ID: 962276165

View in Genome Browser
Species Human (GRCh38)
Location 3:134015255-134015277
Sequence CAAGATTTCCCCCTTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 9, 3: 116, 4: 779}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962276165_962276167 8 Left 962276165 3:134015255-134015277 CCTTTTAAAAGGGGGAAATCTTG 0: 1
1: 0
2: 9
3: 116
4: 779
Right 962276167 3:134015286-134015308 TGCAACATGGATAAATCTAGAGG 0: 1
1: 3
2: 71
3: 457
4: 2599
962276165_962276166 -5 Left 962276165 3:134015255-134015277 CCTTTTAAAAGGGGGAAATCTTG 0: 1
1: 0
2: 9
3: 116
4: 779
Right 962276166 3:134015273-134015295 TCTTGTCAGTTGCTGCAACATGG 0: 1
1: 2
2: 73
3: 878
4: 4095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962276165 Original CRISPR CAAGATTTCCCCCTTTTAAA AGG (reversed) Intronic
900864638 1:5259621-5259643 CAAATTTTCCCCTTTTTATAAGG + Intergenic
903084905 1:20847490-20847512 CATATTTTTCCCCTTTTAAAGGG + Intronic
903587133 1:24424702-24424724 CAGGTCTTCCCTCTTTTAAAGGG - Intronic
903976926 1:27156215-27156237 CCAGATTTCCCCTTTTTATAAGG + Intronic
904294941 1:29514068-29514090 CCAGGTTTCCCCTTTTTACAAGG + Intergenic
905478098 1:38242976-38242998 CCAAATTTCCCCCTTTTATAAGG - Intergenic
905767501 1:40613577-40613599 CAGGATCTCCTCCTTTTTAAAGG + Intergenic
906267154 1:44441131-44441153 AAGGATTTCCCCCCTTTAACTGG - Intronic
906611115 1:47204068-47204090 CAGGATTTCACCCTTTTTTATGG - Intergenic
906734565 1:48113142-48113164 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
907022524 1:51082333-51082355 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
907060579 1:51419145-51419167 CAACATTTCCCCCTTGGAATTGG + Intronic
907349801 1:53818737-53818759 CAAGATTTCCTTCTTTTTAAAGG + Intronic
907539061 1:55195611-55195633 CAAGATTGCCTTCTTTTTAAAGG - Intronic
907617686 1:55941079-55941101 CAAGATATCCCACATTTTAAAGG - Intergenic
907732792 1:57084209-57084231 CCAGATTTCCTTCTTTTATAAGG - Intronic
908113277 1:60917829-60917851 CCACATTTCCCCTTTTTATAAGG + Intronic
908371192 1:63479769-63479791 CAGGATTTCCCTCTTTTTAAAGG + Intronic
908877970 1:68699428-68699450 CAGGATCTCCTCCTTTTTAAAGG + Intergenic
909218049 1:72917081-72917103 CAAGATTTCCTTCTTTTTTAAGG + Intergenic
909511878 1:76462459-76462481 TAAGATCTCACACTTTTAAAAGG - Intronic
910050730 1:82971094-82971116 CTAAATTTCCCCTTTTTACATGG - Intergenic
910494940 1:87816289-87816311 CCAGAGTACCTCCTTTTAAATGG - Intergenic
910566775 1:88652560-88652582 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
910802332 1:91158955-91158977 CAAAGTTTCCCCTTTTTATAAGG + Intergenic
911300086 1:96162009-96162031 CAGGATTTTCTCCTTTTTAAAGG - Intergenic
911349860 1:96740095-96740117 CAAGATTTCCTCCCTTTTTAAGG + Intronic
911949599 1:104155356-104155378 CAAGATTTCCCTTTTTTAAAAGG - Intergenic
912004951 1:104886561-104886583 CAAAATTTCCCCTTTTTATAAGG - Intergenic
912158951 1:106957329-106957351 CAAGATTTCATCTTTTTAAATGG - Intergenic
912603619 1:110964793-110964815 GAAGATATCTCCCTTTTCAAGGG + Intergenic
913279621 1:117173333-117173355 CCAAATTTCCCCTTTTTATAAGG - Intronic
914429432 1:147607159-147607181 CAGGATTTCCTTCTTTTTAAAGG + Intronic
914739225 1:150449608-150449630 CCAGATTTCACCTTTTTATAAGG + Intronic
917301444 1:173578800-173578822 CCAAATTTCCCCTTTTTATAAGG + Intronic
917911986 1:179658156-179658178 CAAGATTTCCTTCTTTTTAAAGG + Intronic
917919340 1:179737171-179737193 CAGGATTTCCTTCTTTTATAAGG - Intergenic
918524745 1:185453180-185453202 CTAAATTTCCCCTTTTTATAAGG - Intergenic
918860261 1:189815953-189815975 CAAACTTACCCCCTTTGAAAAGG - Intergenic
918875143 1:190031570-190031592 CAGGATTTCCCCCTTTTTAAAGG + Intergenic
918999006 1:191803748-191803770 CAAGATTTCCTTCTTTTAAATGG + Intergenic
919469488 1:197960658-197960680 CAAGATTTTCTCCCTTTTAAAGG + Intergenic
920598238 1:207294677-207294699 CAACATTTCCTTCTTTTTAAAGG + Intergenic
921098129 1:211904712-211904734 CAATATTTCCTTCTTTTTAAAGG + Intergenic
921431661 1:215073024-215073046 CCAAATTTCCCCCTTTTTAAAGG - Intronic
921447820 1:215266999-215267021 CAGGATTTCCTTCTTTTATAAGG - Intergenic
921799806 1:219389521-219389543 TAAAATTTTCCCCTTTTAAGGGG - Intergenic
922065093 1:222129573-222129595 CAGAATTTCCTCCTTTTTAAAGG - Intergenic
922111012 1:222555384-222555406 CAGGATTTCTTCCTTTTATAAGG - Intergenic
922141335 1:222890896-222890918 CCAGATTTCCTCTTTTTATAAGG + Intronic
922175780 1:223196005-223196027 CTAAATTTCCCCTTTTTATAAGG + Intergenic
922931086 1:229390226-229390248 CCAAATTTCCCCTTTTTATAAGG - Intergenic
923043833 1:230339672-230339694 CAAGACTTCCTCCTTTTTAAAGG - Intronic
923502991 1:234581713-234581735 CATGCTTTTCACCTTTTAAAGGG - Intergenic
923635230 1:235689312-235689334 CAGGATTTCCATCTTTTTAAAGG - Intronic
923930923 1:238695778-238695800 CAAGATTTCCTTCTTTTCTAAGG - Intergenic
924165710 1:241280173-241280195 CCAAATTTCCCCTTTTTATATGG - Intronic
924246536 1:242091109-242091131 CAAATTTCCCCCCTTTTACAAGG + Intronic
924326384 1:242898538-242898560 CCAAATTTCCCCTTTTTATAAGG + Intergenic
924689693 1:246334377-246334399 CATGATTTCACTCTTTTTAATGG - Intronic
1063164557 10:3448452-3448474 CAACATTTCCTTCTTTTTAAAGG + Intergenic
1063179356 10:3583959-3583981 CTGGTTTTCCCTCTTTTAAATGG - Intergenic
1063817130 10:9788210-9788232 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1064510839 10:16089350-16089372 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1064676469 10:17765120-17765142 CCAGATTTTCCCTTTTTAAAAGG + Intronic
1064933984 10:20659662-20659684 CAAGATGTCATCATTTTAAATGG + Intergenic
1065388886 10:25161864-25161886 CAAGATTTCCTTCTTTTTTATGG + Intergenic
1065413176 10:25453049-25453071 CAGGATTTCCTGCTTTTTAAAGG + Intronic
1066248141 10:33604810-33604832 CAAGATTTCCTTCTTTTCAAAGG - Intergenic
1067168830 10:43887659-43887681 CAAGATTTTCTTCTTTTTAAAGG - Intergenic
1067554657 10:47260285-47260307 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1068038953 10:51798827-51798849 CAAAATTACCCCATTTTAAGGGG - Intronic
1068372695 10:56138441-56138463 TATGATTTCCCCATTTTAAGTGG + Intergenic
1068641012 10:59407878-59407900 CAAGATTTCTTCCTTTTTTATGG + Intergenic
1069027595 10:63560613-63560635 CAAAATTTCCCCTCTTTAGACGG + Intronic
1069075860 10:64037772-64037794 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1069399145 10:68023357-68023379 CAGAATTTCCTCCCTTTAAAAGG - Intronic
1069403791 10:68076720-68076742 CCAAATTTCCCTCTTTTATAAGG + Intergenic
1071492926 10:86148285-86148307 CAGGATTTCCTTCTTTTCAAAGG - Intronic
1071871855 10:89804448-89804470 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1071938429 10:90557516-90557538 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1072021098 10:91402601-91402623 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1072077953 10:91997513-91997535 CAAGATTTTAACTTTTTAAAAGG - Intronic
1072177594 10:92944074-92944096 CAGAATTTCCCTCTTTTATAGGG + Intronic
1072860780 10:99003176-99003198 CAGGATTTCCTCCTTTTTTAAGG + Intronic
1072865073 10:99050677-99050699 CATAATTTCCTTCTTTTAAATGG - Intronic
1073479372 10:103776750-103776772 CTAAATTTCCCCCTTTCACAGGG + Intronic
1073591198 10:104759092-104759114 CCAAATTTCCCCCTTTTATAAGG - Intronic
1074571317 10:114626830-114626852 CCATGTTTCCCCTTTTTAAAAGG - Intronic
1074642823 10:115407556-115407578 CAGGATTTCCTTCTTTTTAATGG + Intronic
1074647193 10:115471116-115471138 CAAGATTTCCTGCTTTTTAAAGG + Intronic
1075022652 10:118963050-118963072 CCAGATTTCCCCTTTTTATGAGG + Intergenic
1075235853 10:120728032-120728054 CTACATTTCCCCTTTTTATAAGG + Intergenic
1076087115 10:127643010-127643032 CAACATTTCTTCCTTTTGAAGGG + Intergenic
1076147466 10:128135463-128135485 CAAGCTTTACCCCATGTAAATGG + Intergenic
1076239788 10:128895900-128895922 ATAGAATTCCCCCATTTAAAGGG + Intergenic
1077449388 11:2627623-2627645 CATGATTTCCTGCTTTTTAAAGG + Intronic
1078887683 11:15521101-15521123 CAAGACTTCCGCCTTTTCAAAGG + Intergenic
1079253503 11:18806280-18806302 CAATATTTCCCCCATTTTAAAGG + Intergenic
1079449058 11:20583615-20583637 CCAAATTTCCTCCTTTTATAAGG + Intergenic
1079763863 11:24365237-24365259 CAAGCTTTCACCATTTTAAGTGG + Intergenic
1080342201 11:31278330-31278352 CAAGAGTTTCTCCTTTTTAAAGG - Intronic
1080478872 11:32624849-32624871 CAAGAACTCCTCCTTTTTAATGG - Intronic
1080842557 11:35998171-35998193 TCAGAGTTCCCCCTTTAAAAAGG - Intronic
