ID: 962271434

View in Genome Browser
Species Human (GRCh38)
Location 3:133980542-133980564
Sequence TCTCCTGGAAGGCGCCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962271432_962271434 -9 Left 962271432 3:133980528-133980550 CCTATTCTCAAGCATCTCCTGGA 0: 1
1: 0
2: 1
3: 10
4: 168
Right 962271434 3:133980542-133980564 TCTCCTGGAAGGCGCCCCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 125
962271430_962271434 -1 Left 962271430 3:133980520-133980542 CCAGGAGTCCTATTCTCAAGCAT 0: 1
1: 0
2: 1
3: 5
4: 109
Right 962271434 3:133980542-133980564 TCTCCTGGAAGGCGCCCCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 125
962271429_962271434 15 Left 962271429 3:133980504-133980526 CCGAACAGGCTCTGAGCCAGGAG 0: 1
1: 0
2: 1
3: 25
4: 265
Right 962271434 3:133980542-133980564 TCTCCTGGAAGGCGCCCCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962271434 Original CRISPR TCTCCTGGAAGGCGCCCCTC TGG Intronic
900548068 1:3239542-3239564 TCTCCTTGAAGAAGCCCCTATGG - Intronic
900852808 1:5157395-5157417 GCTTCTGGAAGACGCCCCTGTGG - Intergenic
903126523 1:21251894-21251916 CCTCCTGGTAGGAGGCCCTCAGG + Intronic
911669580 1:100592648-100592670 GCATCTGGAAGGGGCCCCTCTGG + Intergenic
911691959 1:100845020-100845042 TCACCTGGCGGGTGCCCCTCTGG - Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
917584894 1:176416546-176416568 GCACCTGGCAGGTGCCCCTCTGG - Intergenic
918360307 1:183750942-183750964 GCACCTGGCAGGTGCCCCTCTGG - Intronic
918631994 1:186729976-186729998 GCACCTGGCAGGTGCCCCTCAGG - Intergenic
1064992435 10:21267581-21267603 TCTCCTTGGAGACACCCCTCTGG + Intergenic
1071997693 10:91163372-91163394 AGGACTGGAAGGCGCCCCTCTGG - Intronic
1073301619 10:102474442-102474464 TCTCCGAGAAGGTGCCCCTCAGG + Intronic
1073996004 10:109316305-109316327 TCTCTTGGAAGTCTCCCCTGAGG + Intergenic
1074213435 10:111360394-111360416 TCTCTCTGCAGGCGCCCCTCTGG + Intergenic
1076548515 10:131261984-131262006 GCTCCTGGAAGGCACCACACAGG - Intronic
1076887904 10:133270965-133270987 TCTCCTGGAAGGCGTCTTCCGGG + Exonic
1077290036 11:1784842-1784864 TCTCCTGGCAGGTGCCCACCTGG + Intergenic
1077413435 11:2413898-2413920 GTTCCTGGAAGGCGCCCACCTGG - Intronic
1077532080 11:3102062-3102084 TCCCCTGGAAGCCGGCCCTCGGG + Intronic
1081613636 11:44578112-44578134 CCTCCTGGGAGGCCGCCCTCAGG - Intronic
1082848051 11:57741908-57741930 TCACCTCGAAGCTGCCCCTCCGG - Exonic
1083813955 11:65121575-65121597 GCTCCTGGCAGGCGCGCCCCTGG - Exonic
1084659338 11:70537871-70537893 CCTCCTGGAAGACCCCCCACGGG - Intronic
1085295907 11:75431491-75431513 TCAGCTGGAAGGTTCCCCTCAGG - Intergenic
1087703716 11:101466153-101466175 TATCCTGGAAGGTGCCCCTTTGG - Intronic
