGG + Intronic
949732807 3:7133419-7133441 GGAATATGCTACTGGCATCTAGG + Intronic
950089167 3:10283041-10283063 TACAAATGTCACTGGCATTTGGG - Intronic
950398278 3:12750836-12750858 GGAAAGTGCTACTGGCATCTGGG - Intronic
961508581 3:127387759-127387781 AGCAAGTGACACTGGCAGGTGGG - Intergenic
962270056 3:133971037-133971059 GGCAAATGCCACTGGCATGTGGG + Intronic
966325471 3:178748432-178748454 GTCAGATGCCACTGGAGTGTTGG + Intronic
971081325 4:23215246-23215268 GAGAAATTCCACTGGCATCTGGG + Intergenic
975409044 4:74026404-74026426 GACAAATGCCATTGGAATTTTGG + Intergenic
976541447 4:86281668-86281690 AGGAAATCCCACTGGAATGTTGG + Intronic
984013746 4:174402143-174402165 GGCAAATGCCACAGACATCAAGG + Intergenic
985417120 4:189747025-189747047 TGCTAATGCCACTGACATGACGG + Intergenic
989117368 5:37968293-37968315 GGCCAATGCCACTGGTCTGTGGG - Intergenic
996111657 5:119573179-119573201 GGCCCAGGCCCCTGGCATGTGGG + Intronic
998477740 5:142435749-142435771 GTCAAATGCAACTTGCGTGTGGG + Intergenic
1001117339 5:168950802-168950824 GGCAATTGCAACTGCCATTTTGG - Intronic
1003017372 6:2478773-2478795 GGCTAATGCCCCTGCCCTGTTGG - Intergenic
1003261370 6:4519324-4519346 AACACATGACACTGGCATGTTGG - Intergenic
1004389891 6:15201324-15201346 TGAAGATGCCACTGGCTTGTGGG + Intergenic
1007962224 6:45970167-45970189 GCCAAGTGCCCCTGTCATGTGGG + Intronic
1008874298 6:56308866-56308888 AGCAAATTCCACTGGGAAGTAGG + Intronic
1010721023 6:79283420-79283442 GGCAATTGCAGCTGGCTTGTGGG + Intergenic
1012171599 6:96023478-96023500 GGCAAATGGCAGAGGAATGTTGG + Intronic
1012937385 6:105382729-105382751 GGCAAGTGCCATTGGCAGGCAGG + Intronic
1016389931 6:143564694-143564716 GGTAAATGCCACTGGCTGATCGG + Intronic
1017149854 6:151269251-151269273 TGAAAATGCCACTGACATTTTGG - Intronic
1018423989 6:163663662-163663684 TGGAAACTCCACTGGCATGTGGG + Intergenic
1023282522 7:38585686-38585708 GGAAAATTCCACTGGCACGGTGG - Intronic
1024192862 7:47030638-47030660 AGCAAATGTCCCTGGGATGTAGG - Intergenic
1024536644 7:50440370-50440392 GGCAAATGGTACTGGGTTGTTGG - Intergenic
1025297710 7:57789502-57789524 GGCAAATGCCTGGGGTATGTAGG - Intergenic
1026526689 7:71159690-71159712 AGCAGATGCCCCAGGCATGTTGG - Intronic
1026813134 7:73486043-73486065 GAAAAATGCCACTGACATTTGGG - Intronic
1027579298 7:79973870-79973892 GAAAAATGCTACTGCCATGTGGG - Intergenic
1033756314 7:144400342-144400364 GACAAATGCCAGTGACAGGTAGG + Intronic
1034355531 7:150448257-150448279 GGCAAACGCCACCGGCATCGGGG - Intergenic
1036608540 8:10329644-10329666 GACACATGACACTGGCAGGTTGG - Intronic
1037672696 8:21028955-21028977 GGCAAAGGCCACTGGGACGATGG - Intergenic
1040509637 8:48082910-48082932 GTCAAATGCTACAGCCATGTTGG + Intergenic
1044790104 8:95838461-95838483 GTCAAATGAGACTGGCATGGAGG - Intergenic
1046171268 8:110510276-110510298 TATAAATGCCACTTGCATGTTGG + Intergenic
1048460317 8:134615966-134615988 GGCAAATGCCAGGTGCATTTAGG + Intronic
1048849886 8:138634841-138634863 TGCAAGTCCCACAGGCATGTGGG - Intronic
1050741497 9:8825811-8825833 TGCAAATGCCATGGGAATGTCGG - Intronic
1051694883 9:19757606-19757628 GGGAAATTCCACTGGCTTATTGG - Intronic
1053285429 9:36847007-36847029 GGCAAATGCCATTGGCAACCAGG - Intronic
1053653456 9:40192419-40192441 GACAAATGACACTGTCATCTGGG - Intergenic
1053795897 9:41726529-41726551 GGCAAATGCCTGGGGTATGTAGG + Intergenic
1053903859 9:42821709-42821731 GACAAATGACACTGTCATCTGGG - Intergenic
1054184304 9:61938600-61938622 GGCAAATGCCTGGGGTATGTAGG + Intergenic
1054531127 9:66183799-66183821 GACAAATGACACTGTCATCTGGG + Intergenic
1054654202 9:67649895-67649917 GGCAAATGCCTGGGGTATGTAGG - Intergenic
1060408167 9:123382853-123382875 GGCAACCGCCACTGGCATAAAGG - Intronic
1062506915 9:136882306-136882328 GGCAGATGCCAGTGGCATGGCGG + Intronic
1203636023 Un_KI270750v1:112623-112645 TGCTAATGCCACTGACATGATGG - Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186516298 X:10168218-10168240 GCCAAACCCCACTGGCATTTGGG - Intronic
1186861892 X:13680948-13680970 GGAAACTGCCACTGGCATTCTGG + Intronic
1191140891 X:57115566-57115588 GGCAAATGGCACTGGAGTTTAGG + Intergenic
1191894991 X:65982989-65983011 GACATATGTCTCTGGCATGTTGG - Intergenic
1192304862 X:69948463-69948485 GCCAAATGAAACTGGCATCTTGG - Intronic
1194624737 X:96214534-96214556 TGCCTATGCCACTGGCATCTTGG + Intergenic
1195755432 X:108194663-108194685 GGCAAATGGCACAGGGATCTTGG + Intronic
1199229525 X:145420000-145420022 GGAAAATACCACTGGAATTTTGG + Intergenic
1200133174 X:153862433-153862455 CCCAAAGGCCCCTGGCATGTGGG + Exonic