1081205495 11:40270398-40270420 CCAGATTTCCTCTTCTTAAAAGG + Intronic
1081319616 11:41675328-41675350 CCAAATTTCCCTCTTTTATATGG + Intergenic
1081699326 11:45142892-45142914 AAAGATGTTCCCCTTTTTAATGG - Intronic
1081721593 11:45293676-45293698 TAGGATTCCCCCATTTTAAACGG + Intergenic
1081903159 11:46647143-46647165 GAAACTTTCCCCCTTTTAATGGG + Intronic
1082966487 11:58971358-58971380 CAAGTTTCCCCTCTTTTAAGGGG - Intronic
1083465411 11:62842342-62842364 CACCATTTCCCCCGTTTAAATGG - Intergenic
1084078321 11:66799768-66799790 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1084482113 11:69428011-69428033 CCAAATTTCCCCTTTTTAGAAGG - Intergenic
1084577123 11:69996462-69996484 AAACATTTCTCCCTTTGAAATGG - Intergenic
1085558219 11:77445107-77445129 CCAAATTTCCCCTTTTTATAAGG - Intronic
1085962623 11:81480676-81480698 GAACATTTTCCCCTGTTAAATGG + Intergenic
1086186572 11:84024572-84024594 CACAATTTCTCCTTTTTAAAGGG - Intronic
1087004248 11:93453542-93453564 CTAAATATCCCCCTTTTATAAGG - Intergenic
1087221385 11:95550175-95550197 CAAGATTTTCCCCATTTCATAGG + Intergenic
1087230871 11:95661509-95661531 CAATATTTCCTTCTTTTATAAGG + Intergenic
1087487831 11:98780262-98780284 CAAGATTTTCTTCTTTTTAAAGG - Intergenic
1087615543 11:100482621-100482643 TAAAATTTCCCCTTTTTATAAGG + Intergenic
1087704592 11:101475800-101475822 CAGGATTTTCTTCTTTTAAAAGG + Intronic
1088745888 11:112804480-112804502 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1088766416 11:112984228-112984250 CAGGATGTCCCTCTTTTTAAAGG + Intronic
1088961926 11:114676929-114676951 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1089188924 11:116640407-116640429 CAGGATTTCCCTCTTTTTCAAGG + Intergenic
1090160904 11:124493838-124493860 CAAGATTTCCATATTTTACATGG - Intergenic
1090212762 11:124934484-124934506 CCACATTTCCCCTTTTTATAAGG - Intronic
1090506268 11:127318866-127318888 AAAGATTTCCTCCTTGTGAAAGG + Intergenic
1090920515 11:131202456-131202478 CAGGATTTCCTACTTTTTAAAGG + Intergenic
1090979625 11:131707319-131707341 GAAGAATTTCCCCTTTTTAAAGG + Intronic
1091112848 11:132986689-132986711 AAAGATTTTCTTCTTTTAAATGG + Intronic
1091553834 12:1557096-1557118 CAGGATTTCCTCCTTTTTAAAGG + Intronic
1091716257 12:2778488-2778510 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1091804251 12:3344422-3344444 CAAGATTCCCTTCTTTTATAAGG + Intergenic
1091901660 12:4148924-4148946 CCAAATTTCCCCCATTTACATGG + Intergenic
1092320600 12:7469969-7469991 CAGGATTTCCCTCTTTTTAAAGG - Intronic
1092528376 12:9324653-9324675 CCAGGTTTCCTCCTTCTAAATGG + Intergenic
1092943047 12:13428190-13428212 CCAAATTTCCCCCTTTTATAAGG - Intergenic
1093068977 12:14688667-14688689 CAAAAGTTCCCCCTTTCAATAGG + Intronic
1093405377 12:18798082-18798104 CCAGACTTCCCCTTTTTATAAGG - Intergenic
1093881030 12:24404917-24404939 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1094182927 12:27611404-27611426 CCAAATTTCCCCTTTTTATAAGG + Intronic
1094210018 12:27879224-27879246 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1094213511 12:27917493-27917515 CAAGATTTCATTCTTTTATATGG - Intergenic
1094295426 12:28899629-28899651 CCAAATTTCTCCCTTTTATAAGG + Intergenic
1094342296 12:29426267-29426289 CAAAATTTCTCACTTTTTAAAGG - Intronic
1094739546 12:33273221-33273243 CCAGATCTTTCCCTTTTAAAGGG + Intergenic
1095174773 12:39078971-39078993 CAAGATTTCCCCTGTTTTTAAGG - Intergenic
1095337709 12:41048641-41048663 CAATATTGCCCACTTTTAAGGGG + Intronic
1095676068 12:44919551-44919573 CTAAATTTCCCCTTTTTATAAGG - Intronic
1096192174 12:49626903-49626925 CAAGGTATCCCCCTTTTTCAGGG - Intronic
1096655626 12:53089681-53089703 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1097431398 12:59512320-59512342 GTAGATTTCCCTCTTTTTAAAGG - Intergenic
1097513521 12:60573097-60573119 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1097956507 12:65491975-65491997 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1098136117 12:67404016-67404038 CAGGATTTCCCACTTTTTTAAGG - Intergenic
1098273838 12:68794169-68794191 CCAAATTTCCCCCTTTTATATGG + Intergenic
1098514993 12:71364997-71365019 CAGGATCTCCCCTTTTTTAAAGG - Intronic
1098518568 12:71408441-71408463 CAGGATTTCCTTCTTTTAAAAGG - Intronic
1098965058 12:76778962-76778984 CAAATTTTCTCCTTTTTAAAAGG + Intronic
1099434068 12:82622729-82622751 CATCATTTCCCCCCTTTTAAAGG + Intergenic
1099450280 12:82799727-82799749 CCACATTTCCCCTTTTTATAAGG + Intronic
1099803021 12:87480950-87480972 CAAGTTTTCTCTCTTTAAAAAGG - Intergenic
1100841412 12:98615824-98615846 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1101115281 12:101525530-101525552 CCAGATTTCCCCTTTTTATAAGG + Intergenic
1101521905 12:105491631-105491653 CAGAATTTCCTCCTTTTAAAAGG + Intergenic
1101577574 12:106012148-106012170 CAGGATTTCCTCCCTTTTAAAGG - Intergenic
1102611496 12:114116325-114116347 CAAGATTTCCCCCCTACATATGG + Intergenic
1102830561 12:115994939-115994961 CAGGATTACTCCATTTTAAAGGG + Intronic
1102906574 12:116680596-116680618 CAGGATTTCCCTCTTTTTCAAGG - Intergenic
1103496140 12:121363684-121363706 CCATATTTCACCCTTTTATAAGG + Intronic
1103512513 12:121484969-121484991 CCAGATTTCCTCATTTTATAAGG - Intronic
1103791663 12:123476543-123476565 CCAGATGTCCCCCTTTTATAAGG - Intronic
1104396428 12:128437576-128437598 CAAGATTTTCCTCCTTGAAAAGG - Intronic
1104489811 12:129183996-129184018 AAAGATTTGCCCCTTCTGAAAGG - Intronic
1105022982 12:132829317-132829339 CCAGCTTTGCCCTTTTTAAAGGG - Intronic
1105515760 13:21089497-21089519 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1105613555 13:21991258-21991280 CAGGATTTCTCTCTTTTTAAAGG + Intergenic
1105727282 13:23177039-23177061 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
1105732824 13:23236187-23236209 CAGGATTTCCCTTTTGTAAAAGG + Intronic
1106139591 13:27001102-27001124 CCAAATTTCCCCCTTTTATAAGG - Intergenic
1106306931 13:28520710-28520732 CAACATTTCTTCCTTTTTAAAGG + Intergenic
1106430259 13:29674220-29674242 CAGGATTTCCTCCTTTTTTAAGG + Intergenic
1106622381 13:31383171-31383193 CAGGATTTCCCTCTTTTTTAAGG + Intergenic
1106799215 13:33239200-33239222 CAAGATTTCCTTCTTTTTTAAGG + Intronic
1107500099 13:40964834-40964856 CCAAATTTCCCCTTTTTATAAGG + Intronic
1107593255 13:41931190-41931212 TAAGATTTCCTTCTTTTTAAAGG - Intronic
1108115099 13:47118859-47118881 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1108175576 13:47789386-47789408 CAAGATTTCCTTCTTTTTAAAGG - Intergenic
1108246178 13:48516559-48516581 CTAAATTTCCCCTTTTTATAAGG + Intronic
1108876550 13:55056518-55056540 CCAGGTTTCTCCCTTTTAAGAGG - Intergenic
1109159214 13:58950830-58950852 CAAGATTTCCTTCTTTTTAAAGG + Intergenic
1109209854 13:59522543-59522565 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1109329297 13:60907843-60907865 CAAAATTTCCTTCTTTTTAAAGG - Intergenic
1109611952 13:64777177-64777199 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1109889323 13:68587545-68587567 AAAGATTTCCTTCTTTTTAAAGG + Intergenic
1110154901 13:72304700-72304722 CAAATTTTCCTCCTTTTAAATGG + Intergenic
1110548744 13:76787697-76787719 CAAGATTTCCTTCTTTTTAAAGG - Intergenic
1111025383 13:82514227-82514249 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1111217689 13:85165359-85165381 CAAGATTTCCTCCATTTGTAAGG - Intergenic
1111236460 13:85415360-85415382 AAAAATTTTCCTCTTTTAAAAGG - Intergenic
1111816330 13:93157917-93157939 CAGGATTTCCTTCTTTTATAAGG + Intergenic
1111969539 13:94897013-94897035 CAGGATTTTCCTCTTTTCAAAGG + Intergenic
1112143443 13:96671699-96671721 CCAAATTTCCCCCTTTTATAAGG + Intronic
1112441880 13:99430295-99430317 CAGGATTTCCCTCTTTTTGAAGG + Intergenic
1112490944 13:99863011-99863033 CAAGTTTTCGGCCTTTTAAGTGG - Exonic
1112491081 13:99864663-99864685 CCAAATTTACCCCTTTCAAAAGG - Intronic
1112664496 13:101554076-101554098 CGAGGTTTCCCCTTTTTATAAGG + Intronic
1112875286 13:104030549-104030571 ATAAATTTTCCCCTTTTAAAAGG + Intergenic
1113056025 13:106269034-106269056 CAGAATTTCCCTCTTTTTAAAGG - Intergenic
1113124976 13:106967762-106967784 CAAGATTTCCTTCTTTTTTAAGG + Intergenic
1113458110 13:110463298-110463320 CCAAATTTCCCCTTTTTATAGGG + Intronic
1114274793 14:21133032-21133054 CAGGATTTCCTTCTTTTTAATGG - Intergenic
1114748709 14:25179670-25179692 CAGAATTTCCTTCTTTTAAAAGG - Intergenic