1094007887 12:25774732-25774754 TTCCCTGGAAGGGGCTCCTCAGG - Intergenic
1096780810 12:53991089-53991111 TCTCCTCGAAGTCGACACTCTGG + Intronic
1098151785 12:67555092-67555114 GCACCTGGCAGGCACCCCTCTGG - Intergenic
1103582195 12:121923760-121923782 TCCCCTGAAAGGCAGCCCTCAGG + Exonic
1105330482 13:19411187-19411209 TCTCATGGAAGGCAGCTCTCTGG - Intergenic
1105918561 13:24939973-24939995 TCTCATGGAAGGCAGCTCTCTGG - Intergenic
1106826897 13:33532902-33532924 TCACCTGGAAGGTGCCCATCTGG - Intergenic
1111114293 13:83755184-83755206 GCATCTGGCAGGCGCCCCTCTGG + Intergenic
1112165935 13:96919477-96919499 GCACCTGGCAGGTGCCCCTCTGG + Intergenic
1112450793 13:99507680-99507702 TCTTCAGGAAGGCGCCACTGTGG + Intronic
1121839467 14:97120674-97120696 TCTCCAGGAAGGGGGCCCTGTGG - Intergenic
1126420276 15:48465129-48465151 TCTCCTAGAAGGCGGCCCTTTGG - Intronic
1129270604 15:74417485-74417507 GCTCCTGGAAGTCCCTCCTCCGG + Intronic
1131983411 15:98017514-98017536 TATCCTGGAATGCTCTCCTCAGG + Intergenic
1132828821 16:1917866-1917888 TCCCCAGGAAGGCGCCGGTCAGG + Intronic
1132838924 16:1968823-1968845 TCTGCTGGAGGGTGCCCCACAGG + Exonic
1138345025 16:56315517-56315539 TCTCCTGGATGGGGGCTCTCTGG - Intronic
1139407114 16:66727780-66727802 TCTCCTGCAAGAGGACCCTCTGG - Exonic
1139594790 16:67951278-67951300 TCTCCAGGTAGGCGCTCCACAGG + Exonic
1141842288 16:86580896-86580918 TCCGCTGGAAGGGGCCTCTCTGG + Exonic
1148135658 17:45290118-45290140 TCTCCTGGAAAGCCCCACTGGGG - Intronic
1151964675 17:77425229-77425251 TTTCCTGGGAGGCCCTCCTCCGG - Intronic
1152019457 17:77772834-77772856 CGTCCTGGAAGGCAGCCCTCTGG + Intergenic
1152474431 17:80508818-80508840 CCTCCTTGAAGGTGCCACTCAGG + Intergenic
1152856445 17:82667437-82667459 TCTCATGGAAGGCGCTGCACAGG - Intronic
1153238824 18:3013045-3013067 GCTCCTCGCAGGCGTCCCTCCGG - Intronic
1160194005 18:76737957-76737979 TCTACTGGGAGGCCCCCCCCAGG - Intergenic
1160437073 18:78859906-78859928 GCTCCAGGAAGCCACCCCTCTGG - Intergenic
1160872925 19:1285405-1285427 CCTCCTGGGAGTCGCCTCTCCGG - Intergenic
1162235193 19:9303530-9303552 TCTCCTGGCATGCCACCCTCCGG + Intronic
1163424827 19:17235577-17235599 GCTCCTGGAAGGCGCGCACCTGG + Exonic
1164615960 19:29666885-29666907 ATTCCTGGAAGGCCCTCCTCCGG - Intronic
1165403186 19:35614745-35614767 CCTCCTGGAAGCCTCCCCTTAGG - Intronic
926577216 2:14595502-14595524 TCACCTGGAAGGAGCCACACAGG + Intergenic
928625040 2:33130997-33131019 TCACCTGGTAGGTGCCACTCGGG + Intronic
930153149 2:48078495-48078517 CCTCCTGGCAGGCACCCCACAGG + Intergenic
932592414 2:73075356-73075378 GCTGCTGGAAGGGGGCCCTCTGG - Exonic
