ID: 962277873

View in Genome Browser
Species Human (GRCh38)
Location 3:134029679-134029701
Sequence CGGAGTCCGCGGGGTCTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962277873_962277881 8 Left 962277873 3:134029679-134029701 CCCGGAAGACCCCGCGGACTCCG 0: 1
1: 0
2: 0
3: 12
4: 76
Right 962277881 3:134029710-134029732 AATGTTGCCGAAGACCGAGCGGG 0: 1
1: 0
2: 0
3: 2
4: 44
962277873_962277880 7 Left 962277873 3:134029679-134029701 CCCGGAAGACCCCGCGGACTCCG 0: 1
1: 0
2: 0
3: 12
4: 76
Right 962277880 3:134029709-134029731 TAATGTTGCCGAAGACCGAGCGG 0: 1
1: 0
2: 0
3: 0
4: 28
962277873_962277883 16 Left 962277873 3:134029679-134029701 CCCGGAAGACCCCGCGGACTCCG 0: 1
1: 0
2: 0
3: 12
4: 76
Right 962277883 3:134029718-134029740 CGAAGACCGAGCGGGCACAGCGG 0: 1
1: 0
2: 0
3: 8
4: 85
962277873_962277886 25 Left 962277873 3:134029679-134029701 CCCGGAAGACCCCGCGGACTCCG 0: 1
1: 0
2: 0
3: 12
4: 76
Right 962277886 3:134029727-134029749 AGCGGGCACAGCGGCCGGCTCGG 0: 1
1: 0
2: 1
3: 6
4: 129
962277873_962277884 20 Left 962277873 3:134029679-134029701 CCCGGAAGACCCCGCGGACTCCG 0: 1
1: 0
2: 0
3: 12
4: 76
Right 962277884 3:134029722-134029744 GACCGAGCGGGCACAGCGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962277873 Original CRISPR CGGAGTCCGCGGGGTCTTCC GGG (reversed) Intronic
900146974 1:1162690-1162712 CGGAGTCTGCGGGGCCTGCGGGG + Intergenic
903585636 1:24413567-24413589 CGGAGGCCGGGGGGTCTCCGCGG + Intronic
906704524 1:47885288-47885310 GGGAGTCAGCGAGGGCTTCCTGG - Intronic
921217609 1:212950867-212950889 CGGGGTCCGGGAGGGCTTCCTGG + Intronic
1063454243 10:6172095-6172117 CGCAGTCCCCAGGGTGTTCCGGG - Intronic
1064261086 10:13787214-13787236 CGGAGCTCACGGGGTTTTCCAGG - Intronic
1070238574 10:74655653-74655675 GGGAGGCCCGGGGGTCTTCCTGG - Intronic
1077001994 11:328126-328148 CGGAGTCCTGGGGGACTTGCGGG - Intergenic
1077278510 11:1729910-1729932 AGGAGCCCCCGGGGGCTTCCAGG + Intergenic
1077478773 11:2803288-2803310 CGGAGTCAGCAAGGGCTTCCTGG + Intronic
1080639157 11:34148779-34148801 CGGAGTCCTCCGGGACTTCCGGG - Intergenic
1082952348 11:58830920-58830942 GGGAGGCAGAGGGGTCTTCCTGG - Intergenic
1091223273 11:133943443-133943465 CTGGGTCCTCGGGGTCTCCCTGG - Intronic
1095431990 12:42144503-42144525 CGCAGGCCGCGGTGGCTTCCTGG - Exonic
1098160992 12:67648531-67648553 CGGAGGCCGCCGAGTTTTCCGGG + Intronic
1103994477 12:124820373-124820395 AGGAGTCCGGGAGGTCTTCCTGG + Intronic
1104860670 12:131921750-131921772 CCGAGGCCGCAGGCTCTTCCTGG - Exonic