1115227524 14:31119433-31119455 AAAAATTTCCCACCTTTAAATGG + Intronic
1115674812 14:35660783-35660805 CAAGATTTCCTTCTTTTTAAAGG - Intronic
1116086481 14:40245543-40245565 CAGAATTTCCTCCTTTTTAAAGG + Intergenic
1116097696 14:40392548-40392570 CTAGATTTCCCCCTTTATCAAGG + Intergenic
1116705505 14:48293236-48293258 CAAGATTTCCTTCTTTTTTAAGG + Intergenic
1117033214 14:51697331-51697353 CATGATTTCCTTCTTTTTAAAGG - Intronic
1117210140 14:53488883-53488905 TAAGATTTCCTTCTTTTCAAAGG - Intergenic
1117914978 14:60668385-60668407 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1118145736 14:63133873-63133895 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1118492792 14:66277876-66277898 CATGATTTCCATCTTTTAAATGG - Intergenic
1118552142 14:66964888-66964910 CAAGATTTCAAACTATTAAATGG + Intronic
1118996626 14:70842323-70842345 CCAAATTTCCTCTTTTTAAAAGG + Intergenic
1119148435 14:72336909-72336931 CTAAATTTCCCCTTTTTATAAGG + Intronic
1119639786 14:76305928-76305950 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1119792100 14:77360521-77360543 CAAGATCTCCTTCTTTTATAAGG + Intronic
1119851464 14:77869431-77869453 CCAAATTTCCCCTTTTTATAAGG + Intronic
1119991255 14:79200200-79200222 CAGGATTTCCCACTGATAAATGG - Intronic
1120138851 14:80904156-80904178 CAGGATTTCTCCCTTTTTAAAGG - Intronic
1120367831 14:83592827-83592849 CAGGATTTCCTTCCTTTAAAAGG + Intergenic
1120773147 14:88403546-88403568 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1121687790 14:95851732-95851754 CAAGATTTTCTTCTTTTTAAAGG - Intergenic
1121827214 14:97020111-97020133 CAAGATTTTCTTCTTTTTAATGG + Intergenic
1122002905 14:98678386-98678408 CAAGATTTCCTTCTTTTTCAAGG + Intergenic
1122050035 14:99051321-99051343 CAGGATTTCCTTCTTTTTAATGG - Intergenic
1122432946 14:101667498-101667520 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1123708071 15:22964998-22965020 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1124010823 15:25837337-25837359 CAGGATTTCCTTCTTTTAAAAGG - Intronic
1124221845 15:27856155-27856177 CAAAATTTCCCCTTTTTGTAAGG + Intronic
1124240768 15:28025900-28025922 CAAGATTTTACCATTTTCAAAGG - Intronic
1124422711 15:29536749-29536771 CCAAATTTCCCCTTTTTATAAGG - Intronic
1124448272 15:29759792-29759814 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1124473838 15:30013212-30013234 TAAGATTTCCTTCTTTTTAAAGG + Intergenic
1124507323 15:30289662-30289684 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1124532537 15:30520161-30520183 CAAAATTTCCATCTTTTAACTGG + Intergenic
1124736232 15:32248997-32249019 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1124766116 15:32487483-32487505 CAAAATTTCCATCTTTTAACTGG - Intergenic
1124984925 15:34598314-34598336 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1125291997 15:38159530-38159552 AAAGTTTTAACCCTTTTAAAAGG + Intergenic
1125364722 15:38901784-38901806 GCAGATTTCCTTCTTTTAAAAGG + Intergenic
1125563521 15:40657731-40657753 CCACATTTCCCCTTTTTATAAGG + Intronic
1125980838 15:43999748-43999770 CAAGACTTCCTCCTTTTTACAGG + Intronic
1126333537 15:47560788-47560810 CCAAAGTTCCCCCTTTTATAAGG - Intronic
1126452844 15:48828325-48828347 CAGGATTTCCCTCTTTTCTATGG + Intronic
1126553239 15:49955689-49955711 CAGGATTTCCTCCTTTTTTATGG - Intronic
1126990610 15:54371760-54371782 CAGGATTTCCCTCTTTTTTAAGG - Intronic
1127031540 15:54869858-54869880 CAGGATTTCCCTCCTTTTAAAGG - Intergenic
1127296060 15:57609485-57609507 CCAGATTTTCCCCTTTTTATAGG + Intronic
1127621494 15:60738946-60738968 TCAAATTTCCCCCTTTTATAAGG + Intronic
1127680254 15:61288074-61288096 CAGGATTTCCTTCTTTTATATGG + Intergenic
1127845601 15:62867899-62867921 CCACATTTCCCCTTTTTATAAGG - Intergenic
1127988951 15:64096769-64096791 AAAGCTTTCTCCTTTTTAAAGGG + Intronic
1128871321 15:71157806-71157828 CAAGATTTCATTCTTTTTAATGG + Intronic
1129075124 15:72988269-72988291 CAGGATATCCTCCTTTTTAAAGG - Intergenic
1129085389 15:73084471-73084493 GAAGATTTCCTCCTTTTTAAAGG + Intronic
1129522510 15:76194769-76194791 CTAGATTTCCCTTTTTTATAAGG + Intronic
1130173312 15:81540463-81540485 CAAGATTTCATGCTTTTTAATGG - Intergenic
1130193037 15:81754458-81754480 CCAAATTCCCCCTTTTTAAAAGG - Intergenic
1130419644 15:83731753-83731775 CAAGATTTCCTTCTTTTTTAAGG - Intronic
1130450661 15:84048574-84048596 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1131040201 15:89257582-89257604 CCAGAGTTCCCCTTTTTATAAGG + Intronic
1131503524 15:92994707-92994729 AATGTTTTCTCCCTTTTAAATGG + Intronic
1131564754 15:93476049-93476071 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1131979939 15:97985196-97985218 CAAAATTTGAGCCTTTTAAATGG + Intergenic
1132021450 15:98366032-98366054 CCAGATTTCCTCCTTTTGAAAGG - Intergenic
1132153504 15:99478678-99478700 TCAAATTTCCCCCTTTTATAAGG + Intergenic
1133752273 16:8733962-8733984 CAGGATTTCCTCCTTTTTTAAGG + Intronic
1134008185 16:10832457-10832479 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1134084646 16:11348068-11348090 CAGGATTTCACATTTTTAAATGG + Intronic
1134283706 16:12841411-12841433 CAGAATTTCCTCCTTTTTAATGG - Intergenic
1134695759 16:16222850-16222872 CTCGTTTTCCCCCTTTTACAGGG - Intronic
1134774092 16:16836916-16836938 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1134855127 16:17512162-17512184 TCAGATTTCCCCTTTTTATAAGG + Intergenic
1135898982 16:26438677-26438699 CAAAATTTCTCCTTTTTATAAGG + Intergenic
1136669575 16:31844229-31844251 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1137380026 16:47989331-47989353 CAAGATTTCCCCATTTTTAAAGG - Intergenic
1137414590 16:48263529-48263551 CAAGATTTCCTTCTTTTTTAAGG + Intronic
1137810466 16:51347971-51347993 CAGGATTTCCTTCTTTTTAAGGG - Intergenic
1137905938 16:52322145-52322167 CAAGATTTCCTTCTTTTTAAAGG + Intergenic
1138189854 16:55005814-55005836 CAAGATTTCCTTCCTTTAGAAGG - Intergenic
1138372178 16:56535993-56536015 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1139016134 16:62690927-62690949 CAAGATTTCATCTTTTTTAATGG + Intergenic
1139319247 16:66100071-66100093 CAGGATTTCCCTCTTTTAAAAGG - Intergenic
1139609117 16:68042189-68042211 CAAGATTTCCTTCTTTTTTAAGG + Intronic
1140583678 16:76261317-76261339 CACTATTTCCTTCTTTTAAAAGG + Intergenic
1140764640 16:78145755-78145777 CCAGATTTCCCCTTTTCATAAGG + Intronic
1140968528 16:79990744-79990766 CCAGATTTCCCCTTTTTATAAGG + Intergenic
1141032477 16:80601826-80601848 CAAGATTTCCACCTTAGAAATGG + Exonic
1141379180 16:83560339-83560361 CAGGATTTTCTCCTTTTTAAAGG - Intronic
1141689006 16:85586144-85586166 CCAGATTTCCCCTTGTTAGAAGG + Intergenic
1141713433 16:85713572-85713594 CCAGATTTCCCCTTTTGATAAGG + Intronic
1143056584 17:4167202-4167224 AAAGATTTCACCTTTTTAAAAGG + Exonic
1143823489 17:9584943-9584965 CATGATTTCCTTCTTTTTAAAGG - Intronic
1145178952 17:20728058-20728080 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1146174576 17:30657207-30657229 CAAGATTTCCTTCTTTTATCAGG - Intergenic
1146348034 17:32073221-32073243 CAAGATTTCCTTCTTTTATCAGG - Intergenic
1146852769 17:36237660-36237682 CCAAATTTCCCCTTTTTATAAGG - Intronic
1146868681 17:36361552-36361574 CAAAATTTCCCCTTTTTATAAGG - Intronic
1148196059 17:45713862-45713884 CACGATTTCCTTCTTTTAAAAGG - Intergenic
1149158536 17:53663567-53663589 CAAGATTTCCTTTTGTTAAAAGG - Intergenic
1149838608 17:59937641-59937663 CCAAATTTCCCCTTTTTATAAGG + Intronic
1150198603 17:63328450-63328472 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1150580672 17:66470683-66470705 CAAGAATTGCCCTTTTGAAAGGG + Intronic
1150915049 17:69428426-69428448 CCAAATTTCCCCTTTTTATAAGG + Intronic
1150916215 17:69439955-69439977 CTTGGTTTCCCCCTTTTTAATGG - Intronic
1151249293 17:72821199-72821221 CCAGATTTCCCCTTTTTATAAGG - Intronic
1152793622 17:82295584-82295606 CAAGATTTCCTTCTTTTTAAAGG + Intergenic
1153237149 18:2999293-2999315 CCAGATTTCCTCTTTTTATAAGG - Intronic
1153558678 18:6346993-6347015 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1153619555 18:6964389-6964411 CCACATTTCCCCTTTTTATAAGG - Intronic
1154012228 18:10584718-10584740 CAAGATTTCATTCTTTTTAATGG + Intergenic
1154393543 18:13965818-13965840 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1155421161 18:25658052-25658074 AAAGATTTCCTTCTTTTTAAAGG + Intergenic