936031966 2:109079786-109079808 CCTCCTGGAAGGCTCACATCAGG - Intergenic
942928181 2:181457687-181457709 TCTCCCGGACGGCGGCCCTTCGG - Exonic
945779721 2:214154345-214154367 TCTACTGGAAAGTGCCCATCTGG - Intronic
947118504 2:226795870-226795892 TCTCCTGCCAGGCTGCCCTCCGG + Exonic
948789845 2:240371578-240371600 TCCCCTGGAAGGGGCCCTGCAGG + Intergenic
948933647 2:241149051-241149073 TCTCCTGGAGCTCGCCCCGCAGG + Intronic
1169491567 20:6075733-6075755 TCTCCTAGGATGCACCCCTCAGG - Exonic
1170727252 20:18941229-18941251 TCACCTGGCAGGGGCCCCTCTGG - Intergenic
1170991025 20:21302066-21302088 TTACCTGGAAGCAGCCCCTCTGG - Intergenic
1171349194 20:24490065-24490087 TATCCTGGAGGGTGCCTCTCTGG - Intronic
1176125760 20:63473748-63473770 TGTCCTGGGAGGGGTCCCTCTGG + Intergenic
1176180185 20:63746257-63746279 CCTCCTGGAAGGAGCCCCCAGGG + Exonic
1178284423 21:31313410-31313432 TCTTCTGGGAGGCTCCCATCTGG + Intronic
1180564407 22:16650651-16650673 TCTCATGGAAGGCAGCTCTCTGG + Intergenic
1181728533 22:24828023-24828045 TCTCCTGAAAGGCCCCCTTTGGG + Intronic
949683327 3:6540868-6540890 GCATCTGGAAGGTGCCCCTCTGG - Intergenic
951685165 3:25335657-25335679 TCTCCAGCAAGGCCCCTCTCAGG - Intronic
953926451 3:46985093-46985115 TCTGCTGGAATGCCCCCATCAGG - Intronic
955494840 3:59520502-59520524 CCTCCAGGAAGCCGCTCCTCAGG - Intergenic
960343776 3:116507113-116507135 TCTCCTTGAAGGGGTCCTTCAGG + Intronic
961530037 3:127535007-127535029 ACTCCTGGAAGGAGCCACTCAGG - Intergenic
962271434 3:133980542-133980564 TCTCCTGGAAGGCGCCCCTCTGG + Intronic
968223577 3:196957746-196957768 TCTCCTGTTAGGCTTCCCTCCGG + Intronic
968434153 4:576323-576345 CCTCCTGGGAGGGGCCCCGCGGG - Intergenic
968816653 4:2824949-2824971 TGTCCTGGGAGGTGCCCCTGTGG + Intronic
972453926 4:39233217-39233239 TCTCCTGCAATGCTCACCTCTGG - Intronic
973647119 4:52960996-52961018 TCTCCTGCAAGGTCCCGCTCAGG - Intronic
981133904 4:141189278-141189300 GCTTCTGGAGGGTGCCCCTCTGG - Intronic
985795956 5:1962263-1962285 TTTCCTAGAAGGCGCCCACCTGG + Intergenic
987230775 5:15891672-15891694 TATTCTGGAAGGCTTCCCTCTGG + Intronic
987924001 5:24317347-24317369 GCACCTGGCAGGTGCCCCTCTGG - Intergenic
992059271 5:73025896-73025918 TCTTTTGTAAGGAGCCCCTCTGG + Intronic
995508559 5:112885173-112885195 TCTCCTGGCTGGCTCCTCTCTGG - Intronic
998319027 5:141211089-141211111 TGTCCTGGAAAGGGGCCCTCAGG - Exonic
998319593 5:141216305-141216327 TGCCCTGGAAGGGGGCCCTCGGG - Exonic
999468741 5:151831907-151831929 GCACCTGGCAGGTGCCCCTCTGG + Intronic
1001643865 5:173265492-173265514 CCACCTGGCAGGGGCCCCTCTGG + Intergenic
1002426942 5:179182092-179182114 CCCCCTGGAAGGCCCCCCGCAGG + Intronic
