ID: 962278624

View in Genome Browser
Species Human (GRCh38)
Location 3:134033754-134033776
Sequence GCTGCTGGGGAGGCAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 831}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962278624 Original CRISPR GCTGCTGGGGAGGCAAGAGA AGG Intronic
900080736 1:855580-855602 GCTGCTGTGGAGACAAAAGCTGG + Intergenic
900182853 1:1320018-1320040 GCTGCTGGGGAGGACAGGGCAGG + Intronic
900266553 1:1760048-1760070 GCTGCTGTGCAGGGAAGGGATGG + Intronic
900306895 1:2014536-2014558 GCTGCTGGGGAGACAAGATCTGG - Intergenic
900712404 1:4122656-4122678 CCAGCTGGGGAGGCGGGAGAAGG + Intergenic
901057200 1:6454163-6454185 GCTGCTGCGGCGGCAAGAACAGG - Intronic
901095845 1:6678762-6678784 GCTGCTTGGGAAGCTAGAGCAGG - Intronic
901129132 1:6951222-6951244 TCTGCTGGGGAGGCCACAGGTGG + Intronic
901417420 1:9127491-9127513 GCTGCCGGGAAGGCAAGGCAAGG + Intronic
901434265 1:9236546-9236568 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
901521296 1:9787041-9787063 GCTGCAGGGGTGAGAAGAGAAGG + Intronic
901862290 1:12082019-12082041 GCAGGAAGGGAGGCAAGAGAAGG - Intronic
901932994 1:12608853-12608875 ACTGCTTAAGAGGCAAGAGAGGG - Intronic
902108849 1:14060971-14060993 GCTGCTGGTGTGGGAGGAGAAGG - Intergenic
902283009 1:15388249-15388271 GAGGCTGGGGAGGGAAGGGAAGG - Intronic
902369861 1:15999243-15999265 GCAGCTGGGGAGCCAGCAGAGGG + Intergenic
902477164 1:16694328-16694350 GCTGCTGCGGCGGCAAGAACAGG + Intergenic
902611743 1:17601992-17602014 GCTGCTGGGGAGACCTGAGGTGG - Intronic
902614293 1:17615504-17615526 GTTTCGGGGGAGGCAAGGGACGG + Intronic
902663844 1:17923803-17923825 GATGTTGGGTAGGGAAGAGAGGG + Intergenic
902829698 1:19004091-19004113 GCTGCCGGGGAGGGATGAGGAGG - Intergenic
902879683 1:19363191-19363213 GCTGCTTGGGAGGCTGGGGAAGG - Intronic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
903050200 1:20594917-20594939 GGTGATGGGCAGGGAAGAGAAGG + Intronic
903177908 1:21591529-21591551 GCCCCTGGGGAGGCATGAAAGGG + Intergenic
903552506 1:24167804-24167826 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
904479853 1:30786904-30786926 GCTGCTGGGAAGTCAGGGGAGGG + Intergenic
904487142 1:30833419-30833441 GCTACTGGGGCATCAAGAGACGG + Intergenic
904501920 1:30917794-30917816 GATGCTGGGAAGGCTAGTGAGGG - Intergenic
904557435 1:31374302-31374324 GCTGCTGGGGAGGCTAAGGTAGG - Intronic
904637826 1:31898017-31898039 ACTGCTGTGGAGGAATGAGAAGG - Intergenic
904718045 1:32484094-32484116 GCTGCTTGGGAGGCTGGAGGGGG + Intronic
904771467 1:32883751-32883773 GCATCTGAGGAGGCAGGAGAGGG - Intergenic
905052941 1:35067761-35067783 GCTGCTTGGGAGGCTAGGGAGGG + Intronic
905158498 1:36010048-36010070 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
905227020 1:36485728-36485750 GGGGCTGGTGAGGCAGGAGAGGG - Intergenic
905461588 1:38126100-38126122 GCCGGTGCGGAGGCAGGAGATGG + Intergenic
905528356 1:38656419-38656441 TCTGCTGGGGATGGCAGAGAAGG + Intergenic
905795160 1:40811840-40811862 TCTGCTGGGGAGATTAGAGAGGG + Intronic
906129133 1:43445604-43445626 TGTGCTGGGCAGGAAAGAGAAGG - Intronic
906669689 1:47645465-47645487 CCACCTGGAGAGGCAAGAGAAGG + Intergenic
907052596 1:51339811-51339833 GCTGCTGGGGAATTAAGGGAAGG + Intronic
907251994 1:53145794-53145816 GCTTCTGGGGAGGCTTGAGCTGG + Intergenic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
907831822 1:58071430-58071452 GCTGCTGGGCTGCTAAGAGAAGG + Intronic
908210857 1:61898350-61898372 GCTACTGGGGAGGCTGGAGCAGG - Intronic
908294243 1:62697555-62697577 CCTGCTTGGGAGGGAAGAAAAGG + Intergenic
908361990 1:63377843-63377865 GCTACTGGGGAGGCTGGAGCAGG - Intronic
908577458 1:65475902-65475924 GCTGCTCGGGAGGCTTGAGGTGG + Intronic
909646282 1:77920788-77920810 GTTACTGGTGAGGGAAGAGAAGG + Intronic
910134006 1:83944594-83944616 GCTGCTCGGGAGGCTGGGGAAGG + Intronic
910570633 1:88698268-88698290 TCTGCTGGGGAAGAAAGAAAAGG - Intronic
912328015 1:108787214-108787236 GCTACTAGGGAGGCAAGGGTGGG - Intronic
912461349 1:109833963-109833985 GCTGCTGGGGAGGCTGAGGAAGG - Intergenic
912555947 1:110516098-110516120 GCTGCTGGGAAGGGAAGAGCAGG - Intergenic
913452164 1:118999814-118999836 GGAGATGGGGAGGAAAGAGAGGG + Intergenic
913556161 1:119969428-119969450 GCTGTTTGGGATGAAAGAGAAGG + Intronic
913570066 1:120110854-120110876 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914290875 1:146271820-146271842 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914551919 1:148722603-148722625 GCTGCTGGGGAGACATCAGCCGG + Intergenic
915000045 1:152580471-152580493 GGTGCAGAGGAGGCAGGAGAAGG + Exonic
915227043 1:154419001-154419023 GGTGGTGGGGAGCCCAGAGAAGG + Intronic
915323637 1:155069727-155069749 CCGGCTGGGGAGGTGAGAGAGGG - Intergenic
915346990 1:155202589-155202611 ACTGCAGGGGAGGCTTGAGATGG - Intronic
915571583 1:156747860-156747882 GAAGCTGGGGTGGCACGAGACGG - Intronic
915933871 1:160078591-160078613 GCTGCTTGGCAGGACAGAGAAGG + Intergenic
915994632 1:160550381-160550403 GCTGGTGGGGACACAGGAGAGGG + Intronic
916048200 1:161016543-161016565 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
916210380 1:162355346-162355368 GCTCCAAGGTAGGCAAGAGATGG + Exonic
916882081 1:169028737-169028759 GCTGCTTGGGAGGCAGAAGCAGG + Intergenic
917132895 1:171760759-171760781 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
917326470 1:173837883-173837905 GCTACTCGGGAGGCAAGGGCAGG - Intronic
917692397 1:177482717-177482739 GCTCCTGGGGAGGCAGAGGAAGG + Intergenic
917937245 1:179880999-179881021 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
919329309 1:196149042-196149064 CCAGATGGTGAGGCAAGAGAAGG - Intergenic
919721378 1:200840379-200840401 GCTGCTTGGGAGGCTAGGGCAGG - Intronic
919875652 1:201865318-201865340 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
920022671 1:202967321-202967343 GCGGCTGGGGGGGCAGGAGGCGG + Intergenic
920180969 1:204131509-204131531 CCTGCTGGGGGGACAGGAGAGGG - Exonic
920212035 1:204335386-204335408 TCTGCTGGGGAAGGAAGGGAGGG - Intronic
920246355 1:204590454-204590476 GCTTCTGGGGAGGCCTCAGAAGG + Intergenic
920382938 1:205546245-205546267 TCTGCTGGGGAGCCAAGGGCTGG + Intergenic
920504175 1:206505120-206505142 GCTGCAGGGAAGGACAGAGATGG + Intergenic
920844124 1:209579274-209579296 GCAGCTGGTGAGGCAGGAAAAGG - Intergenic
921348828 1:214214661-214214683 GCTGCTGGTGAAGCAGGAGGAGG - Intergenic
921976631 1:221209835-221209857 GCTGCTTGGGAGGCTGAAGAAGG + Intergenic
922313023 1:224414215-224414237 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
922807634 1:228398860-228398882 GGTGCAGGGGCGGCAGGAGAAGG + Intronic
923041440 1:230322784-230322806 GCTGGTGGGCAGGGGAGAGAGGG - Intronic