1155879884 18:31132145-31132167 CCAAATTTCCCCTTTTTATAAGG - Intronic
1156148455 18:34214826-34214848 CAAGATTTTCCTCCTTTTAAAGG - Intronic
1156183552 18:34635191-34635213 CAAGATTTCCTTCTTTTTAAAGG + Intronic
1157537086 18:48467851-48467873 CCAGATTTCCCCTTTTTATAGGG - Intergenic
1157819752 18:50757642-50757664 CCAGATTTCCCATTTTTATAAGG + Intergenic
1157961189 18:52155083-52155105 CAAATTTTCCCCTTTTTATAAGG + Intergenic
1158392447 18:57054343-57054365 CAGGATTTCCTTCCTTTAAAAGG + Intergenic
1158667309 18:59444062-59444084 CAAAATTTCCATCTTTTTAAAGG + Intronic
1158681833 18:59574975-59574997 CCAAATTTCCCCTTTTTATATGG - Intronic
1158747485 18:60218193-60218215 CCAGATTTCCTCTTCTTAAAAGG - Intergenic
1158963943 18:62607592-62607614 CAAATGTTCCCCCTTTTAGAAGG + Intergenic
1159392854 18:67816540-67816562 CAAAATTTCCTTCTTTTTAAAGG + Intergenic
1159456691 18:68668383-68668405 CAACTTTGCCCCCTTTTTAATGG - Intergenic
1159544329 18:69820052-69820074 CAAGATTTCCTCCTTTTTTAAGG + Intronic
1159551856 18:69903627-69903649 CAGAATTTCCCCTTTTTATAAGG - Intronic
1159721188 18:71893266-71893288 CATGATTTCCTTGTTTTAAATGG + Intergenic
1159800387 18:72891795-72891817 CAAGATTTCCTTATTTTATAAGG + Intergenic
1159833032 18:73301664-73301686 CAAGATTTCTATCTTTTTAAAGG - Intergenic
1159918056 18:74203483-74203505 CCACATTTCCCCTTTTGAAAAGG + Intergenic
1160023234 18:75197105-75197127 CAAGCATTCCTCCTTTTACAAGG + Exonic
1160023239 18:75197116-75197138 CATGCTATCCCCCTTGTAAAAGG - Exonic
1161629911 19:5348681-5348703 CCAGATTTCCCCTTTTTATAAGG + Intergenic
1161760650 19:6168704-6168726 CAAGACTGCCCACTTTTTAAAGG + Intronic
1162005508 19:7776020-7776042 CCATATTTCCCCGTTTTAGAAGG - Intergenic
1162041894 19:7975803-7975825 CTAAATTTCCCTCTTTTATAAGG - Intronic
1162287008 19:9746308-9746330 CAAGATCTCACCCTTGTAAAGGG + Intergenic
1162838429 19:13337434-13337456 CAAAATCTCCCCTTTTTATATGG + Intronic
1162987829 19:14282843-14282865 CAAGATTTCCTTCTTTTATCAGG + Intergenic
1163068971 19:14822028-14822050 CAGGATTTCCTTCTTTTTAAAGG + Intronic
1163188206 19:15654680-15654702 CAAAATTTCAGTCTTTTAAATGG + Intronic
1164121575 19:22269992-22270014 CAAAATTTCCCCAGATTAAATGG + Intergenic
1164968433 19:32508787-32508809 CAAGATATCCTACTTTTTAAAGG + Intergenic
1165135372 19:33664922-33664944 CAAGATTTCATTCTTTTTAATGG + Intronic
1165179797 19:33957763-33957785 CAAAATTTCCCCTTTCTATAAGG + Intergenic
1166140655 19:40803471-40803493 CAGGCTTTCCCGCTTTTAGATGG + Intronic
1166780520 19:45340369-45340391 CCTGATTGCCCCCTTCTAAATGG - Intronic
1167419494 19:49394757-49394779 CAAGTTTTCCTCATTCTAAAAGG - Intronic
1167739067 19:51312874-51312896 CTAGATTTCCCCCTAAGAAAAGG + Intronic
1167767636 19:51494782-51494804 CAAGATTTCCTTCTTTTTAAAGG - Intronic
1168362266 19:55751989-55752011 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
924972157 2:138322-138344 CAAGATCTCCTTCTTTTTAAAGG - Intergenic
925471396 2:4165090-4165112 CCAGTTTTCCCCATTTTATAGGG - Intergenic
925983578 2:9196807-9196829 CCAAATTTCCCCTTTTTATAAGG - Intergenic
926052898 2:9756087-9756109 CAAAATTTCCCCTTTTTATAAGG - Intergenic
927080472 2:19624687-19624709 CAAGATTTCTTTCTTTTATAAGG + Intergenic
927336871 2:21935276-21935298 CCATACTTCCCCATTTTAAAGGG - Intergenic
927620461 2:24651368-24651390 CAGGATCTCCTCCTTTTTAATGG - Intronic
928395866 2:30942957-30942979 CCAAATTTCCCCTTTTTATAAGG - Intronic
928607277 2:32954490-32954512 CCAAATTTCCCCTTTTTATAAGG + Intronic
928814839 2:35280498-35280520 CAGGAATTCCTCCTTTTATATGG + Intergenic
928830058 2:35470981-35471003 CAAGATTTCCTTCTTTTTTATGG + Intergenic
928906889 2:36377529-36377551 CATGATTTCCCTCTGTAAAATGG + Intronic
929026526 2:37609681-37609703 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
929034613 2:37678942-37678964 GAAGTTTTCTCCCTTTTGAATGG + Intronic
929052734 2:37851767-37851789 CAAGATTTACCACATTTAAGTGG - Intergenic
929230278 2:39552525-39552547 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
929620899 2:43353067-43353089 CAAGATCTCCTCCTTTTTAAAGG + Intronic
929833862 2:45375929-45375951 CCAAATTTCCCCTTTTTATAAGG + Intergenic
930892906 2:56411839-56411861 CATGATTTCCTTCTTTTATATGG - Intergenic
931023454 2:58078326-58078348 CATGATTTCCTTCTTTTTAAAGG + Intronic
931541111 2:63329913-63329935 CAGGATTTCCTTCTTTTTAAAGG + Intronic
931570603 2:63665425-63665447 CAAAATTTCCCCTTTTTATAAGG + Intronic
931710275 2:64983790-64983812 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
932011828 2:67985944-67985966 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
932946774 2:76243080-76243102 CAAGATTTCACTCTTTTAAATGG + Intergenic
933104813 2:78311070-78311092 CAAGATTTTGTCCTTTTATAAGG + Intergenic
933605109 2:84374545-84374567 CTAAATTTTCCCCTTTTATAAGG - Intergenic
933804104 2:85985602-85985624 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
933983428 2:87572123-87572145 CTGAATTTCCCCCTTTTATAAGG + Intergenic
934040231 2:88122268-88122290 CCAAGTTTCCCCCTTTTATAAGG + Intergenic
934994999 2:98949749-98949771 CCAAATTTCCCCTTTTTATAAGG - Intergenic
935721493 2:105983242-105983264 CAAAATTTCCCCAGATTAAATGG + Intergenic
935744268 2:106177015-106177037 CAAGATGTCACCTTTTTTAAAGG + Intronic
935945732 2:108284995-108285017 CCAAATTTCCCCCTTTTATAAGG - Intergenic
936310421 2:111378671-111378693 CTGAATTTCCCCCTTTTATAAGG - Intergenic
936821485 2:116527487-116527509 CCACATTTCCCCCTTTCATAAGG + Intergenic
937817324 2:126266004-126266026 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
937897567 2:126990179-126990201 CTAGGTTTCCCCTTTTTAAGGGG + Intergenic
938190192 2:129272793-129272815 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
938213596 2:129489474-129489496 CAAGATTTCCTTCTTTTTTAAGG + Intergenic
939597724 2:144147733-144147755 CCAGATTTCCCCATCATAAAAGG - Intronic
939609364 2:144291125-144291147 CTACATTTCCCCTTTTTATAAGG + Intronic
940286276 2:152035987-152036009 CAGGATTTCCTCCTTTTTTAAGG - Intronic
940286924 2:152041761-152041783 CAAGATATCTCCCTTTTTGATGG - Intronic
940524707 2:154798763-154798785 CAAAATTACCTTCTTTTAAAAGG + Intronic
940591404 2:155732841-155732863 CAAGATTTGTCCCTTTTCTAAGG + Intergenic
940604375 2:155901513-155901535 TAACATTTCTCCCTTTTAAATGG - Intergenic
941020261 2:160400260-160400282 CAAGCTTTTCCCTTTTTGAAAGG - Intronic
941139460 2:161760967-161760989 CAGGATTTCCTTCTTTTATATGG - Intronic
941304235 2:163841595-163841617 CAAGATTCCCCTCTTTTTGAAGG - Intergenic
941358623 2:164523725-164523747 CAATGTTTCCCCTTTTTAAAAGG - Intronic
941838441 2:170052515-170052537 CAAGATTTCCTTCTTTTTTAAGG - Intronic
942055069 2:172174541-172174563 CGAGATTTACACATTTTAAAAGG - Intergenic
942143065 2:172997309-172997331 CAAGGTTACCCCTTTTTATAAGG + Intronic
942266548 2:174233018-174233040 CAGGATTTCCTTCTTTTTAAGGG - Intronic
942329309 2:174805464-174805486 CAAGAACTCCTCCCTTTAAAAGG + Intronic
942402419 2:175617189-175617211 CAAGATTTCCTTCTTTATAAAGG + Intergenic
942849704 2:180469734-180469756 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
943129108 2:183835662-183835684 CAAGATATCCCTCTTTTTTAAGG + Intergenic
943242187 2:185399450-185399472 CCAAATTTCCAACTTTTAAAAGG - Intergenic
943293631 2:186108922-186108944 TGAGATTTCCCCATTTTATAAGG + Intergenic
943831580 2:192470945-192470967 CAAGGGTTCCTCCTATTAAATGG - Intergenic
943910889 2:193566023-193566045 CCAAATTACCCCCTTTTATAAGG - Intergenic
944001288 2:194841596-194841618 CAAGATTTCTCCCCTTTTTAAGG + Intergenic
944150135 2:196548884-196548906 CCATATTTCCCCTTTTTATAAGG + Intronic
944343767 2:198635798-198635820 CTAAATTTCCCCTTTTTATAAGG - Intergenic
944486189 2:200208206-200208228 CAGGATCTCCTCCTTTTTAAAGG - Intergenic
944495098 2:200299171-200299193 CCAAATTTCCCCCTTTTCATAGG - Intergenic
944894257 2:204147810-204147832 CAGAATTTCCCTCTTTTATAAGG + Intergenic
944997516 2:205310662-205310684 CAAGATTTTCTACTTTTTAATGG + Intronic
945289734 2:208115397-208115419 CAAAATTTCCCCAGATTAAATGG - Intergenic
945713029 2:213323793-213323815 CAGAATTTCCCTCTTTTTAAAGG - Intronic
945990965 2:216394959-216394981 CAAAATTTCCCCTTTTTATAAGG - Intergenic
946453894 2:219805307-219805329 CAAGATTTACTTCTTTTGAAAGG + Intergenic
946456978 2:219834662-219834684 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