1002512174 5:179727934-179727956 TCTCCCGGAAAGCTCTCCTCAGG + Intronic
1002576966 5:180179371-180179393 TCTCCTGAAATGCTGCCCTCTGG - Intronic
1004534335 6:16485341-16485363 TCTCATGCAAGGCGGCCATCAGG + Intronic
1005806246 6:29476624-29476646 TCACCTGGAAGGTGACCCTGAGG - Intergenic
1006170682 6:32090386-32090408 TCTCCTGGAATGCCCACCACTGG + Intronic
1006604022 6:35243649-35243671 TCTCCTGGAAGGTGCCCGCTGGG - Exonic
1012597035 6:101053531-101053553 GCACCTGGCAGGTGCCCCTCTGG - Intergenic
1013283026 6:108656479-108656501 TTTCCTGGAAGGGGCCGCCCTGG + Intronic
1014386994 6:120815568-120815590 GCTCCTGGTGGGAGCCCCTCTGG - Intergenic
1015692352 6:135939183-135939205 TCTTCTGGAAGGGTCACCTCAGG + Intronic
1018635191 6:165854517-165854539 GCTCCTTGAGGCCGCCCCTCAGG - Intronic
1018894281 6:168002410-168002432 TCTCCTGGATGGTGCGGCTCTGG + Intronic
1022473968 7:30698452-30698474 TCTCCTGGAAGGCACCTATCTGG + Intronic
1023382629 7:39623721-39623743 TCGCCTGGAAGGCCCCGCGCCGG - Exonic
1028561931 7:92185441-92185463 TCTCCTTGAAGGGGTCCTTCAGG + Intergenic
1029675210 7:102064002-102064024 CCGCCTGGAAGGCGCCTCCCAGG - Intronic
1035255362 7:157622480-157622502 TCTCCTGGAACGGGCCCCAGTGG - Intronic
1037996560 8:23356725-23356747 TTTCCTAGAAGGCCTCCCTCTGG - Intronic
1038083225 8:24163902-24163924 GCACCTGGCAGGTGCCCCTCTGG - Intergenic
1038567196 8:28629576-28629598 ACTCCTGGATGGGGCCCCTCGGG + Intronic
1040286084 8:46101108-46101130 TCTCCTGGAAGGAGGCCTTCCGG + Intergenic
1041583887 8:59494507-59494529 GCACCTGGAAGGTGCCCCTCTGG - Intergenic
1045295781 8:100870661-100870683 TCTGCTGGAAGGTGGCCCACTGG + Intergenic
1045916650 8:107480060-107480082 TCTTCTGGAAGGCAGACCTCAGG + Intronic
1049393237 8:142382725-142382747 TCTCCTGGAAAGCTGGCCTCTGG - Intronic
1049708792 8:144054564-144054586 CCTCCTGGAAGACGCCCCCCTGG + Exonic
1052325680 9:27214839-27214861 TCACCTGGAAGCCAGCCCTCAGG - Intronic
1055945645 9:81689224-81689246 TCTCGTGGATGTCGTCCCTCGGG - Exonic
1060016665 9:120092613-120092635 TCTCCTTCAAAGCTCCCCTCTGG + Intergenic
1061419715 9:130466624-130466646 TCTCCTGGGAGGGGCCCATGGGG - Intronic
1061431337 9:130533237-130533259 TCTCCTTCATGGCTCCCCTCGGG - Intergenic
1187945946 X:24426668-24426690 TCTCCAGGATGGCTGCCCTCAGG - Intergenic
1188893210 X:35635755-35635777 GCATCTGGTAGGCGCCCCTCTGG - Intergenic
1191237968 X:58151376-58151398 GCTTCTGGCAGGTGCCCCTCTGG + Intergenic
1191830079 X:65406984-65407006 TCTCGTGGATGTCGTCCCTCGGG + Intronic
1199612685 X:149631553-149631575 AGTCCTGGAAGAGGCCCCTCAGG + Exonic
1201485359 Y:14488330-14488352 TATCTTGGAAGAAGCCCCTCTGG + Intergenic
1201850862 Y:18478421-18478443 GCACCTGGCAGGTGCCCCTCTGG - Intergenic