923113233 1:230909930-230909952 GCTCTTGGTGAGGGAAGAGAGGG + Intronic
923424463 1:233854988-233855010 GCTTCTGGGGAGGCCAGTCATGG - Intergenic
923854139 1:237827823-237827845 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
924099029 1:240584596-240584618 GCTACTTGGGAGGCTGGAGAAGG + Intronic
924788996 1:247226529-247226551 GCTACTGGGGAGGCAAAGGCAGG - Intergenic
1062830417 10:601787-601809 GCGGCTGGGGACGCAGGCGATGG + Intronic
1062886376 10:1019636-1019658 GCTGCTGGAGAGGGAGGCGAGGG - Exonic
1063172297 10:3519823-3519845 GCTGCCCGGGAGACAAGAGCAGG - Intergenic
1063312007 10:4961662-4961684 GCTGCTCGGGAGGCTAAAGCAGG - Intronic
1063489983 10:6455100-6455122 GCTGCTGGGGATGGCAGTGAGGG + Intronic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064025317 10:11844101-11844123 GCTGCTGGGGAGGCTGCAGTGGG - Intronic
1064568712 10:16670874-16670896 GCTACTGGGGAGGCTGGAGCAGG - Intronic
1064696934 10:17976031-17976053 GCTACTGGGGAGGTGGGAGAGGG + Intronic
1065313247 10:24436644-24436666 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
1065351225 10:24797382-24797404 GCTGCTTGGGAGGCTAGGGTAGG - Intergenic
1065789969 10:29251560-29251582 CCTGCTGGGGAGGGAAAAGCTGG + Intergenic
1066358197 10:34705374-34705396 GCTACTGGGGAGGCTAAAGCAGG + Intronic
1067161643 10:43830308-43830330 GCTGCTCGGGAGGCAAAGGCAGG + Intergenic
1067346298 10:45441325-45441347 GCAGCTGGGGAGGGGAGAGGAGG - Exonic
1067846074 10:49722392-49722414 GCTACTGGGGAGGCTAAAGTGGG + Intergenic
1068063846 10:52103398-52103420 GCTGAGGGGGAGGAAGGAGAGGG - Intronic
1068207252 10:53871863-53871885 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
1068631162 10:59298952-59298974 GCTGGTGGGGAGGAAGGAGGTGG + Intronic
1068737587 10:60431647-60431669 GCTGGTGGGGGGGCTAGGGAAGG + Intronic
1069029184 10:63577533-63577555 GCTACTGGGGAGGCCAAGGAGGG - Intronic
1069200623 10:65610488-65610510 GCTACTTGGGAGGCAAGGGCAGG + Intergenic
1069632514 10:69905638-69905660 GCTCCTGGGAAGGCTGGAGATGG + Intronic
1069633787 10:69913318-69913340 CCTTCTGGGGAGACAAGAGGGGG + Intronic
1069904030 10:71721873-71721895 GCAGCTGGGGAGGCTAAGGAAGG - Intronic
1070693133 10:78542534-78542556 ACTGCTGTGGAAGCAAGAAAAGG - Intergenic
1070748097 10:78947301-78947323 GCTGCTGGGCTGGCAGGGGAGGG - Intergenic
1070827174 10:79398071-79398093 GCTGCTTGGCAGGCAAGGGATGG + Intronic
1071052830 10:81472901-81472923 GCTGCAGGGGAGGCAGGACCCGG + Intergenic
1071275234 10:84048296-84048318 ACTGAAGGGGAGGCAAGAGTGGG - Intergenic
1072188811 10:93064564-93064586 CCTGCTGGGAATGCAAAAGAGGG - Intronic
1072517716 10:96202284-96202306 GCTGCTGGGCTGGAAACAGAGGG + Intronic
1072710713 10:97714113-97714135 GCTGCTGGGCAAGCACGAGCTGG + Exonic
1073043072 10:100620600-100620622 GCTGCTAGGGAGGGATGAGCGGG + Intergenic
1073057744 10:100713229-100713251 GCTGCTGTGGAGGCAGGGGGTGG - Intergenic
1073510337 10:104038795-104038817 GGTGCTGGGGAGTTGAGAGAAGG - Intronic
1074396488 10:113102025-113102047 GCTACTCGGGAGGCAGGAGGCGG + Intronic
1074565934 10:114577968-114577990 AAGCCTGGGGAGGCAAGAGAGGG - Intronic
1074711542 10:116182103-116182125 GGTGGTGGGGAGGGCAGAGATGG + Intronic
1075180538 10:120207035-120207057 GCTGCTGAGGAGATAATAGATGG - Intergenic
1075524086 10:123168046-123168068 GCTCTTAGGGAGGCAAGAGGCGG - Exonic
1075661573 10:124200554-124200576 AATGATGGGGAGGAAAGAGAAGG + Intergenic
1075811373 10:125227268-125227290 ACTGCTGCTGAGGCCAGAGAGGG + Intergenic
1076888675 10:133273838-133273860 CCTGCGGGGGAAGCAGGAGAGGG + Exonic
1077304571 11:1863322-1863344 ATAGCTGGGGAGGCAAGAGGTGG + Intronic
1077662283 11:4080344-4080366 TCTGATGGGAAGACAAGAGATGG - Intronic
1077792920 11:5461131-5461153 ACTGATGGGGTGGCAAGTGAGGG + Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1079339621 11:19601361-19601383 GCCACTGCGGAGGCAAGGGAAGG - Intronic
1080539064 11:33249506-33249528 GCTACTGGGGAGGCTGAAGAGGG - Intergenic
1080557098 11:33427779-33427801 ACTGCAGGGGAGAGAAGAGAGGG - Intergenic
1081379746 11:42399983-42400005 GCTACTGGGGAGGCCAAAGCAGG - Intergenic
1081576707 11:44323168-44323190 GCTGCTGGGGAGAAGGGAGAAGG - Intergenic
1081634199 11:44710003-44710025 GCAGCAGGGGAGGCAGGAGGAGG + Intergenic
1081693159 11:45092073-45092095 GCAGGAGGGCAGGCAAGAGACGG - Intergenic
1082988501 11:59187576-59187598 GGTGCTGGGAAAGCAAGAGGAGG - Intronic
1083201614 11:61124207-61124229 GCTGCTGGGGACCCTAGAGATGG - Intronic
1083224550 11:61276680-61276702 CCTGAGGAGGAGGCAAGAGAGGG + Exonic
1083309611 11:61777564-61777586 GCTGCGGGGGAAGGAAGGGAGGG + Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083664893 11:64269007-64269029 GCTGCTGAGGAGCCTAGATACGG - Exonic
1083764716 11:64836293-64836315 GCTCCTGAGGAGGCAGGGGAGGG + Exonic
1083933767 11:65859938-65859960 GCAGTTGGGGAGGCCTGAGATGG - Intronic
1084047512 11:66578325-66578347 GCTGCTTGGGAGGCCAAAGAGGG + Intergenic
1084050241 11:66594662-66594684 GCTACTGGGGAGGCCAAAGCAGG + Intronic
1084534421 11:69748283-69748305 GCTGCAGGGAAGGCCAGGGAGGG - Intergenic
1084565578 11:69926617-69926639 GCTGGAGGGGAGGAAGGAGATGG + Intergenic
1084597594 11:70126240-70126262 GCAGCTGGGATGGCAGGAGAGGG - Intronic
1084862441 11:72028882-72028904 CCTTCTGGTGAGACAAGAGATGG + Intronic
1086013680 11:82137793-82137815 GCTGCTAGGGAGGCAAAAGATGG + Intergenic
1086376538 11:86206604-86206626 TCTGCTGGGGAGGGGAGAGGGGG + Intergenic
1087789983 11:102395411-102395433 GCTACTGGGGAGGCTAAGGAAGG - Intergenic
1088231837 11:107681024-107681046 GCCACTGTGGAGCCAAGAGATGG - Intergenic
1088640832 11:111871374-111871396 GCTGCTGGGCAGCCGAGAGGCGG - Intronic
1088701808 11:112419735-112419757 GCAACTGGGGAGGCCAGGGATGG + Intergenic
1089061310 11:115628259-115628281 CCTGCTGGGGGTGGAAGAGAAGG + Intergenic
1089081486 11:115779885-115779907 GCTACTCAGGAGGCAAGAGATGG - Intergenic
1089139318 11:116273487-116273509 GCTGCTGGGGAGACGAGGAAGGG + Intergenic
1089170205 11:116506490-116506512 GCTCCTAGGGAGGGAACAGAAGG + Intergenic
1089287278 11:117415705-117415727 GCTGCTGGAGGGCCAAGACAAGG + Intergenic
1089640243 11:119843191-119843213 GCTCCAGGGGAGCCAGGAGAGGG + Intergenic
1090025537 11:123164413-123164435 GCTACTGGGGAGGCTAGGGTGGG - Intronic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1090204858 11:124878487-124878509 GCTGCTGGGGAGGAAGGGGAGGG + Intronic
1091184911 11:133638387-133638409 GCTGGTGGGGAGGGAAGGGAAGG - Intergenic
1091375469 12:22256-22278 GCTGCTGGGGAGGAAGAAGCAGG + Intergenic
1091892122 12:4066210-4066232 GCTACTTGGGAGGCTAAAGAGGG - Intergenic
1091995115 12:4987264-4987286 GCTGCCAGGCAGGCAGGAGAAGG - Intergenic