946532675 2:220589211-220589233 CCAAATTTCCCCTTTTTATAAGG - Intergenic
946738716 2:222780431-222780453 CCAAATTTCCCCTCTTTAAAAGG - Intergenic
946763975 2:223023007-223023029 CCAGATTTCCCCTTTTTATAAGG + Intergenic
946964391 2:225022209-225022231 CAAGATTACACAGTTTTAAACGG - Intronic
946964393 2:225022243-225022265 CAAGATTACACAATTTTAAATGG - Intronic
947088794 2:226486536-226486558 CAATTTCTCCACCTTTTAAATGG - Intergenic
947476306 2:230450796-230450818 CAGGATTTCTTCCTTTTCAAAGG + Intronic
1168740124 20:181385-181407 CAACTTTTCCTCCTTTCAAATGG + Intergenic
1169185429 20:3612476-3612498 CAAGATTTCCACCTCTTGATGGG - Intronic
1169655724 20:7920699-7920721 CAGAATTTCCCACTTTTTAAAGG + Intronic
1170510222 20:17068671-17068693 AAAGATCACCCCTTTTTAAAGGG - Intergenic
1171152970 20:22844108-22844130 CCAAATTTCCCCTTTTTAAAAGG - Intergenic
1171978998 20:31613554-31613576 CAAGATCTCCTCCTTTAAAAGGG - Intergenic
1171980879 20:31627896-31627918 CCAGATTTCCCCTTTTTTGAAGG - Intergenic
1172687908 20:36771032-36771054 CACAATTTCCCCCTTTTTTAGGG + Exonic
1172893927 20:38286397-38286419 CCACATTTCCCCTTTTTATAAGG + Intronic
1173757453 20:45529896-45529918 CAGGATTTCCTACTTTTTAAAGG + Intergenic
1173889909 20:46498836-46498858 CCAGATTTCCCCTTGTTATAAGG - Intergenic
1174862884 20:54108682-54108704 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1175507643 20:59497182-59497204 CCAAGTTTCCCCCTTTTATAAGG + Intergenic
1176660588 21:9631500-9631522 CAGGATTTCCTTCTTTTGAAAGG + Intergenic
1177145286 21:17400589-17400611 CAGGATTTCTCTCTTTGAAAAGG + Intergenic
1177206160 21:18014295-18014317 CATGATTTCATCCTTTTTAATGG - Intronic
1177222935 21:18217812-18217834 CAATATTTCCCCATTTTAAATGG - Intronic
1177490607 21:21821026-21821048 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1177596077 21:23244815-23244837 CAAAATTTCCCCTTTTCATAAGG + Intergenic
1177628264 21:23693101-23693123 CAGGATGTCCTCCTTTTTAAAGG + Intergenic
1178279143 21:31265914-31265936 GAAGATTTCCATCTTTTAATCGG - Intronic
1178376893 21:32074468-32074490 CCAGATTTTCCCCTTTTATAAGG + Intergenic
1178546316 21:33495782-33495804 CCAAATTTCCTCCTTTTATAAGG - Intergenic
1178599860 21:33986027-33986049 CCACATTTCCCCTTTTTATAAGG + Intergenic
1178988084 21:37325851-37325873 CATGATTTCCCTCTTTTTAATGG - Intergenic
1180241885 21:46513955-46513977 GAATATTTTCCCCTTTTTAAAGG + Intronic
1180934195 22:19613445-19613467 CCTGTTTTCCCCCTTTTCAATGG + Intergenic
1181349299 22:22244044-22244066 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1182029219 22:27144375-27144397 CCACATTTCCCCTTTCTAAAAGG - Intergenic
1182245142 22:28951367-28951389 CCAGATTTCCCCTTTTAATAAGG - Intronic
1182626399 22:31649810-31649832 CTAGATTTTCCCTTTTTATAAGG - Intronic
1182726887 22:32454593-32454615 CAATATTTCCTCCTTGAAAAGGG - Intronic
1183240785 22:36656817-36656839 CTAGACTTCCCCATTTAAAATGG + Intronic
1183711040 22:39503270-39503292 CAACATTACCCCATTTTAAGTGG - Intronic
1183788615 22:40046580-40046602 AAAGATTTCCCTCATTCAAATGG + Intronic
1185020999 22:48375267-48375289 CAGGTTTTCCCACTTTGAAATGG - Intergenic
949167502 3:959801-959823 CCAAATTTCCCCTTTTTATAAGG - Intergenic
949297149 3:2538107-2538129 CCAAATTTCCCCCTTTTATAAGG - Intronic
949337269 3:2989137-2989159 TAAGATTTTCTCCTTTTCAATGG - Intronic
949527147 3:4916119-4916141 CCAAATTTCCCCTTTTTATAAGG + Intergenic
949944921 3:9182332-9182354 CCAAATTTCCCCTTTTTACAAGG - Intronic
949978294 3:9480950-9480972 CAAGATTTCTCTCTTTTAAGTGG + Intergenic
950146493 3:10653732-10653754 CTAGGTTTCCCCCTCTGAAAAGG - Intronic
950159130 3:10746343-10746365 CATTATTTCCCCCACTTAAAAGG + Intergenic
951372904 3:21873806-21873828 CAATATTTCCTTCTTTTGAATGG + Intronic
951387878 3:22064604-22064626 CAGGATTTCCTCCTTTTATAAGG - Intronic
951671098 3:25182865-25182887 TTAAATTTCCCCCTTTTATAAGG - Intronic
952101413 3:30017476-30017498 CAAGTTTTCCTCTTTTTATAAGG - Intergenic
952998534 3:38908779-38908801 CAAGCGTTCCCCGTTTTGAAGGG + Intronic
953382979 3:42488093-42488115 CCAAATTTCCCCTTTTTATAAGG - Intergenic
953857238 3:46508751-46508773 CAAGATTTTCCCCTTCTTACGGG + Intergenic
954099666 3:48359781-48359803 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
954611900 3:51948847-51948869 CAAGATTTCCTCCTTTTTTAAGG + Exonic
954856070 3:53644643-53644665 CAGGATTTCCTTCTTTTTAAAGG + Intronic
955817837 3:62864632-62864654 CCAGATTTCCCCATTTTATAAGG + Intronic
956041068 3:65145595-65145617 CATGACTTCCCCCTTTTGATTGG - Intergenic
956228403 3:66985709-66985731 CAGGATTTCCTCCTTTTCTATGG + Intergenic
956336107 3:68165917-68165939 CAATATTTCCATATTTTAAATGG + Intronic
956406669 3:68934868-68934890 CCAAATTTCCCCATTTTATAAGG - Intergenic
956425051 3:69125358-69125380 CAACTCTTCCCCCTTTTACAGGG - Intergenic
956849314 3:73213773-73213795 CCAAATTTCCCCTTTTTATAAGG - Intergenic
956865316 3:73363477-73363499 CCAAATTTCCCCTTTTTATAAGG + Intergenic
957852645 3:85829840-85829862 CAAAATTTCCCTTTTTTAAAAGG + Intronic
958424855 3:93968265-93968287 CCACATTTCCCCTTTTTATAAGG - Intronic
958880389 3:99662864-99662886 CCAAATTTCCCCTTTTTATAAGG + Intronic
959319395 3:104851614-104851636 CAAAATTTCACTCTTTTTAAAGG - Intergenic
959356264 3:105333179-105333201 CAGGATTTCACTCTTTTTAATGG - Intergenic
959466409 3:106692745-106692767 CAAGATTTTTCCCCCTTAAATGG - Intergenic
959654233 3:108782907-108782929 CAAGATTTCCTTCTTTTTTAAGG + Intergenic
960164910 3:114390269-114390291 CAAGATTTCCTTCTTTTTGAAGG + Intronic
960204429 3:114878013-114878035 TAATTTTTGCCCCTTTTAAATGG - Intronic
960344088 3:116511031-116511053 CCAAATTTCCCCTTTTTATAAGG - Intronic
960409347 3:117303241-117303263 TAAGAAATCTCCCTTTTAAAGGG + Intergenic
960474310 3:118105273-118105295 CAAGATTTCCCTTTGTTGAAAGG - Intergenic
960568605 3:119162762-119162784 CAAGATTTCCTTCTTTTTTAAGG - Intronic
960616909 3:119604428-119604450 CAGGATTTCCTTCTTTTTAAAGG - Intronic
960725007 3:120661221-120661243 CAAGCTTTCCCTCCTTTTAATGG + Intronic
960945057 3:122960638-122960660 CAGAATTTCCTCCTTTTATAAGG - Intronic
961008526 3:123420995-123421017 CCAAATTTCCCCTTTTTATAAGG + Intronic
961365440 3:126396469-126396491 CCAAATTTCCCCATTTTACAGGG + Intronic
962043345 3:131730622-131730644 CAAAATTTCCCATTTTTATAAGG - Intronic
962149412 3:132877150-132877172 CAAGGTTTCCAGCTATTAAATGG + Intergenic
962276165 3:134015255-134015277 CAAGATTTCCCCCTTTTAAAAGG - Intronic
962935423 3:140076231-140076253 CAGGATTTTCACCTTTTTAAAGG + Intronic
963030977 3:140975648-140975670 CAATTTTTCCTCATTTTAAAAGG - Intronic
963544718 3:146641925-146641947 AAAGATTTCAAACTTTTAAAAGG - Intergenic
964425414 3:156547934-156547956 CACCTTTTCCTCCTTTTAAATGG + Intronic
964549689 3:157872962-157872984 CATGCTTTCCCCATTTAAAATGG - Intergenic
965233548 3:166085494-166085516 CCAAATTTCTCCCTTTTAAAAGG + Intergenic
966387106 3:179410586-179410608 CCAAACTTCCCCCTTTTATAAGG + Intronic
966436056 3:179885343-179885365 CCAAATTTCCCCTTTTTATAAGG - Intronic
967613393 3:191535616-191535638 CAACATTTCTTCCTTTTCAATGG - Intergenic
967769269 3:193316132-193316154 CAAGATTTTCTCCTTTTCTAAGG + Intronic
968204340 3:196785836-196785858 CAAGATCTCCTGGTTTTAAAAGG - Intronic
968255099 3:197262580-197262602 CAAGACTGCCCCCATTTAGATGG - Intronic
970099032 4:12499596-12499618 CAAGATTTGCTCCTGTTCAAGGG + Intergenic
970143263 4:13006100-13006122 CCAAATTTCCCTTTTTTAAAAGG - Intergenic
970331680 4:14992778-14992800 CCAGATTTCCTTCTTTTTAAAGG + Intergenic
970923381 4:21421438-21421460 GAGGATTTCCTCCTTTTTAAAGG - Intronic
971245336 4:24922091-24922113 CTAAATTTCCCCTTTTTATAAGG + Intronic
971585992 4:28406553-28406575 CAAGATTTCCTTCTTTTATGAGG - Intergenic
971618658 4:28827363-28827385 CAAGATTTCCTTCTTTTTAATGG - Intergenic
972147443 4:36045357-36045379 CAAAATTTCCTCCTTTTTAAAGG - Intronic
972585178 4:40431199-40431221 CAAGATTTTCTTCTGTTAAATGG + Intronic
973224757 4:47770692-47770714 CAAGATTTCCTTCTTTTTAAAGG - Intronic
973302570 4:48604476-48604498 CCAAATTTCCCCTTTTTAAAAGG - Intronic
973583280 4:52365815-52365837 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
973605648 4:52584700-52584722 CAGGATTTCCTCCTTTTTGAAGG - Intergenic
973829602 4:54745436-54745458 CAAGTTTTCTCACCTTTAAATGG - Intergenic
974086940 4:57271555-57271577 CAAGATTTCCTTCTTTGTAAAGG + Intergenic
974104149 4:57448779-57448801 CAAGATTTTCTTCTTTTTAAAGG + Intergenic