1105041771 12:132966766-132966788 CGAGGTCAGGGGGGTCTTCCTGG - Intergenic
1106190712 13:27450333-27450355 CGGAGTCGGAGGGTTCTGCCGGG - Intronic
1106248795 13:27968812-27968834 CGCAGTCCCCGGGGCCATCCTGG - Exonic
1115753010 14:36508758-36508780 GGGAGTCTGCGGGGCCTTCAGGG - Intronic
1119904097 14:78285924-78285946 AGGAGCCAGGGGGGTCTTCCTGG - Intronic
1121437355 14:93928445-93928467 CGGCTCCCGCGGGGCCTTCCTGG + Exonic
1127988812 15:64096081-64096103 CGGAGTCCGAGGGGGCGGCCGGG + Exonic
1128333921 15:66774039-66774061 CCGAGTCCTCTGGGTCTTCAGGG - Intronic
1131829615 15:96345730-96345752 CGGAGACCTCGGGGACCTCCGGG + Intergenic
1132844293 16:1992830-1992852 CGGGGTCAGCGGGGTCAGCCGGG - Intronic
1132852926 16:2032965-2032987 CGGTGCCTGCGGGGGCTTCCGGG + Intronic
1134609617 16:15598008-15598030 AGGAGTCCACGGGTTGTTCCTGG + Intronic
1141099852 16:81189235-81189257 CGGGGTACACGGGGTGTTCCTGG + Intergenic
1142354766 16:89597167-89597189 CGGGGTCTGCGGGGTCTGCCTGG + Exonic
1144035251 17:11359418-11359440 CAGAGTCAGCTGGGCCTTCCAGG + Intronic
1148464313 17:47855868-47855890 CTGAGTCCGTGAGGTCTGCCAGG + Intronic
1148471447 17:47896306-47896328 CGCTGCCGGCGGGGTCTTCCCGG + Intronic
1150227653 17:63532527-63532549 TGGAGTCGGAGGGGGCTTCCTGG + Intronic
1158048867 18:53190918-53190940 CGGAGTCCGCTCTGTCTCCCAGG - Intronic
1160805935 19:992160-992182 CAGGGCCCGCGGGGTCTTCCGGG - Intronic
1160811352 19:1014284-1014306 CGGCGGCCGCGGGAGCTTCCCGG - Exonic
1163536672 19:17880906-17880928 TGGAGTCCCCGGGCTTTTCCTGG + Exonic
1163827362 19:19531076-19531098 GGGAGTCAGCGAGGGCTTCCTGG - Intronic
1165160220 19:33811590-33811612 CGGCGTCCGCGGAGCCCTCCAGG + Intronic
1166310430 19:41959335-41959357 CGGGGCCGGCGGGGTCTTCAGGG - Exonic
1166795767 19:45424453-45424475 CGGAGTCCGGAAGGGCTTCCTGG + Intronic
1167439443 19:49499956-49499978 CGGAGGCCCCTGGGTCCTCCAGG + Intergenic
926690385 2:15729151-15729173 TGGCGTCCTCGGGTTCTTCCAGG + Intronic
928317658 2:30258533-30258555 TGGAGTGGGCGTGGTCTTCCAGG + Exonic
930996139 2:57721046-57721068 CTCAGTCCGCTGTGTCTTCCTGG + Intergenic
940017692 2:149123988-149124010 AGGAGCCCGGGGGGCCTTCCTGG - Intronic
946024615 2:216664452-216664474 CTGAGTCTTTGGGGTCTTCCAGG + Intergenic
947872026 2:233444587-233444609 AGGACTCCGCGAGGGCTTCCTGG - Intronic
948951516 2:241255314-241255336 TGGAGTCCGCGGGGCCTTCATGG - Intronic
1169224363 20:3846985-3847007 CGGAGTCCGCCGGGACGCCCTGG + Intronic
1175139360 20:56848535-56848557 CGGAGCCGGTGGAGTCTTCCAGG + Intergenic