1092014745 12:5149373-5149395 GGTGCTGGGGAGTTAGGAGATGG + Intergenic
1092760759 12:11809051-11809073 GCTTCTTGGGAGGCATGAGGTGG + Intronic
1092793849 12:12091798-12091820 GGTGCAGAGGAAGCAAGAGATGG + Intronic
1092931568 12:13320654-13320676 GCTGCTCGGGAGGCCTGAGGTGG + Intergenic
1093715197 12:22374090-22374112 GCTGATGGAGAGGGAGGAGAGGG - Intronic
1094023773 12:25941477-25941499 GGGCCTGGGGAGGGAAGAGAAGG + Intergenic
1094373398 12:29763563-29763585 TCTGGTGGGGAGTCAAAAGAGGG + Intronic
1094391192 12:29952010-29952032 GCTACTGGGGAGGCTGGGGAAGG + Intergenic
1094478733 12:30863134-30863156 GCTGCTGGGCAGTGAAAAGATGG + Intergenic
1095120831 12:38416742-38416764 GCTACTGGGGAGGCTAAAGTGGG - Intergenic
1095206331 12:39443487-39443509 GCTGCTGGGCAGGGAGGCGAGGG + Intergenic
1095347402 12:41167916-41167938 GCTGCTGGGGAGGCAGGCCCGGG - Intergenic
1096269860 12:50156290-50156312 GCTGCTGGGGAGGCCAAGGCAGG + Intronic
1096306539 12:50482661-50482683 GCTACCGGGGAGGCTAGAGTGGG - Intergenic
1096494144 12:52029574-52029596 GCTACTTGGGAGGCAAAAGTGGG + Intronic
1096525252 12:52206640-52206662 GATGCTGGGGAGAGAAAAGAGGG + Intergenic
1096730005 12:53601820-53601842 GCTGCAGGGGATGAAAGAAATGG + Intronic
1096956848 12:55534813-55534835 GCTGCTGTGGAGGATAGAGGTGG - Intergenic
1097017660 12:55998712-55998734 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
1097061216 12:56285392-56285414 GCTACTGGGGAGGCAAAGGCAGG - Intronic
1097063057 12:56300220-56300242 TCTGGTGGGGAGGTAAGAAAGGG + Exonic
1097167792 12:57094829-57094851 GCAGGTGGGGAGGCAGGAGAAGG - Exonic
1097363803 12:58688409-58688431 GGTGGTGGGGAGGGGAGAGAGGG + Intronic
1097430974 12:59506580-59506602 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1100158045 12:91824701-91824723 GTTTAAGGGGAGGCAAGAGAGGG + Intergenic
1100788437 12:98103971-98103993 GATGCTGGGGAGCAAAGAAAGGG + Intergenic
1101155929 12:101927650-101927672 GCTACTCAGGAGGCAAGAGGGGG + Intronic
1101322681 12:103686880-103686902 GCTGGTGGGAAGGCCAGAGTTGG - Intronic
1101866389 12:108523515-108523537 GCTGCTGGGGCGGCAACTGCAGG + Exonic
1102281769 12:111624263-111624285 GCTACTGGGGAGGCTGAAGAGGG - Intergenic
1102612352 12:114123505-114123527 GCTACTCGGGAGGCTAAAGAAGG - Intergenic
1102951773 12:117036026-117036048 GCTGCAGGGCAGGCCAGACACGG - Intergenic
1103018659 12:117515812-117515834 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
1103021975 12:117541311-117541333 GCTGATGTGGAGGCATGGGAGGG + Intronic
1103340416 12:120218154-120218176 GCTGCTGGGGAGGCTAAAGCAGG - Intronic
1103531614 12:121606249-121606271 GCTACTGGGGAGGCTAAGGAAGG - Intergenic
1103624918 12:122210926-122210948 GCTACTGGGGAGGCTAAAGTGGG + Intronic
1103876156 12:124129009-124129031 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
1104598221 12:130134265-130134287 GGTGCTGGGGAGGGAGGAGCTGG - Intergenic
1104989567 12:132618322-132618344 GCTGCGGCGGAGGCAGGAGCTGG + Intergenic
1105036876 12:132931065-132931087 GCTACTGGGGAGGCTAAAGTGGG + Intronic
1106528729 13:30567712-30567734 GCTGGTGGTGAGGCAACTGAGGG + Intronic
1107104893 13:36632492-36632514 GCTGCTGGGATGGAAGGAGATGG + Intergenic
1107187206 13:37537706-37537728 GCTACTGGGGAGGCTAAGGAAGG - Intergenic
1107906796 13:45068856-45068878 GGTGCTGAGGAGGCAGGAGATGG + Intergenic
1108176592 13:47798736-47798758 GCTTCTGGAGAGGCAAAAGGAGG + Intergenic
1108350558 13:49586950-49586972 GATGCTGGGAAGACAAGAGTAGG - Intergenic
1109916266 13:68988420-68988442 GCTGCTCGGGAGGCAGAAGTAGG + Intergenic
1110463470 13:75773671-75773693 GCTGATTTGGAGGCAAGAGATGG + Intronic
1112268508 13:97947714-97947736 GCTACTGGGGAGGCTAGGGCAGG - Intergenic
1112531672 13:100210087-100210109 GCTACTTGGGAGGCTAAAGAAGG - Intronic
1113593937 13:111518282-111518304 GATGCTGGGGGGGCAGGTGAGGG - Intergenic
1113674124 13:112196373-112196395 GGTGCTGAGGAGGCAGGAGCAGG - Intergenic
1113728987 13:112626187-112626209 GCTGCTGGGGAGGCTGCAGAAGG + Intergenic
1114987001 14:28242017-28242039 GTTGCTGGGGAAACAATAGAAGG - Intergenic
1115486106 14:33912930-33912952 GCTGGTGGGGAGGGGAGAGGAGG - Intergenic
1115804940 14:37040086-37040108 GCTACTCGGGAGGCAGGAGCAGG + Intronic
1116369797 14:44115778-44115800 GTTGGTTGGGAAGCAAGAGAGGG - Intergenic
1116789469 14:49325164-49325186 GCTTCTGAGGAGCCAACAGAAGG - Intergenic
1116797684 14:49409478-49409500 ACTGCTGGGTGGGAAAGAGATGG - Intergenic
1116798233 14:49414434-49414456 GCTGCTTGGGAGGCTAGGGTGGG + Intergenic
1117346917 14:54841652-54841674 GCTGTTGGGGAAGGAAGAGTAGG - Intergenic
1117983185 14:61362226-61362248 GCTACTTGGGAGGCAGAAGAGGG + Intronic
1118718449 14:68576714-68576736 GCTGCACTGGAGGCAAGAAATGG + Intronic
1118725434 14:68625582-68625604 GCTACTCGGGAGGCCAAAGAGGG - Intronic
1119144222 14:72295381-72295403 GCAGCTGGAGAGGAAAGACAAGG + Intronic
1119304131 14:73593448-73593470 GCTACTTGGGAGGCAATGGAGGG - Intronic
1119671762 14:76525400-76525422 GCTGCTGGGAAGGAAAAGGAGGG + Intergenic
1119851136 14:77867399-77867421 GCTGCTGGGAAGGCAGGATGAGG - Intronic
1121324556 14:93012430-93012452 GCTGCTGAGGGGGCCAGGGAAGG + Intronic
1121472323 14:94165317-94165339 GCTGATGGGGAGGCTAGTGGCGG + Intronic
1122177829 14:99934261-99934283 GCTGCTGATGAGGCTTGAGAAGG - Intronic
1122584068 14:102792234-102792256 GCTACCGGGGAGGCTAAAGAAGG - Intronic
1122703548 14:103606189-103606211 GCTGCTGGGGAGGCTAAAGCAGG + Intronic
1122817063 14:104319100-104319122 GCTCCAGGGAAGTCAAGAGATGG + Intergenic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123686018 15:22797954-22797976 GCTGCTGGGGAGGCTGAGGAAGG - Intronic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1124143355 15:27097228-27097250 GCTGCTGGGCATGTAAGAAATGG + Intronic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124391339 15:29261126-29261148 GCTGCTTGGGAGGCTAGCGGGGG + Intronic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125338528 15:38651998-38652020 GCAACTGGGCAGGAAAGAGAAGG + Intergenic
1125510793 15:40291413-40291435 GCTGCAGCGGCGGCACGAGAAGG - Exonic
1125539340 15:40460734-40460756 GCTGCTGGGGAGGTGAGGGCTGG + Intronic
1125702960 15:41704544-41704566 GCTGCTGGGGAGGCTGAAGCAGG + Intronic
1125821171 15:42633029-42633051 GCTGCTGGGGGGCCAAGGTAGGG + Intronic
1126841463 15:52721338-52721360 GAAACTGGGGAGGCATGAGATGG + Intergenic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128006469 15:64246733-64246755 GCTGCTGGGAAGCCAGGATATGG + Intronic
1128084836 15:64878678-64878700 ACAGGTGGAGAGGCAAGAGAAGG + Intronic
1128235778 15:66066221-66066243 GCAGCAGGGTAGGCAAGAGGAGG + Intronic
1128330187 15:66750660-66750682 AGTGCTGGGAAGGGAAGAGAAGG + Intronic