974139931 4:57873035-57873057 CAAAATTTCCTTCTTTTTAAAGG - Intergenic
974501355 4:62707686-62707708 CATGATTTCCCTCTTCTTAAAGG + Intergenic
974721787 4:65749514-65749536 CAAGATTTACCTCTTCTGAATGG - Intergenic
975666111 4:76736625-76736647 CAAGATTTTCTATTTTTAAATGG - Intronic
975924904 4:79438050-79438072 CAAGATTTCTTTCTTTTTAAAGG + Intergenic
975951626 4:79779385-79779407 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
976785088 4:88810440-88810462 CCAAATTTCCCCTTTTTATAAGG - Intronic
976789977 4:88867357-88867379 CATAATTTCCCTCTTTAAAATGG - Intronic
977212825 4:94241407-94241429 CCAAATTTCCCCTTTTTATAAGG + Intronic
977213455 4:94248074-94248096 CCACATTTCCCACTTATAAATGG - Intronic
977314136 4:95424083-95424105 TATAATTTCCCCCATTTAAAAGG - Intronic
977399833 4:96518946-96518968 CCAGATTTCCTCTTTTTATAAGG + Intergenic
977470811 4:97439045-97439067 GAAGATTTCTCCTTTTTCAAAGG - Intronic
977507576 4:97921839-97921861 CAGGATTTCCTTCTTTTTAAAGG - Intronic
977584655 4:98761270-98761292 CCAAATTTCCCCCTTTTGTAAGG - Intergenic
977805822 4:101296179-101296201 GAAAATTACCCCCTTTTATAAGG - Intronic
977889500 4:102291865-102291887 CAGGATTTCCTTCTTTTTAAAGG - Intronic
978006230 4:103620563-103620585 CATGATTTCCCTCTTTTTTATGG - Intronic
978348547 4:107797498-107797520 CCAGATTTCCTCATTTTATAAGG - Intergenic
978447254 4:108791309-108791331 CAAAATTTCCCCTTTTTGTAAGG - Intergenic
978590473 4:110318909-110318931 CAAGATTTCTTTCCTTTAAAAGG + Intergenic
978870527 4:113571450-113571472 CAAGATTCCCTTCTTTTTAAAGG - Intronic
978980093 4:114934169-114934191 CAAGATTTCCTTCTTTTTTAAGG - Intronic
979123189 4:116928718-116928740 CAAGATTTCCTTCTTTTTAAAGG + Intergenic
979651066 4:123132453-123132475 CAAGATTTCCTTCTTTTTTATGG + Intronic
979831715 4:125314069-125314091 AAAGATCTCCCTCTTTTCAAAGG + Intergenic
980031879 4:127841411-127841433 CAAAATTTTACCATTTTAAAAGG + Intergenic
980094801 4:128478413-128478435 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
980565758 4:134537990-134538012 CCAAATTTCCCCTTTTTATAAGG + Intergenic
980758527 4:137197593-137197615 TAACATTTCCTCCTTTCAAATGG - Intergenic
981054684 4:140348468-140348490 CAAGATTTCCTTCTTTTTTAAGG + Intronic
981097311 4:140795347-140795369 CAAAATTTCCCCTTCTTACAAGG - Intergenic
981196195 4:141923575-141923597 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
981449202 4:144876395-144876417 CAAAATTTCCTTCTTTTTAAAGG - Intergenic
981547829 4:145912631-145912653 CCAAATTTCCCCCTTTTATAAGG - Intronic
982534488 4:156592682-156592704 CATGATTTCCCCCTTTTACAAGG + Intergenic
982575343 4:157102509-157102531 TAAGATTTCCTTCTTTTTAAAGG + Intronic
982656850 4:158160775-158160797 CAGGATTTCTCCCTTTTTAAAGG - Intronic
982797147 4:159659950-159659972 CAAGATTTCCTTCTTTTTAAAGG + Intergenic
983335128 4:166381804-166381826 CCATATTTCACACTTTTAAAAGG + Intergenic
985414773 4:189724914-189724936 CAGGATTTCCTTCTTTTGAAAGG - Intergenic
985994096 5:3587050-3587072 CCAAATTTCCTCCTTTTGAAGGG - Intergenic
986049217 5:4071535-4071557 TCAAATTTCCTCCTTTTAAAAGG + Intergenic
986108352 5:4683879-4683901 CAAGATTTCCTTCTTTTTGAGGG - Intergenic
987569894 5:19643494-19643516 GCAGATTTCCTTCTTTTAAAGGG - Intronic
987639484 5:20594427-20594449 CCAAATTTCCCCTTTTTATAAGG + Intergenic
987685598 5:21196426-21196448 AAAGATTTCACTCTTTTATAAGG - Intergenic
987745176 5:21961628-21961650 CCAAATTTCCCCCTTTCATAAGG - Intronic
987973061 5:24976047-24976069 CCAGATTTCCCAATTTTCAAGGG - Intergenic
989255503 5:39362300-39362322 AAAAATGTCCCCTTTTTAAAAGG - Intronic
989758289 5:44982970-44982992 CAAATTTTCCCCTTTTTATAAGG + Intergenic
990013602 5:51030242-51030264 CAGGATTTCCTCCTTTTTAGAGG - Intergenic
990219970 5:53577211-53577233 CAAGCCTTCCACCTTTCAAATGG - Intronic
990786465 5:59426036-59426058 CAAAATTTCCTGCTTTTATAAGG - Intronic
991400483 5:66246090-66246112 CCAAATTTCCCCTTTTTATAGGG + Intergenic
991437332 5:66610240-66610262 CCACATTTCCCCTTTTTATAAGG + Intronic
991639090 5:68736033-68736055 CAAAGTTTCCCCCTTTTATTTGG + Intergenic
991659657 5:68937392-68937414 CAGGATTTCCTGCTTTTCAAAGG - Intergenic
991765381 5:69971747-69971769 CCAAATTTCCCCCTTTCATAAGG - Intergenic
991781940 5:70146410-70146432 CCAAATTTCCCCCTTTCATAAGG + Intergenic
991844617 5:70846819-70846841 CCAAATTTCCCCCTTTCATAAGG - Intergenic
991874383 5:71146721-71146743 CCAAATTTCCCCCTTTCATAAGG + Intergenic
991993762 5:72367138-72367160 CAACATTTCCCTCACTTAAATGG - Intergenic
992107094 5:73458488-73458510 CCATTTTTCCCCTTTTTAAAAGG + Intergenic
993217206 5:85041347-85041369 CATGGTTTCACCCTTTTATATGG + Intergenic
994032568 5:95161259-95161281 CAGGATTTCCCCCCTTTATGAGG - Intronic
994178699 5:96740496-96740518 CCAAATTTCCCCTTTTTATAAGG + Intronic
994565300 5:101438416-101438438 CAAATTTTCCCTCTTTTTAAAGG + Intergenic
994793967 5:104269402-104269424 CAAGATTTTCTTCTTTTTAAAGG - Intergenic
995146524 5:108793329-108793351 CAAGATCTCACTCTTTTTAATGG + Intronic
995222170 5:109661237-109661259 CAGGATTTCCTTCTTTTATAAGG - Intergenic
995648503 5:114341006-114341028 CAATATTTCCTTCTTTTTAAAGG + Intergenic
996227311 5:121015548-121015570 CTTTATTTCCCCTTTTTAAAGGG + Intergenic
996585075 5:125078388-125078410 CAGGATTTCCCTCTTTTTTAAGG - Intergenic
996886670 5:128363676-128363698 CCAGATTTCCCCTTTTCACATGG - Intronic
996907501 5:128618434-128618456 TTAGATTTCCCTCTTTTGAATGG + Intronic
997016885 5:129946753-129946775 CAAGATATCCCCCTTTTTTAAGG + Intronic
997049798 5:130366180-130366202 CAGGATTTCCCCCCTTTACAAGG + Intergenic
997073937 5:130649508-130649530 CAAGACTTACCACTTTTGAAAGG - Intergenic
997288329 5:132700700-132700722 CTATCTTTCACCCTTTTAAAAGG - Exonic
997871350 5:137507781-137507803 CAGGATTTCCTTCTTTTTAAAGG + Intronic
998425159 5:142020302-142020324 CAAGATTTCCTTCTTTTTCAAGG + Intergenic
998534741 5:142919199-142919221 CCAAATTTCCCCTTTTTACAAGG - Intronic
998726071 5:145016240-145016262 CCAAATTTCCCCTTTTTATAAGG + Intergenic
999076342 5:148799323-148799345 CTACATTTCCACCTTTTATAAGG - Intergenic
999076637 5:148802621-148802643 CAAATTTTCCCCTTTTTATAAGG + Intergenic
999399594 5:151254018-151254040 CAAGATGTTCCCCCTTTTAAAGG + Intronic
999538926 5:152550294-152550316 CAAGACTTCACCCTTTCTAAAGG - Intergenic
999849011 5:155517255-155517277 CCAGATTTCCCCTTTTTATAAGG + Intergenic
1000017333 5:157289612-157289634 CCAGATTTCCTCTTTTTATAAGG + Intronic
1000806696 5:165803978-165804000 CAGGATTTCCCTCTTTTAATAGG - Intergenic
1001194683 5:169661784-169661806 CAAGATCTCCTCCTTTTTAAAGG + Intronic
1001376685 5:171266307-171266329 CAAGATTTCTCATTTTAAAATGG - Intronic
1001793433 5:174481530-174481552 CAAAATTTCCTTCTTTTTAAAGG - Intergenic
1002320149 5:178370330-178370352 CAGGATTTCCTCCTTTTGTAAGG - Intronic
1002993370 6:2258549-2258571 AAAAATTTCCCTCTTTTAATAGG + Intergenic
1003106815 6:3223056-3223078 CAAGATTTCCATTATTTAAAAGG - Intergenic
1003143404 6:3490210-3490232 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1003143507 6:3491141-3491163 CCAAATTTCCCCTTTTTACATGG - Intergenic
1004004512 6:11626680-11626702 CTAAATTTCCCCCTTCAAAAAGG - Intergenic
1004175279 6:13334510-13334532 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1004484621 6:16054516-16054538 CAAGATGTCTCCCTCTCAAAAGG + Intergenic
1004589076 6:17031337-17031359 CCAAATTTCCTCTTTTTAAAAGG - Intergenic
1005127854 6:22469435-22469457 CCAGATATCTCGCTTTTAAATGG + Intergenic
1005258942 6:24035819-24035841 CAAAATTTCCTTCTTTTTAAAGG + Intergenic
1005603623 6:27452894-27452916 CAAGATTTCTCTTTTTTAACTGG + Exonic
1005630593 6:27703891-27703913 CCAAATTTTCCCTTTTTAAAAGG + Intergenic
1006247594 6:32753155-32753177 CAAGATTTCCTTCTTTTATACGG - Intergenic
1006279626 6:33039815-33039837 CATGATTTCATCTTTTTAAATGG + Intergenic
1006424127 6:33953561-33953583 CAAGATTTCCTTCTTTTTTATGG - Intergenic
1006692501 6:35901323-35901345 CCAGATTTTCTCTTTTTAAAAGG - Intronic
1007362073 6:41365880-41365902 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1007538186 6:42614662-42614684 CATGCATTCCTCCTTTTAAATGG + Intronic
1008172273 6:48223086-48223108 CAAGATTTCCTTCTTTCTAAAGG + Intergenic
1008358632 6:50587569-50587591 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1008658182 6:53637640-53637662 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1008790392 6:55224683-55224705 CAGGGTTTCCTTCTTTTAAAAGG - Intronic