1176097385 20:63350363-63350385 CTGGGTACGCAGGGTCTTCCTGG - Exonic
1183083335 22:35471321-35471343 CGGAGTCCGCTGAGTTTTCCAGG - Intergenic
1185333310 22:50261124-50261146 CCGAGGCCGCGGCGCCTTCCCGG + Intronic
954409795 3:50365468-50365490 CGGCCTCCGCGGGGTCTGCGAGG + Exonic
956252479 3:67249295-67249317 TGGAGTCAGGGGGGTCTTCAAGG + Intergenic
956291965 3:67670068-67670090 CGGAGTCCCAGGTGTATTCCTGG + Intergenic
962277873 3:134029679-134029701 CGGAGTCCGCGGGGTCTTCCGGG - Intronic
964074458 3:152676326-152676348 AGGAGTCTGAGGGGTCCTCCAGG - Intergenic
964570610 3:158105185-158105207 CGGAGTTCGAGGGGTCTTGGCGG + Intronic
968589317 4:1449763-1449785 GGGGGTCCCCGGAGTCTTCCCGG + Intergenic
969961586 4:10949706-10949728 TGGTGTCTGCTGGGTCTTCCAGG - Intergenic
977257567 4:94757986-94758008 CGGAGTCGGCGGGGCCTCGCGGG + Intronic
985961885 5:3308817-3308839 GGGAGTCCGCGGGCTCAGCCCGG - Intergenic
988609646 5:32712430-32712452 GGGGGTCCACGAGGTCTTCCAGG + Exonic
990308672 5:54518087-54518109 CGGCGACCGCGGCCTCTTCCCGG + Exonic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1001381388 5:171308750-171308772 CGGATTCCGCCGGGTCGTCCCGG + Exonic
1017033902 6:150250112-150250134 GGGAGTCAGCGGGGGCCTCCTGG - Exonic
1019688572 7:2396578-2396600 TGGAGTTTGCGGGGTCTTCCAGG - Intergenic
1027152108 7:75739739-75739761 CTGAGTCCGCGGGCACCTCCCGG + Intergenic
1029477525 7:100793887-100793909 CGCAGTCCCCGGGGTCTGCCAGG - Exonic
1030269993 7:107660813-107660835 GGTAGTCCGCGGGGCATTCCGGG + Exonic
1033033144 7:137846535-137846557 CGGCGGCCGCGGGCTCGTCCAGG + Exonic
1034497730 7:151432318-151432340 CGGAGTCCCGGGGGACTTCCTGG - Intronic
1034552128 7:151827842-151827864 CGGAGGCCACGTGGTCCTCCTGG - Intronic
1034737214 7:153440369-153440391 GGAAGTCCGAGGGGACTTCCTGG + Intergenic
1041511475 8:58659238-58659260 CGGACCCCGCGCGGCCTTCCGGG + Exonic
1044442767 8:92241107-92241129 GGGGGTCCTCGGGGTCCTCCTGG - Intergenic
1049482837 8:142835027-142835049 CTGAGTTCGGGGGGTCTCCCTGG - Intronic
1056174402 9:84020147-84020169 CGGAGTCCGCTGTGTCGCCCAGG + Intergenic
1057208148 9:93185250-93185272 CGGCGTCCGCGGGGGCTCCGGGG - Exonic
1060966781 9:127716113-127716135 CAGAGGCCTCGGGGTCCTCCTGG + Exonic
1062106710 9:134758827-134758849 CGGTGACCTGGGGGTCTTCCTGG + Intronic
1187518140 X:19990912-19990934 CGGCGGCGGCGGGGGCTTCCCGG - Intergenic
1193109588 X:77714329-77714351 CGGAGTCCGGTGGGCCTTGCTGG - Intronic
1196734778 X:118974212-118974234 CACAGTCCGCAGGGTCTTCCGGG - Intergenic