1128442426 15:67724504-67724526 GCTGCTTGGGAGGCTAGTGTGGG - Intronic
1128766393 15:70253608-70253630 GCTGCACGGGAGGCAAGATGCGG - Intergenic
1129003791 15:72355412-72355434 GCTACTTGGGAGGCTAAAGAGGG + Intronic
1129038671 15:72665980-72666002 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129211220 15:74071250-74071272 GCTGCTGGAGCTGCAAGAGTTGG - Exonic
1129303774 15:74643358-74643380 GCTGCTGGTGAAACAAGAAAGGG + Intronic
1129399183 15:75269837-75269859 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129402790 15:75294113-75294135 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129459660 15:75694156-75694178 TCTGCTGGGCAGGCCAAAGAGGG + Intronic
1129522331 15:76193756-76193778 GCTGGTGGGGAGGCAGGGGCAGG - Intronic
1129650141 15:77480178-77480200 GCTGCTTGGGAGGCTAAAGTGGG + Intronic
1129704198 15:77785253-77785275 GCTGCTTGAGGGCCAAGAGAGGG - Intronic
1129868691 15:78927539-78927561 GATGGTGGCGAGGCAGGAGATGG - Intronic
1129883198 15:79020399-79020421 GCTGCTGTGGAAGCAAGAAGGGG - Intronic
1130041180 15:80406053-80406075 GGTGCTGGGGAGGCCAGAATTGG + Intronic
1130407452 15:83614480-83614502 TCAGCTGGCGAGGAAAGAGAAGG - Intronic
1130614448 15:85391594-85391616 GCTGCTGGGGAGGCTAAGGTGGG - Intronic
1132012846 15:98291120-98291142 CTTGCTGGGGAGGCTGGAGAGGG - Intergenic
1132507278 16:317398-317420 GCTGCTCGGGAGGCAGGTGCAGG + Intronic
1132540227 16:504973-504995 GGTGGTGGGGATGCAAGAGGAGG - Intronic
1133205759 16:4232620-4232642 GCTGCTTGGGAGGCTGGAGCAGG - Intronic
1133423405 16:5666180-5666202 GCAGCTGGGAAGGAAAGGGAGGG + Intergenic
1133462850 16:6002081-6002103 GCTACTGGGGAGGCTGAAGAGGG - Intergenic
1134128060 16:11629972-11629994 GGTGTTGGGGAGGGAAGAGAAGG + Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1134428506 16:14177709-14177731 GCTACTGGGGAGGCTGAAGAGGG + Intronic
1134516845 16:14894405-14894427 GCTGCAGGGGAGGCTGGAAAAGG + Intronic
1135295244 16:21273985-21274007 CCTGCTGGGGAGGGAAGAATGGG - Intronic
1135347002 16:21697383-21697405 GCACTTGGGGAGGCAAGAGGCGG + Intronic
1136068015 16:27771657-27771679 GCTGGTGGGGCGGGAGGAGAAGG - Intronic
1136251763 16:29009809-29009831 GGTGCTGGGAAGGGAAGGGATGG - Intergenic
1136609564 16:31357952-31357974 GCTGATGGGGAAGAAAGATAAGG + Intronic
1136882088 16:33908267-33908289 GCTGGTGGGGCTGCAAAAGAGGG + Intergenic
1137247625 16:46718525-46718547 GCTGCTTGGGAGGCAGGTGCTGG + Intronic
1137955286 16:52823401-52823423 GCTGGTGGTGTGGCAAGATAGGG - Intergenic
1138327233 16:56184879-56184901 GAGGCGGGGGAGGCAAGAAAAGG + Intergenic
1138443224 16:57047382-57047404 GCTGCAGGGGAGACTCGAGAGGG + Intronic
1138657808 16:58500939-58500961 CCTGCTGGGGAGGAACGAGGAGG + Intronic
1138706936 16:58924792-58924814 GCTGTTGGGGAGGCAGAAGTGGG - Intergenic
1139461158 16:67123463-67123485 GCTACTGGGGAGGCTGGAGCAGG + Intronic
1139968243 16:70757461-70757483 AGTGCTGGGGAGGCTGGAGAAGG + Intronic
1140584467 16:76273373-76273395 GCAGGAGGGGAGGGAAGAGAGGG + Intergenic
1141079642 16:81038730-81038752 GCTACTGGGGAGGCTAAAGCAGG - Intronic
1141154542 16:81588016-81588038 GTTCCTGGGGAAGCAAGAGCCGG - Intronic
1141531550 16:84649562-84649584 GATGCTGGAGAGCCCAGAGAGGG - Intronic
1142080031 16:88144053-88144075 CCTGCTGGGGAGACAGGAGTGGG + Intergenic
1142245763 16:88969418-88969440 GCTGCGGGGGTCGCAAGAGCGGG + Intronic
1142304741 16:89278901-89278923 TCTGCTGTGGAGGCAAAAGCCGG - Intronic
1142356137 16:89602955-89602977 ACTGCTGGGGAGGCAGGGCAGGG + Intergenic
1203089922 16_KI270728v1_random:1207179-1207201 GCTGGTGGGGCTGCAAAAGAGGG - Intergenic
1142472715 17:172236-172258 GCTGCTGAGAGGGAAAGAGAGGG - Intronic
1142521461 17:507701-507723 GCTGCTGGGGCCGGAAGTGATGG - Intergenic
1142801905 17:2351570-2351592 CCTGCTGGAGATGCAAGACAGGG - Intronic
1143140866 17:4741047-4741069 GCTGCCCGGGAGGCAGGAGGTGG + Exonic
1143187537 17:5019733-5019755 GCTGCTGGGGAGGATAGAGGTGG + Intronic
1143254883 17:5548740-5548762 GCTGCTGGGAGGTCAAGATAAGG - Intronic
1143364209 17:6395235-6395257 GATGCTGAGGAGGCACTAGAGGG + Intronic
1143470352 17:7170331-7170353 GCTGCTCGGGAGGCTAAAGCAGG + Intergenic
1143618943 17:8070193-8070215 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1143992913 17:10981796-10981818 GGGGCTGGGGAGACCAGAGAGGG + Intergenic
1144255586 17:13463978-13464000 TATGCTGGGCAGGCAAGAGAGGG + Intergenic
1144427588 17:15158285-15158307 GCTATTGTGGAGGCAACAGAGGG + Intergenic
1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG + Intronic
1144671788 17:17136881-17136903 GGTGCTGGGGAGGCAGCAGTTGG + Intronic
1145930915 17:28684733-28684755 GGTGCTGGGGAGGCAAAAATAGG - Intronic
1146635691 17:34502690-34502712 GCTGCGGGGGTGGAAAGAGGAGG + Intergenic
1146693514 17:34892669-34892691 GCTGCCTGGGCGGGAAGAGAGGG - Intergenic
1147137124 17:38440884-38440906 GGTGCTGGGGTGGTCAGAGATGG + Intronic
1147283535 17:39382329-39382351 GCTGCTGGGGAGGCTGAGGAAGG + Intronic
1148075075 17:44930991-44931013 CGTGCTGGGGAGGGAAGAGCGGG + Intronic
1148095569 17:45050870-45050892 GGAGCTGGGGAAGGAAGAGACGG + Intronic
1148105862 17:45118492-45118514 GCTGCAGGGGTGGCAGGAGAGGG + Exonic
1148272281 17:46271275-46271297 GCTACTTGGGAGGCTAGAGCAGG - Intergenic
1148354199 17:46964509-46964531 ATTGCTGGGGAGGCCAGAGGTGG + Intronic
1148433892 17:47666162-47666184 GCTACTGGGGAGGCTAGAGTGGG - Intronic
1148577721 17:48723260-48723282 GCTGCGGAGGGGGCAAAAGAAGG - Intronic
1148716349 17:49718863-49718885 GCTACTGGGGAGGCTATGGAAGG + Intronic
1148793405 17:50186020-50186042 ACTGCAGGGGAGGGGAGAGAGGG + Exonic
1149220620 17:54412362-54412384 GTTGCCAGGGAGGGAAGAGAAGG - Intergenic
1149441189 17:56675505-56675527 CCTGCTGGGGTGGCCAGAGGGGG - Intergenic
1149709516 17:58727813-58727835 GCTGTTTGGGAGGCCAGAGTTGG + Intronic
1150704432 17:67474517-67474539 ACTGCTGGGGAAACAGGAGAGGG - Intronic
1151352392 17:73539479-73539501 GCTGATGGGGAGAGGAGAGAGGG + Intronic
1151385515 17:73752995-73753017 GCTACTTGGAAGGCAGGAGAGGG + Intergenic
1151450122 17:74193683-74193705 GCTCCTGGGGAGGGCAGAGGAGG - Intergenic
1151863676 17:76785298-76785320 GCTGGTGGGGACGGAAGAGTGGG + Intergenic
1152034461 17:77863639-77863661 GTTGCTGGTGAGCCCAGAGAGGG + Intergenic
1152323849 17:79624339-79624361 GCTGCAGGGGAGGCTGGGGAAGG + Intergenic
1152595679 17:81236536-81236558 GCAGGTGGAGAGGCCAGAGATGG + Intronic
1152638500 17:81439880-81439902 GCTGAGGGGCAGCCAAGAGAGGG - Intronic
1152693079 17:81729945-81729967 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
1152753530 17:82077551-82077573 CCTGCTGGAGAGGCAGGGGAGGG - Intergenic
1152810966 17:82382761-82382783 GCAGCTGGGGAGGTCAGAGCTGG + Intergenic
1153277353 18:3380532-3380554 GCTGCTCCGGAGGCAAGGGAAGG + Intergenic