1009410059 6:63356057-63356079 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1009492348 6:64307364-64307386 CAGGATTTCCTTCTTTTATAAGG - Intronic
1010174525 6:73012280-73012302 CAAAATTTCCTTCTTTTTAAGGG - Intronic
1010541160 6:77094002-77094024 CAGCTTTTCCCCCTTTTTAAAGG + Intergenic
1010802618 6:80194807-80194829 CAAGATTTGCCTTTTTAAAATGG + Intronic
1012462804 6:99483343-99483365 TAACATCTCCCTCTTTTAAAGGG + Intronic
1012522236 6:100135652-100135674 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1012715142 6:102659546-102659568 CAAGATTTCATTCTTTTATATGG - Intergenic
1013140547 6:107329527-107329549 CCAAATTTCCCCTTTTTATAAGG + Intronic
1013443597 6:110197755-110197777 CAAGATTTCCTTCTTTTTCAAGG + Intronic
1013608842 6:111775206-111775228 CAAAATTTCCCACTTATTAAGGG - Intronic
1014125945 6:117777103-117777125 CAATAAGTCCTCCTTTTAAAAGG - Intergenic
1014965607 6:127744494-127744516 TAAGATTTCCTTCTTTTTAAAGG - Intronic
1015148324 6:130012419-130012441 CATAATTTCCCTCTTTTTAAAGG - Intergenic
1016040013 6:139423020-139423042 GAAGATTTTCCCCTGTGAAATGG + Intergenic
1016051603 6:139536007-139536029 CAATATTACCCCCTATTTAATGG - Intergenic
1016119044 6:140325329-140325351 CAAGATTTTCATCTTTTAAGTGG + Intergenic
1016661673 6:146588235-146588257 CTAGTTTCCCCTCTTTTAAAGGG + Intergenic
1017180088 6:151543794-151543816 CAGGATTTCACTCTTTTAAAAGG + Intronic
1019867578 7:3727114-3727136 CAATGTTTCCCTCTTTTGAAGGG + Intronic
1020356951 7:7288054-7288076 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1020383577 7:7572071-7572093 TAAGTTTTCCCCCCTTCAAAGGG + Intronic
1021288275 7:18810035-18810057 CAAAATTTCCTTCTTTTTAAAGG - Intronic
1021577156 7:22115260-22115282 CCAGATTTCCCACCTTGAAAGGG + Intergenic
1021878309 7:25069399-25069421 CAATATTTCCCACTTGCAAAAGG - Intergenic
1021905401 7:25328370-25328392 CCAAATTTCCCCCTTTTATAAGG - Intergenic
1022062318 7:26809920-26809942 CAAGATTTCCTTCTTTTGAAAGG - Intronic
1022171073 7:27832155-27832177 CAAGATTTTCAGCTTTTTAAAGG + Exonic
1022284424 7:28941538-28941560 CTAAATTTCCCCTTTTTATAAGG - Intergenic
1022552600 7:31255528-31255550 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1022711877 7:32858583-32858605 CAGGATTTGCCCCTTTTCACTGG + Intergenic
1022715789 7:32897037-32897059 CATAATTTTCTCCTTTTAAAAGG - Intergenic
1022736166 7:33078120-33078142 CAATGTTTCCCTCTTTTCAAAGG - Intergenic
1022784269 7:33621823-33621845 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1022912781 7:34916370-34916392 CAGGATTTCCCCCTTTTCACTGG - Intergenic
1023115665 7:36859664-36859686 CCTCATTTCCCTCTTTTAAATGG + Intronic
1023117151 7:36873667-36873689 CATGATTTCTCCCTTTGTAAGGG + Intronic
1023166801 7:37350811-37350833 TCAGATTTCCTCCTCTTAAAAGG - Intronic
1023335367 7:39163830-39163852 CAAGATTTCCTGCTTTTTTAAGG - Intronic
1023372448 7:39525353-39525375 CAGGATTTCCTTCTTTTTAAGGG - Intergenic
1024499217 7:50085130-50085152 CCAAATTTCCCCTTTTTATAAGG - Intronic
1024729772 7:52241366-52241388 CAGGATTTCCTTCTTTTATAAGG + Intergenic
1025267826 7:57480172-57480194 CAATATTTCCCCCCTTTTTAAGG + Intergenic
1025820452 7:64957703-64957725 TAGGATTTACCCCTTTTTAAAGG - Intergenic
1025953272 7:66162899-66162921 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1026234540 7:68514782-68514804 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1026336544 7:69398699-69398721 CCTGACTTACCCCTTTTAAATGG + Intergenic
1027929378 7:84511285-84511307 CATGATTTCCACCTTAGAAATGG + Intergenic
1027945650 7:84742079-84742101 TAAATTTTACCCCTTTTAAAGGG + Intergenic
1028041554 7:86060072-86060094 CAAGATTTCATTCTTTTATATGG + Intergenic
1028124755 7:87100050-87100072 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1028305049 7:89252700-89252722 CAAGATTTCATTCTTTTATATGG - Intronic
1028361378 7:89970809-89970831 CAAGATTTCCTTCTTTTTTAAGG + Intergenic
1028366887 7:90042456-90042478 CAAAATTTCCTCCTTTTACAGGG + Intergenic
1028418926 7:90610734-90610756 CTAAATTTCCCCTTTTTACAAGG + Intronic
1028538342 7:91914517-91914539 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1028860455 7:95643523-95643545 CAAGATTTTGCCCTTTTTATTGG + Intergenic
1029157041 7:98524760-98524782 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1029922999 7:104286407-104286429 CAACATTTTCACCTTTTGAAAGG + Intergenic
1030183312 7:106733242-106733264 CAGGATTTCCTTCTTTTAAAAGG - Intergenic
1030465458 7:109896609-109896631 CAGTGTTTCTCCCTTTTAAATGG + Intergenic
1030547247 7:110911927-110911949 CAGAATTTTCTCCTTTTAAAAGG + Intronic
1030934904 7:115573748-115573770 CAACATTTCCTCCTTTAATAGGG - Intergenic
1031036175 7:116790435-116790457 CAAGATTTCCTTCTTTTTAAAGG + Intronic
1031376119 7:121027853-121027875 CAAGAGTTCCCCACTCTAAATGG - Intronic
1031610524 7:123820973-123820995 CATTATTTCCTTCTTTTAAAAGG + Intergenic
1031678786 7:124645230-124645252 CAGAATTTCCCTCTTTTCAAAGG + Intergenic
1031858421 7:126949455-126949477 CAAGAAGACCCTCTTTTAAAAGG + Intronic
1031873705 7:127114302-127114324 CATGATTTCCCCATTTCAATAGG - Intronic
1031923265 7:127616328-127616350 CAAGCTTTCCCCTTTCCAAATGG + Intergenic
1032771334 7:135060722-135060744 AAAGATTTCCTTCTTTTTAAAGG + Intronic
1033005850 7:137561240-137561262 CAAGATTTCATTCTTTTTAATGG - Intronic
1033160247 7:138989890-138989912 CAAGATTTCCTTCTTTTTTAAGG + Intergenic
1033322244 7:140350466-140350488 CTGGCTTGCCCCCTTTTAAAGGG - Intronic
1033925967 7:146460640-146460662 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1034023956 7:147676835-147676857 CAAGATTTCCTCCTTTTTCATGG + Intronic
1034032540 7:147784121-147784143 CCAGATATCCCCTTTTTATAAGG + Intronic
1034388565 7:150763383-150763405 CAGGATTTCCTTATTTTAAAAGG - Intergenic
1034445002 7:151109535-151109557 CCAAATTCCCCCCTTTTATAAGG + Intronic
1035086239 7:156260922-156260944 CAGGATTTCCTCCTTTTATATGG - Intergenic
1035491522 7:159283784-159283806 CAATTTTTCCCCCTTTTTACAGG + Intergenic
1035528975 8:336536-336558 CCAAATTTCCCCATTTTACAAGG - Intergenic
1037044463 8:14280425-14280447 CAATATTTCTTCCTTTTAAAAGG - Intronic
1037215394 8:16445346-16445368 CCACATTTCTCCCTTTTATAAGG - Intronic
1037738045 8:21582532-21582554 CAACATTTCCAACTTTGAAATGG - Intergenic
1037745289 8:21638940-21638962 CAGGATTTCCGTCTTTTTAAAGG - Intergenic
1037823942 8:22149560-22149582 CAAGAGTTCTCACTTTTGAAAGG + Intronic
1038120572 8:24609708-24609730 CTAAATTTCCCCTTTTTATAAGG - Intergenic
1038199472 8:25398715-25398737 CCAAATTTCCCCTTTTTATAAGG + Intronic
1038854720 8:31319049-31319071 GAAGTCTTCCCCCTTTCAAAAGG - Intergenic
1038895052 8:31773189-31773211 CACACTTTCCCCTTTTTAAAAGG - Intronic
1039042257 8:33418891-33418913 CAGGATTTCATCCTTTTTAATGG - Intronic
1039046815 8:33458105-33458127 CAAAATTTCCCCTTTTTATAAGG - Intronic
1039830992 8:41214588-41214610 CAAGATTTCCCTCTTTCTAAAGG + Intergenic
1039909126 8:41810378-41810400 CAAGATTTCCCTCTTTTGGGGGG - Intronic
1040963029 8:53054768-53054790 CAGAATTTCCCCCATTTTAAAGG + Intergenic
1041032307 8:53749685-53749707 CAGGAATTCCCCATTTTACAAGG - Intronic
1041117785 8:54557043-54557065 CATGATTTCCTTCTTTTTAAAGG - Intergenic
1041433210 8:57807789-57807811 CAAGATTTCCTTCTTTTTTAAGG - Intergenic
1041570967 8:59336521-59336543 GCAAATTTCCCCCTTTTATAAGG - Intergenic
1041664228 8:60427036-60427058 CAAGGTTTGCTCCTTCTAAATGG + Intergenic
1042074231 8:64971966-64971988 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1042627430 8:70773661-70773683 GAACACTTCCCCCTTTTAACTGG - Intronic
1043346671 8:79305636-79305658 CAGGATTTCCTCCTTTTTTAAGG + Intergenic
1043636768 8:82394116-82394138 CAAGATTTCCTTCTTTTTGAAGG + Intergenic
1044188578 8:89284806-89284828 CAAGATTTCACAGTTTTACATGG + Intergenic
1044214588 8:89594060-89594082 CAAGATCTCCTTCTTTTTAAAGG - Intergenic
1044706493 8:95013913-95013935 CCAGATTTCCCCATTGTATAAGG - Intronic
1044887574 8:96795303-96795325 CAAGATCTCATCGTTTTAAAAGG - Intronic
1045269293 8:100648802-100648824 TAAGTTTGCCCCCTTTAAAAAGG - Intronic
1045432994 8:102131268-102131290 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1045832885 8:106485774-106485796 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1045883351 8:107066426-107066448 CAGAATTTCCCTCTTTTAAAAGG - Intergenic