1153367437 18:4273292-4273314 TATGCTGGGGAAGCAAGAGCGGG - Intronic
1153429341 18:4999078-4999100 GCTGCTGGGGATGAAGGAGGGGG - Intergenic
1153582952 18:6593832-6593854 GGTGCTGGGGGGTCAGGAGAAGG + Intergenic
1153605018 18:6824423-6824445 GCTACTCGGGAGGCAAAAGCAGG + Intronic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154316132 18:13304541-13304563 GCTGCTGGGGAGGGCTGGGAAGG + Intronic
1155348118 18:24878725-24878747 CCTGCTGGGGAGCCATGATAAGG + Intergenic
1155770904 18:29696882-29696904 GCTACTCGGGAGGCTAAAGAAGG + Intergenic
1155814319 18:30286073-30286095 TCTGATGGGGAGGCAAAAAATGG - Intergenic
1155978109 18:32153646-32153668 GCTACTTGGGAGGCAAAAGTGGG + Intronic
1156310486 18:35918003-35918025 GCTACTGGGGAGGCAGAGGAAGG - Intergenic
1157165130 18:45351832-45351854 GGGGCTGGAGAGGCAAGAAAGGG + Intronic
1157298002 18:46459685-46459707 GCTGTTTGGGGGACAAGAGAGGG + Exonic
1158035654 18:53026665-53026687 GCTACTTGGGAGGCAAAGGAAGG - Intronic
1158494582 18:57942903-57942925 GTTGATGGGGAGGAAAGACATGG + Intergenic
1158712313 18:59848416-59848438 ACTTGTGGGGAGGCAAGGGAAGG + Intergenic
1158801151 18:60911031-60911053 GCTACTGGGGAGGCCAAAGTAGG + Intergenic
1159974328 18:74691980-74692002 GCTGCTAGGGAGGCTAGGGTGGG + Intronic
1160225023 18:77005769-77005791 GCTGCTGGGGAGGGCAGTGCTGG - Intronic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1160858381 19:1227451-1227473 GCAGCAGGGGAGGCCAGGGAAGG - Intronic
1161078600 19:2299216-2299238 GCTGCCGGGGAGGCAGGAGGGGG + Intronic
1161262333 19:3344949-3344971 GCTGCAGCGGAGGGAGGAGAGGG + Intergenic
1161269971 19:3384498-3384520 GCTACTGGGGAGGCAAAGGCAGG - Intronic
1161331617 19:3691217-3691239 GCTGCTGAGGATGGGAGAGATGG + Intronic
1161585174 19:5101943-5101965 TTTACTGGGGAGGCCAGAGAAGG - Intronic
1161633745 19:5373921-5373943 GCTGCTTGGGAGGCAAAGGTGGG - Intergenic
1162029587 19:7911628-7911650 GCAGCTGGGGAGGCAATGGCAGG + Intronic
1162030139 19:7913672-7913694 CCTGCTGGGGTGGCCAGAGCAGG + Exonic
1162099119 19:8329057-8329079 GCTGCTGGGGAGGCTGAGGAAGG + Intronic
1162412050 19:10512211-10512233 GCTACTGGGGAGGCTGAAGAAGG - Intergenic
1162412520 19:10515029-10515051 GCTGTTGGAGAGGCAAGATACGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162567456 19:11451990-11452012 GCTGCAGGGGAGAGGAGAGAGGG + Exonic
1162793596 19:13075516-13075538 GGTGCTGGGGAAGAAAGAAAGGG - Exonic
1162861676 19:13510202-13510224 GCTACTGGGGAGGCCAAAGTGGG + Intronic
1163109100 19:15147615-15147637 GCACCTGGGGTGGGAAGAGAAGG - Intergenic
1163766267 19:19165122-19165144 GGTGCTGGGGATGCAGGAGCAGG + Intronic
1164037578 19:21467888-21467910 GCTGCTGGGGAAGCAGCATAGGG - Intronic
1164226714 19:23252371-23252393 GCTACTGGGGAGGCAGAAGTAGG - Intergenic
1164628841 19:29747720-29747742 AGTGCTGGGGAGGCCAGAGGCGG - Intergenic
1164813624 19:31177415-31177437 GAGGCTGGGAAGGCAAGGGATGG - Intergenic
1165465081 19:35969294-35969316 GCTACTGGGGATGCTAAAGAAGG + Intergenic
1165604871 19:37093332-37093354 GCTGCTGGGGAGGCTGAGGAAGG - Intronic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165796741 19:38524073-38524095 GGTGGTGGGGAGGGAAGGGAAGG - Intronic
1165874313 19:38995047-38995069 GCTACTGGGGAGGCTGAAGAAGG - Intronic
1166123983 19:40702829-40702851 GCTGCGTGGGAGACAGGAGAGGG - Intronic
1166123992 19:40702881-40702903 GCAGCGGGGGAGACAGGAGAGGG - Intronic
1166254097 19:41590072-41590094 GCAGCTGGGGAGGGAAGACATGG - Intronic
1166266821 19:41689603-41689625 GGTGGAGGGGAGGCAAGAGGAGG - Intronic
1166349156 19:42186500-42186522 GCTGCTGGAGAGGCTAGATGGGG + Intronic
1166356536 19:42230574-42230596 GGTTGTGGGGAGGGAAGAGAAGG - Exonic
1166409453 19:42546947-42546969 GCAGCTGGGGAGGGAAGATGTGG + Intronic
1166730779 19:45057907-45057929 GCAGGTGGGGAGGGCAGAGAGGG - Intronic
1166748775 19:45154730-45154752 GCTGCTGGGGAGGCCAGTCGCGG + Intronic
1166826970 19:45615889-45615911 CCTGCGGGGGAGGGAAGGGATGG + Exonic
1166942333 19:46374407-46374429 GCTCCTGGGGAGGCTAAGGATGG + Intronic
1167100177 19:47399706-47399728 GCTGCTGAGGAGGCTAAGGAAGG + Intergenic
1167151729 19:47713900-47713922 GGAGCTGGTGAGGCAGGAGAGGG - Intronic
1167158885 19:47755190-47755212 GCTGCTGGGAAGGCACTGGAGGG + Intronic
1167247628 19:48383258-48383280 GCTGCTGCCGAGGAGAGAGATGG + Exonic
1167374041 19:49101861-49101883 TCTACTGGGGGGGGAAGAGAGGG - Intronic
1167411685 19:49347719-49347741 GCTGCTGGGGAGCTATGGGAGGG - Intronic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1168149148 19:54435706-54435728 GGTCCTGGGGAGGGAAGAGGAGG + Intronic
1168173968 19:54609394-54609416 GCCGTTGGGGAGGGGAGAGAAGG - Intronic
1168268945 19:55239355-55239377 GCTGCTGCAGAGGCAGGACAGGG + Intronic
1168287379 19:55341356-55341378 GCTGCCGGGGAGGCAGGGGGCGG + Intronic
1168408069 19:56121020-56121042 GCTGCTGGGGGGGCGTGAGTGGG - Intronic
1168618201 19:57855372-57855394 ACTTCTGGGGATGCCAGAGAGGG + Intronic
1202711180 1_KI270714v1_random:20154-20176 GCTGCTGCGGCGGCAAGAACAGG + Intergenic
925020627 2:564943-564965 GCCGCTGGGGAGGCTGCAGAGGG + Intergenic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
925665216 2:6246921-6246943 GCTGCTGGGGAGGCAGAGGCAGG + Intergenic
925812494 2:7714068-7714090 GCTGCTGGGCAGGACAGAGGAGG - Intergenic
925851244 2:8084290-8084312 TTGGGTGGGGAGGCAAGAGAAGG - Intergenic
926032084 2:9600591-9600613 GCTACTTGGGAGGCTAAAGAAGG + Intronic
926313864 2:11695494-11695516 GCTGGAATGGAGGCAAGAGAAGG + Intronic
926814005 2:16782406-16782428 GCTCCTGGGGAGGAAAGATGTGG - Intergenic
926985031 2:18613172-18613194 GCTGGTGGGAAGGGAAGAGAGGG + Intergenic
927136287 2:20098823-20098845 CCAGCTGAGGAGGCATGAGATGG - Intergenic
927144469 2:20153502-20153524 TCTGTTGGGGAGGGGAGAGAAGG + Intergenic
927270163 2:21198891-21198913 CCTGCTGGGCAGGGAAGAGCAGG - Intergenic
927362639 2:22253899-22253921 CCTTCTGGGGAAGCAAAAGATGG + Intergenic
927670531 2:25065290-25065312 GCTGCTCGGGAGGCTGAAGAGGG - Intronic
927678055 2:25121443-25121465 GCAGCAGGGGAGGCCTGAGAAGG + Intronic
927848284 2:26483360-26483382 GCAGCTGGGCAGGTAAGACAAGG - Intronic
927963884 2:27257415-27257437 GCTACTGGGGAGGTGAGACATGG - Intronic
929083626 2:38146750-38146772 GCTGCGGGGGTGGCGGGAGAAGG - Intergenic
929502431 2:42501864-42501886 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930344983 2:50168888-50168910 GGTGTTGGGGAGGAAAGAAAAGG - Intronic
931126465 2:59283414-59283436 GCTACTTGGGAGGCTAAAGAGGG + Intergenic
931256013 2:60573546-60573568 ACTGCTGGGGAGGAATGAGTAGG + Intergenic
931701608 2:64913582-64913604 GCTCCCTGGGAGGGAAGAGAAGG + Intergenic
931764447 2:65442396-65442418 GCTGCTTGGGAGGCTAAAGCAGG + Intergenic
932125585 2:69142838-69142860 GGTGCTGGAGAGATAAGAGAGGG + Intronic
932999162 2:76900119-76900141 GCTGCTTGGGAGGCTTGAGGTGG + Intronic
933938630 2:87227264-87227286 TATTCTGGGGAGGCAGGAGAGGG - Intergenic
934053577 2:88232392-88232414 GCTGCAGGGGAGGCAGTACATGG - Intergenic
934559732 2:95306950-95306972 GCTGCTGGGGAGGCGGGAGGAGG - Intronic
934744856 2:96752680-96752702 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
934854106 2:97718396-97718418 GATGCTGGGGAGGCCAGAGAAGG - Intronic
934902993 2:98175886-98175908 ACTGCAGGGGAGCCAAGAAATGG - Intronic
935064126 2:99633439-99633461 GCTGGAGGGGAGGAAAGAAAAGG + Intronic
936354505 2:111738509-111738531 TGTTCTGGGGAGGCAGGAGAGGG + Intergenic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
936480479 2:112880459-112880481 GCTGCTGGGGAGGCTTGGGAAGG + Intergenic
937305471 2:120867860-120867882 GCTGGAGGGGAGGAGAGAGAGGG + Intronic
937365348 2:121257265-121257287 GCTGTAGGGGAGGCAGGAGGGGG - Intronic
937913699 2:127088624-127088646 GCTACTGGGGAGGCTAGGGCAGG + Intronic
937989336 2:127653701-127653723 GCTGCTGAGGGGTCAAGAGGAGG + Intronic
938066459 2:128284318-128284340 GGTGGGAGGGAGGCAAGAGAAGG - Intronic
939902745 2:147869860-147869882 GTTGCGGGGAAGGCAAGGGAAGG + Intronic
940024311 2:149189163-149189185 GCTGCTGAGTAGGCAAGAGGAGG - Intronic
940226848 2:151409767-151409789 GCAGCTGGGCAGGGAAGGGATGG + Intergenic
940637897 2:156320377-156320399 GCAGCTGGGGAGGAAAGGGAGGG + Intergenic
940771704 2:157845644-157845666 GCTGCTGGGAAGGCCTGAAAGGG + Intronic
942109399 2:172665337-172665359 GCTGCAGGGAAGGCAAAATAGGG - Intergenic
942213182 2:173692221-173692243 GCTGCTGCTGAGGAAAGAGGAGG - Intergenic
942278965 2:174342303-174342325 GCGGCTGGGCAGGCAGGAGCCGG + Intergenic
942792806 2:179779999-179780021 GCTGCTGGGGTTGGAGGAGAGGG + Intronic
942795089 2:179808142-179808164 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
945402952 2:209409248-209409270 GCTGCTTGGGAGGCTAAGGAAGG + Intergenic
945476691 2:210291372-210291394 GCTGCTTGGGAGGCTAAAGCAGG - Intronic
945481098 2:210346678-210346700 GCTGCTCGGGAGGCTAAGGAAGG - Intergenic
946362685 2:219228858-219228880 GGTGCTAGGGAAGTAAGAGAAGG - Intronic
947752244 2:232539271-232539293 GCTGTTGGGTAGGCATGTGAGGG - Intergenic
947868490 2:233418629-233418651 GTTCCTGGGGAGGCAGGAGTGGG + Intronic
948113194 2:235473437-235473459 GCTGCTGGCAAGGCAGAAGATGG + Intergenic
948371871 2:237494679-237494701 TCTGCTGGGGAGGCCACAGATGG + Intronic
948602912 2:239117410-239117432 GCATATGGAGAGGCAAGAGAGGG + Intronic
948635702 2:239334911-239334933 GCTGCTGGGGAGGCTAAGGCAGG + Intronic
948755106 2:240154999-240155021 GCAGCTGGGGATGCCAGGGAGGG + Intergenic
948777007 2:240294420-240294442 GCAGTTGGGGAGGCAGGAGGAGG - Intergenic
949069870 2:242018049-242018071 GGTGCTGGGGACGCAGGGGAGGG + Intergenic
1169012246 20:2260341-2260363 CCTGGTGAGGAGCCAAGAGATGG - Intergenic
1169164747 20:3413314-3413336 GCTACTGGGGAGGCCACAGTGGG + Intergenic
1170857979 20:20075170-20075192 GGTTCTGGTGAGGAAAGAGAGGG - Exonic
1171197486 20:23211531-23211553 GATGATGTGGAGGAAAGAGAGGG - Intergenic
1171388703 20:24787205-24787227 GCTCCTGTGGAGGCATGAGAGGG - Intergenic
1172023752 20:31934303-31934325 GGAGCTGGGGAGGGAAGAGAAGG - Intronic
1172563105 20:35906646-35906668 GCTGCTGGGAAGGGAAGTGAAGG + Intronic
1172622897 20:36331334-36331356 GCAGCTGGGGATGCCGGAGATGG - Intronic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1172775172 20:37403089-37403111 GCTGATGGGGAGGGCAGCGAGGG - Intronic
1172821008 20:37734393-37734415 GCTGGTGAGGAGGGAAGGGAGGG - Intronic
1173486899 20:43447779-43447801 GCTGCTTGGGAGGCTGGAGCAGG - Intergenic
1174145041 20:48447524-48447546 GATGCTGAGGAGGCAGGGGAGGG + Intergenic
1174179683 20:48666977-48666999 GCTGCAAGGGAGGCTGGAGATGG - Intronic
1174454826 20:50641683-50641705 GCTCCTGGGTGGGGAAGAGATGG - Intronic
1174471973 20:50768045-50768067 GCTCCTGGGTGGGGAAGAGATGG + Intergenic
1175090671 20:56500891-56500913 GCTGCTGGGGAGGCTGAAGTGGG - Intronic
1175158978 20:56994090-56994112 GCTGCCAGGGAGGTCAGAGAGGG - Intergenic
1175274813 20:57761103-57761125 GGGGCTGGAGAGGCAAGAAAGGG - Intergenic
1175367833 20:58467658-58467680 GCTGCAGGGGTGGAAGGAGATGG + Exonic
1175717737 20:61266623-61266645 GCTGGTGGGGAGTCTGGAGAGGG + Intronic
1175859565 20:62143140-62143162 GGGGCTGGGGAGCCCAGAGAGGG - Intronic
1175950927 20:62582589-62582611 GCAGCTGGGGAGCCTGGAGAAGG + Intergenic
1176649096 21:9529470-9529492 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1177550521 21:22615039-22615061 GCTGCTGGGGAGGCTAAGGCAGG + Intergenic
1177791565 21:25728028-25728050 GCTGCTGGAGAGGAAGAAGAGGG - Intronic
1178034649 21:28566276-28566298 GATGCTGGCGAGGCTACAGAGGG + Intergenic
1178834916 21:36088728-36088750 GCTGCTTGGGAGGCTGAAGAAGG + Intergenic
1178860237 21:36282862-36282884 GCTACTGGGGAGGCAGAAGCAGG + Intronic
1178890231 21:36514798-36514820 GCTGGAGGCAAGGCAAGAGAAGG - Intronic
1179032307 21:37731299-37731321 GATGCTGGGGATGGAGGAGAAGG + Intronic
1179464654 21:41563458-41563480 ATTGCTGGGGAGGGAAGAGATGG - Intergenic
1179924657 21:44527894-44527916 GCTGCTGGGGAGGTGAGTGGAGG - Intronic
1179949664 21:44702683-44702705 GCAGCTGGGCTGGCAGGAGAAGG - Intronic
1180617673 22:17139133-17139155 GCTGGCAGGGAGGCAAGCGAAGG - Intronic
1180639153 22:17284108-17284130 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1180915973 22:19487412-19487434 GCTACTTGGGAGGCTAGAGTGGG + Intronic
1180927718 22:19567608-19567630 GCTCGTAGGGAGGCAAGAGGTGG + Intergenic
1180971670 22:19819230-19819252 GCTGCTGGGTAAGCAGGAGGTGG - Intronic
1181282634 22:21730789-21730811 GCTGGTGGGGAGTCTACAGAGGG - Intronic
1181548481 22:23620189-23620211 GCTGCTTGGGAGGTGAGGGAGGG - Intronic
1181631588 22:24154619-24154641 GCTGCTGGGGACACAGAAGAAGG - Intronic
1181694370 22:24585564-24585586 GCTGCTGGGGTGGGGAGAAAGGG - Intronic
1181816646 22:25442577-25442599 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1182254276 22:29027076-29027098 GATGCTAAGGAGGTAAGAGAGGG - Intronic
1182493341 22:30688951-30688973 GCTACTGGGGAGGCCAAAGCAGG - Intergenic
1182856246 22:33520114-33520136 GCTGCTTGGGAGGCTGAAGAGGG - Intronic
1183056202 22:35307656-35307678 CCTGCTGGGGAAGGTAGAGAAGG + Intronic
1183284443 22:36953341-36953363 TCTGCTGGGGAAGGAGGAGAAGG + Intergenic
1183495327 22:38140073-38140095 CCAGCTGGGGAAGCAGGAGATGG - Exonic
1184044429 22:41963895-41963917 GCTGCTGGGGGGGCCAGGGAAGG - Intergenic
1184310200 22:43636324-43636346 GCGGCTGGGGAGGGAACGGAGGG + Intronic
1184365493 22:44048481-44048503 GCTACTGGGGAAGCTAGAGCAGG - Intronic