1045904280 8:107324362-107324384 CAACATTTTCCCTTTTTATAAGG - Intronic
1046662847 8:116967186-116967208 CAAGATTTCTCTGTCTTAAACGG + Intronic
1046873828 8:119231745-119231767 CAGGATTTCTGCCTTTTTAAAGG - Intronic
1047434647 8:124826053-124826075 CCAAATTTCCCCTTTTTATATGG + Intergenic
1047573728 8:126130574-126130596 CCAAATTTCCCTCTTTTATAAGG - Intergenic
1047909390 8:129510762-129510784 CCAGACTTCCCCTTTTTATAAGG + Intergenic
1048039641 8:130713505-130713527 CAGGATTTCCTTTTTTTAAAAGG + Intergenic
1048267585 8:133001070-133001092 CAACATTTCCCTTTTTTACAAGG + Intronic
1048326718 8:133445285-133445307 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1048394312 8:133999311-133999333 CAAGATTTCCTTCTTTTATAAGG - Intergenic
1049079089 8:140427441-140427463 AAAGATTTCCAGCTTTTAGAAGG + Intronic
1050241422 9:3639873-3639895 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1050251339 9:3748049-3748071 CAAGAGTTGCCCCTTTACAATGG - Intergenic
1050784450 9:9382972-9382994 CAAGATTTTCTTCTTTTATAAGG - Intronic
1050854409 9:10333603-10333625 TAAGATTTTACCTTTTTAAATGG - Intronic
1051227653 9:14918820-14918842 CAAGATTTTCTTCTTTTCAAAGG - Intergenic
1051317417 9:15856504-15856526 TAAGATTTCCTTCTTTTAAAAGG + Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1051667025 9:19475253-19475275 CCAAATTTCCCCCTTTTGAAAGG + Intergenic
1051720918 9:20036659-20036681 CAAAATTTCTTCCTTTTTAAAGG + Intergenic
1051764221 9:20504411-20504433 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1051982772 9:23044784-23044806 CAGGATTTCCTCCTTTTTTAAGG + Intergenic
1052077888 9:24166632-24166654 CAGGATTTCCCTCTTTTTAATGG + Intergenic
1052321939 9:27177012-27177034 CAGGATTTCCTTCTTTTCAAAGG + Intronic
1052461762 9:28773525-28773547 CAACATTTCCCCCCATTAAATGG + Intergenic
1052566814 9:30164933-30164955 CAAGATTTCCTTCTTTTCAAAGG + Intergenic
1052968176 9:34358317-34358339 CAGTATTTCCTTCTTTTAAATGG + Intergenic
1054827137 9:69584676-69584698 CATTATTTCCCCTTTTAAAATGG - Intronic
1055010702 9:71561792-71561814 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1055105357 9:72506490-72506512 CCAAACTTCCCCCTTTTATAAGG + Intergenic
1055362340 9:75506307-75506329 CAAGATATCCTTCTTTTTAAAGG + Intergenic
1055391758 9:75829246-75829268 CAAAAATCCCACCTTTTAAAGGG - Intergenic
1055570596 9:77613032-77613054 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1055576722 9:77667478-77667500 CTAGTTTTCACCATTTTAAATGG - Intergenic
1055876159 9:80944147-80944169 AAACATTTCCCCCTTTTGTAAGG - Intergenic
1055917077 9:81415240-81415262 CAACATTTCTCTCTTTTAAAAGG - Intergenic
1056129390 9:83568456-83568478 CAAGATTTCTCTCTTTTTAAAGG - Intergenic
1056663884 9:88565185-88565207 CAAGATTTCCCTCTTTTGTAAGG + Intronic
1056681585 9:88724055-88724077 CAAGATTTCCATCTTTTTAAAGG + Intergenic
1056719643 9:89060702-89060724 CAAGATTGCATCATTTTAAAAGG + Intronic
1057524896 9:95789900-95789922 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1057710209 9:97434181-97434203 CAGGATTTCCTCCTTTATAAAGG - Intronic
1057984209 9:99693120-99693142 AAAGTTTCACCCCTTTTAAAAGG + Intergenic
1058352874 9:104047254-104047276 CAAGATTTCATTCTTTTTAATGG - Intergenic
1058628782 9:106963973-106963995 CAAGATTTCCTTCTTTTTTAAGG + Intronic
1058640904 9:107084200-107084222 CAGGATTTCCCTCTTTTTAAAGG - Intergenic
1059144026 9:111881572-111881594 AAAGCTTTCCCCCTTATAAGTGG + Intergenic
1060020795 9:120129398-120129420 CCAAATTTCCCCATTTTATAAGG + Intergenic
1060329594 9:122654841-122654863 CAGGATTTCCCCCCTTTGTAAGG + Intergenic
1060394974 9:123309639-123309661 CTAAATTTCCCCTTTTTATAAGG - Intergenic
1061551555 9:131337652-131337674 CCACATTTCCCCTTTTTATAAGG - Intergenic
1203638157 Un_KI270750v1:133344-133366 CAGGATTTCCTTCTTTTGAAAGG + Intergenic
1185675115 X:1842864-1842886 CAACTTTTCCCCCTCTTATAAGG - Intergenic
1186295445 X:8143653-8143675 CGAGATCTCCCCCTCTTAGAAGG + Intergenic
1186403049 X:9277293-9277315 CCAAATTTCCCCTTTTTAGAGGG + Intergenic
1186442628 X:9599242-9599264 CCAAATTTCCCCTTTTTATAAGG + Intronic
1187036686 X:15547954-15547976 CTAAATTTTCCCCTTTTCAAAGG - Intronic
1187044790 X:15636356-15636378 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1187060788 X:15785336-15785358 CAGGATTTCCTTCTTTTTAAAGG - Exonic
1187571074 X:20502687-20502709 CAGGATTTCCTTCTTTTAAAAGG + Intergenic
1188063299 X:25627368-25627390 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1188149660 X:26656030-26656052 CTAAATTTCCCCCATTTAAAAGG - Intergenic
1188206406 X:27364338-27364360 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1188226068 X:27599184-27599206 CAGGATTTCCTTCTTTTTAAAGG - Intronic
1188465339 X:30473185-30473207 CAAGATTTCCTTCTTTTTTATGG - Intergenic
1188656266 X:32700237-32700259 CAAAATTTCCTTCTTTTTAAAGG - Intronic
1188818735 X:34747470-34747492 CAAGATTTCCTTCTTTTATAAGG - Intergenic
1188951852 X:36385791-36385813 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1189028659 X:37427782-37427804 CAGGATTTCCTTCTTTTATAAGG + Intronic
1189221330 X:39374891-39374913 CAAGAAGTTACCCTTTTAAAGGG - Intergenic
1189264630 X:39704588-39704610 CAGGATTTCCCCCTTTTTAAAGG - Intergenic
1189283928 X:39838695-39838717 CAAGATTAACCCCTCTTGAAGGG + Intergenic
1189714734 X:43853659-43853681 CCAAATTTCCTCCTTTTACAAGG - Intronic
1189961568 X:46329452-46329474 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1190124459 X:47691491-47691513 CAGGATCTCCTCCTTTTATATGG - Intergenic
1190146404 X:47895276-47895298 CCAAATTTCCCCTTTTTATAAGG - Intronic
1190500304 X:51069410-51069432 CAAGATTTCCTTCTTTTTTATGG - Intergenic
1190546096 X:51529134-51529156 CAGGATTTCCTTCTTTTATAAGG - Intergenic
1191251606 X:58262625-58262647 CAAGAATTCCCCCATGGAAAGGG + Intergenic
1191806350 X:65138405-65138427 CAGGATTTTCTACTTTTAAAAGG + Intergenic
1191997901 X:67116113-67116135 CCACATTTCCCCTTTTTATAGGG + Intergenic
1192253415 X:69433355-69433377 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1192605234 X:72509548-72509570 CATGATTTCCTTCTTTTTAAAGG - Intronic
1192637864 X:72836908-72836930 CATGATTTCCTTCTTTTACATGG - Intronic
1192643850 X:72883907-72883929 CATGATTTCCTTCTTTTACATGG + Intronic
1192877465 X:75247037-75247059 CAAGTTATCCCTCTTTTAAAAGG + Intergenic
1193579727 X:83250119-83250141 CAGGATTTCCCCCTTCTTTAAGG + Intergenic
1193717325 X:84948314-84948336 CAAAATTTCCCCAGATTAAATGG - Intergenic
1193883267 X:86953035-86953057 CAATATTTCCTCCTTTTTTAAGG - Intergenic
1194698594 X:97086224-97086246 AAAGATTTCCTTCTTTTTAAAGG - Intronic
1195209552 X:102640064-102640086 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1195466729 X:105187548-105187570 CAAGATTTTCTACTTTTTAAAGG - Intronic
1195840328 X:109169068-109169090 AAATATTTTCCCTTTTTAAATGG - Intergenic
1195863514 X:109406340-109406362 CTAGTTTTCACCCTTCTAAATGG - Intronic
1195875064 X:109531922-109531944 CAGGATTTCTTCCTTTTATAGGG + Intergenic
1196460064 X:115920401-115920423 CAAAATTTCCCCAGATTAAATGG - Intergenic
1196516952 X:116625100-116625122 CAGGATTTCCTTCTTTTATAAGG - Intergenic
1196902072 X:120394531-120394553 CAGGATTTCCCTCTTTTTAAAGG - Intergenic
1197521215 X:127498967-127498989 GACATTTTCCCCCTTTTAAATGG - Intergenic
1197921588 X:131600064-131600086 CAAGATTTCCTCCTTTTTGAAGG + Intergenic
1197946348 X:131843051-131843073 CAGGATTTCCTTCTTTTTAAAGG + Intergenic
1198122281 X:133606091-133606113 AAATATGTCCCCCTGTTAAATGG + Intronic
1198251426 X:134882901-134882923 CAAGAGTTCGCTTTTTTAAAGGG - Intergenic
1198316911 X:135477264-135477286 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1198483222 X:137060152-137060174 CCAAATTTCCCCTTTTTATAAGG + Intergenic
1198487244 X:137099944-137099966 CCAAATTTCCCCTTTTTATAAGG - Intergenic
1198526425 X:137505861-137505883 CAGGATTTCCTTCTTTTATAAGG - Intergenic
1199460007 X:148073949-148073971 CAGGATTTCCTTCTTTTTAAAGG - Intergenic
1199558357 X:149134324-149134346 CAGGATTTCCTTCTTTTTAATGG + Intergenic
1199568356 X:149242106-149242128 CAGGATTTTCTTCTTTTAAAAGG - Intergenic
1199801911 X:151260109-151260131 CTAAATTTCCCTCTTTTATAAGG + Intergenic
1200822129 Y:7597356-7597378 CAAAATGTCCTCCTTTTATAAGG - Intergenic
1200925412 Y:8649935-8649957 CAAGATGTACCCCTTGTAAAAGG + Intergenic
1201737643 Y:17286581-17286603 CAAGATTTCCTTCTTTTTCAAGG - Intergenic