1184417875 22:44362772-44362794 GGTGCTGGGAAGGGAAGTGAGGG - Intergenic
1184479429 22:44738095-44738117 GCTGCAGGGGAGGTCAGAGCAGG - Intronic
1184594540 22:45505881-45505903 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1184927196 22:47651253-47651275 GCAGCTGGGGAAGGAGGAGAAGG + Intergenic
1185075162 22:48679028-48679050 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075229 22:48679220-48679242 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075426 22:48679734-48679756 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185199381 22:49492210-49492232 GCAGCTGGGGAGGTAGGAGGAGG - Intronic
949603313 3:5625702-5625724 GCTACAGGGGAGGGAAGGGAGGG - Intergenic
950085257 3:10252966-10252988 GCTGCTGGGGAGGCTGAGGAAGG - Intronic
950764184 3:15261105-15261127 TCTGCAGGGGAGGCAGGAGGTGG - Intronic
950858486 3:16127137-16127159 TCTGCTGGGGTGGCCAGGGAGGG - Intergenic
950876579 3:16280210-16280232 TCTGATGGGGAGGGTAGAGAGGG + Intronic
951195052 3:19814364-19814386 GCTACTGGGGAGGCTAAGGAGGG + Intergenic
951565748 3:24011168-24011190 GCTGCTGGGGAGGCTAAGGTGGG - Intergenic
952428743 3:33201699-33201721 GCTGTTGGGTAGGCCTGAGATGG - Intronic
953314980 3:41918711-41918733 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
953768105 3:45759553-45759575 GCTGCTCAGGAGGCAGGAGCTGG + Intronic
953932414 3:47012325-47012347 GATCCTGAGGAGGCAGGAGAGGG + Intergenic
954288648 3:49637238-49637260 GCTGCTGGGGGGGTGAGAGGAGG + Intronic
954340005 3:49945768-49945790 GCTGCTGGGGAGGCTGGGGCAGG + Intronic
954365752 3:50145218-50145240 CCTGCTGGGGGGGCCAAAGATGG - Intergenic
954636273 3:52072495-52072517 GGCGCTGGGGAGGCAAACGATGG + Intergenic
954637943 3:52081635-52081657 GCCTCAGGGGAGGCAGGAGATGG + Intronic
954726511 3:52616021-52616043 TCTGCTGAGGAGGTAAGAGGAGG - Intronic
955059188 3:55481919-55481941 GCTGCCAGGGAGGGAGGAGATGG + Intronic
955384391 3:58467535-58467557 TATGCTGGGGAGGAAAGACAAGG + Intergenic
955409663 3:58647397-58647419 GATGCTGGGGAGGGAAGCCAGGG + Intronic
957368549 3:79259254-79259276 GCTGCTGGGGAGGCTGAAGTGGG - Intronic
958004407 3:87793221-87793243 GCCGCTGGGGTGGAGAGAGACGG + Intergenic
959049604 3:101512620-101512642 GCTGCTGGGGAGGAAAGGTGGGG - Intronic
959692203 3:109209739-109209761 GCTGCTTGGGAGGCCAAGGAAGG + Intergenic
959978649 3:112489753-112489775 CATGCTGGGGAGGCTACAGAAGG + Intronic
960055850 3:113275929-113275951 GCCTCTGGGGAGGCAGCAGAGGG - Intronic
960854700 3:122091282-122091304 GCTGCTAAGAAGGCAGGAGAGGG + Intronic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
961445986 3:126982093-126982115 GCTCCTGGGGAGGGAGGAGCGGG + Intergenic
961700965 3:128744139-128744161 GCTACTTGGGAGGCTAGAGTGGG + Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
962600000 3:136984448-136984470 GCTGCAGGAAAGGCAAGATAAGG + Intronic
962853067 3:139322395-139322417 GGTGCCGAGCAGGCAAGAGATGG - Intronic
963312153 3:143721104-143721126 GCTGCTTGGGAGGCAGAAGTGGG + Intronic
963821770 3:149904490-149904512 GCTGCTGGGGAGGCTAAGGTAGG - Intronic
963934930 3:151042751-151042773 GGTGGTGGGCAGGCAAGAGAAGG - Intergenic
963967783 3:151392352-151392374 GCTGCTTGGGAGGCCAAAGCAGG + Intronic
964498286 3:157318798-157318820 GCTACTTGGGAGGCAGGAGTGGG + Intronic
964687444 3:159412856-159412878 GCAGGTCTGGAGGCAAGAGATGG + Intronic
965075242 3:163966969-163966991 GCTACTGGGGAGGCAAAAGAGGG + Intergenic
965194904 3:165581433-165581455 GCTACCGGGGAGGCAAAAGTGGG - Intergenic
965709402 3:171542086-171542108 GCTACTGGGGAGGCTAAAGTGGG - Intergenic
966681141 3:182643368-182643390 GATGGTGGGGAGACAGGAGAGGG - Intergenic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
967579483 3:191135783-191135805 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
967859978 3:194143078-194143100 GCTGCTGGGGAGGCTAAGGCAGG + Intergenic
967932004 3:194696710-194696732 ACTGCTGCAGACGCAAGAGAGGG - Intergenic
968032379 3:195511411-195511433 GCTCCTGGGGAGGCTTGAGGTGG + Intergenic
968234704 3:197024730-197024752 GCTGCTGGGGAAGGAAGAGGGGG - Intronic
968262931 3:197339768-197339790 GCTGCTGCCCAGGCAGGAGACGG - Intergenic
968549603 4:1215271-1215293 GCTGCTGGGGCAGCTAGAGTGGG + Intronic
968761277 4:2443778-2443800 CCTGCTGGGGAGGCAGGAGAAGG - Intronic
968916615 4:3499582-3499604 GGTGCTGGGGAGGGCAGAGCAGG - Intronic
969283789 4:6189920-6189942 GCTGCAGGCGTGGCAGGAGAGGG + Intronic
971163943 4:24162701-24162723 GCTACTTGGGAGGCAGAAGAAGG - Intergenic
971290722 4:25336596-25336618 GCTGCTGGGGAGGCTGTGGAAGG - Intronic
971622418 4:28872595-28872617 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
971705105 4:30031685-30031707 GCTGCTCGGGAGGCTGAAGAAGG - Intergenic
971959123 4:33462312-33462334 GCTACTTGGGAGGCTAAAGAGGG - Intergenic
972030454 4:34450746-34450768 ACTTCTGGGGAGGGAAGTGAGGG + Intergenic
973875511 4:55214442-55214464 GCTGATGGGGAGGGCACAGACGG + Intergenic
974977997 4:68916160-68916182 GCTGCTGGGTAGGAAACAGTAGG - Intergenic
975230666 4:71928818-71928840 GCTACTGGGGAGGCTAAAGTGGG - Intergenic
976604330 4:86968685-86968707 ACTGCTGGGGACGGAAGAGGGGG + Intronic
977922280 4:102658718-102658740 GCAGCTGAGGGTGCAAGAGATGG + Intronic
978976688 4:114884282-114884304 GCTGCTGGGGAGGCAGGAAGAGG + Intronic
979108114 4:116713916-116713938 GCTGGTGCTGAAGCAAGAGACGG + Intergenic
980936519 4:139231321-139231343 GCTGCTGGGGAGGCTAAGGTGGG - Intergenic
981313402 4:143318135-143318157 GCTGCTGGGGAGGCTGAAGAAGG + Intergenic
981399513 4:144297049-144297071 GCTACTGGGGAGGCTAGATCAGG - Intergenic
981741491 4:148006871-148006893 GCTGATGGGGAGGAAGGAAAGGG - Intronic
982065014 4:151646687-151646709 GACGCTGGGGAACCAAGAGAGGG + Exonic
982232599 4:153222850-153222872 GCTGCGGGGGAGGAAGGAGGAGG + Intronic
982841765 4:160196585-160196607 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
982956450 4:161774148-161774170 GCTACTTGGGAGGCAAGACTAGG + Intronic
983524121 4:168743061-168743083 ACTGCTGGGGAGGACACAGAAGG - Intronic
984850171 4:184145723-184145745 GGGGCTGGGGAGGCAGGAGATGG - Intronic
984961488 4:185102052-185102074 GCTGCTGCGGAGCCAGGAAATGG - Intergenic
985443384 4:190002022-190002044 GCTACTCGGGAGGCTAAAGAAGG - Intergenic
985471253 5:48267-48289 GCTGCTGGGGAGCAGAGTGAAGG + Intergenic
985505647 5:278795-278817 GGTGCTGGGGATGCAGGGGAGGG + Intronic
985748549 5:1661491-1661513 GCTGCTGGGGAGGGACCACAGGG + Intergenic
985784285 5:1886062-1886084 GCCGCAGGGGAGGCAGGGGATGG + Intronic
987143434 5:14967869-14967891 GCTGAGGGTGAGGCTAGAGATGG - Intergenic
987282616 5:16426213-16426235 GCAGCTGTGGTGGCAGGAGAGGG + Intergenic
988450738 5:31340614-31340636 GCTACTTGGGAGGCTAGAGCCGG - Intergenic
988538616 5:32089890-32089912 TCTGCCTGGGAGGCATGAGATGG - Exonic
988540040 5:32100367-32100389 GCTGGTAGGCAGGCAAGGGAGGG + Intronic
988911957 5:35852206-35852228 TCCGCTGGGAAGGCCAGAGAGGG + Intergenic
988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG + Intergenic
989053592 5:37345069-37345091 GCTGCTTGGGAGGCTAAAGTTGG + Intronic
989151374 5:38303019-38303041 GCTGCTTGTGAGGAAAGATAGGG + Intronic
989231828 5:39095742-39095764 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
989280637 5:39638976-39638998 GCAGCTGGGAAGGCAATAAATGG + Intergenic
989572453 5:42957224-42957246 GCTGCTGGGGAGGCTAAGGCAGG + Intergenic
990310144 5:54530032-54530054 GAAGCTGGAGAGGCAAGGGAGGG - Intronic
990701951 5:58483426-58483448 GCAGTTGTGCAGGCAAGAGATGG + Intergenic
991439140 5:66628142-66628164 GCTGCTCGGGAGGCTAGAGTGGG - Intronic
991732391 5:69602387-69602409 GCTGCTGGGGAGGCTGAGGAAGG + Intergenic
991808823 5:70457530-70457552 GCTGCTGGGGAGGCTGAGGAAGG + Intergenic
991862561 5:71025466-71025488 GCTGCTGGGGAGGCTGAGGAAGG - Intergenic
992441890 5:76804278-76804300 GTGTCTGGGGAGGCCAGAGAGGG + Intergenic
992790648 5:80210415-80210437 GCTGGTGCGGAGGACAGAGAGGG - Intronic
993011357 5:82486864-82486886 GCAGCAGGGATGGCAAGAGAGGG + Intergenic
994080595 5:95705054-95705076 GCTGCTTGGGAAGCAAAAGTGGG - Intergenic
994625704 5:102215748-102215770 GCTGCTGGGGAGGCTGAAGCAGG + Intergenic
995876138 5:116792264-116792286 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
995909439 5:117168060-117168082 GCTTCTGGGGAGGCCTCAGAAGG - Intergenic
996156820 5:120112774-120112796 GCTGCTGGGGAGGCTGAGGAAGG - Intergenic
996416280 5:123214171-123214193 GTTGCTGTGGAGGTCAGAGAGGG - Intergenic
997269978 5:132528251-132528273 GAGGCTAGGGAGGGAAGAGAGGG - Intergenic
997439632 5:133900009-133900031 TCTCCTGCGGATGCAAGAGACGG + Intergenic
998670498 5:144347893-144347915 GCTGCTGTGCAGAGAAGAGACGG - Intronic
998801700 5:145875435-145875457 GCTACTCGGGAGGCTAGAGCAGG + Intergenic
998804774 5:145907415-145907437 GCTGCTTGGGAGGCCAAAGCAGG + Intergenic
999200034 5:149809824-149809846 GGTGCTAGGTAGGCCAGAGACGG + Intronic
999244199 5:150144695-150144717 GCTGCTGGGGGCCCAAGGGAGGG + Intronic
999264177 5:150255728-150255750 GCTGCTGAGGAAGCAGGAGCTGG + Intronic
999270647 5:150294703-150294725 GCTTGTGGGGAGGGAAGGGAGGG - Intergenic
999443359 5:151620058-151620080 GCTGCTGGGGAGGCATGGAAGGG - Intergenic
999690316 5:154140768-154140790 GCTGCAGGAGGGGCCAGAGAAGG - Intronic
999699043 5:154211240-154211262 GGGGCTGGGGAGGGAAGAGCAGG + Intronic
999883907 5:155898787-155898809 GCAGTTGGAGTGGCAAGAGAAGG + Intronic
1000183376 5:158834889-158834911 CCTGCTTAGTAGGCAAGAGAGGG + Intronic
1000205141 5:159051334-159051356 GGGGCTGGGGAGGGGAGAGAGGG - Intronic
1000330870 5:160204437-160204459 GGAGCTGGGGAGGAAAGACATGG - Intronic
1001476952 5:172057348-172057370 GCTGCTGCGCAAGCATGAGAAGG - Exonic
1001565502 5:172696926-172696948 GCAGATGGGGAAGCCAGAGAGGG - Intergenic
1001782719 5:174384266-174384288 GCTTCAGAGAAGGCAAGAGAAGG + Intergenic
1001865007 5:175096248-175096270 GCTGCGGTGGTGGCAGGAGAGGG + Intergenic
1002048480 5:176555501-176555523 GCTGGAGGGGAGGCAAGAGCAGG - Intronic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002401277 5:178992741-178992763 GCTGGTGTGAAGGCCAGAGAGGG + Intronic
1002508161 5:179695159-179695181 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1002603807 5:180370332-180370354 GCTGCTGGGGAGGGGAGGGAGGG + Intergenic
1002655497 5:180743458-180743480 TCTGAAGGGGAGGAAAGAGATGG - Intergenic
1003468802 6:6409352-6409374 AGTGCTGGGGAGGCATGAAAGGG - Intergenic
1003520907 6:6857446-6857468 GCTGCAGGTGTGGAAAGAGATGG - Intergenic
1003603132 6:7536642-7536664 GCTACTGGGGAGACTAGAGTGGG - Intergenic
1003628805 6:7768061-7768083 CTTCCTGGGGAGGCAAGAGCGGG + Intronic
1003867341 6:10375504-10375526 GCTGTAGGGGAAGCATGAGAAGG - Intergenic
1003999597 6:11584945-11584967 GCTACTGGGGAGGCTGAAGAGGG - Intergenic
1004058262 6:12163453-12163475 GCTGCTGGGAATGCAAAGGAAGG - Exonic
1004145670 6:13063666-13063688 GCTGCTGGGGAGGCTAAGGTGGG + Intronic
1004344622 6:14837200-14837222 AATGCTGAGAAGGCAAGAGAGGG + Intergenic
1004620781 6:17328555-17328577 GCTGGGGTGGAGGCAAGATATGG - Intergenic
1004885770 6:20050324-20050346 TCTGCTTTTGAGGCAAGAGAAGG + Intergenic
1004897599 6:20163760-20163782 GCTGCTGGGGAATCATCAGAAGG - Intronic
1005038995 6:21585006-21585028 GCTACTGGGGAGGCTAAAGCAGG + Intergenic
1006028580 6:31162798-31162820 CCTCCTGGGGAGGGAAGGGAAGG - Exonic
1006110673 6:31743086-31743108 GCTGTGGGGGAGGAAAGAAAAGG - Exonic
1006181103 6:32153980-32154002 GGTGCTGGGGAGGAAACAGGCGG - Intronic
1006196157 6:32243794-32243816 GCTGATGGTGAGGCGGGAGAAGG + Intergenic
1006435178 6:34022399-34022421 GCAGCCGGGGACGCCAGAGAGGG + Exonic
1006680455 6:35793469-35793491 GCAGCTGGGAAGGCGGGAGAAGG - Intronic
1007105875 6:39282527-39282549 GCTCCTGGGGAGAGAACAGACGG + Intergenic
1007385601 6:41518295-41518317 GCAGGTGGGGAGGCAGCAGAAGG - Intergenic
1007690556 6:43698406-43698428 GCTGCAGGGCAGGCAGGACAGGG + Intergenic
1007866952 6:44981927-44981949 GCTACTGGGGAGGCTAAAGTGGG + Intronic
1008876056 6:56329356-56329378 GCTGTGGGGGAGGAAAGAGATGG + Intronic
1009263729 6:61528079-61528101 GGTGTTGGGGAGGCCAGATATGG - Intergenic
1010210830 6:73362029-73362051 ACTACTGGGGAGGCTAAAGAGGG + Intergenic
1010723992 6:79312703-79312725 GCTGTTGGGGCCCCAAGAGAAGG - Intergenic
1011223615 6:85083870-85083892 GCTACTCGGGAGGCTAAAGAAGG + Intergenic
1011434538 6:87322709-87322731 GCAGCTGGGAAGGGCAGAGACGG - Intronic
1012485218 6:99713687-99713709 GCTACTTGGGAGGCCAAAGAGGG - Intergenic
1013230824 6:108160640-108160662 GCTGCTGTGAAGGGAAGACAGGG + Intronic
1013792198 6:113850170-113850192 GCTACTGGGGAGGCTGGGGAGGG + Intergenic
1014799972 6:125767994-125768016 GCTGCTAGGGAGGCTAAGGAGGG - Intergenic
1014930703 6:127332572-127332594 GGTGGTGGGGAGGCAGGAGGTGG + Intronic
1015399139 6:132768680-132768702 GCTGATGTGGAGGGAGGAGAGGG - Intergenic
1015728370 6:136322921-136322943 GCTACTTGGGAGGCCAGAGCGGG + Intergenic
1015958458 6:138622390-138622412 GCTGCTGGGGAGGCTGAGGAAGG + Intronic
1016441768 6:144091861-144091883 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
1016886800 6:148966846-148966868 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1017063602 6:150508434-150508456 GCTGCTTGGGAGGCTGAAGAAGG - Intergenic
1018058201 6:160070372-160070394 GCAGCTTGGGAAGCACGAGAAGG + Intronic
1018407275 6:163500344-163500366 GCAGTTGTTGAGGCAAGAGATGG + Intronic
1018732433 6:166662354-166662376 GATGCAGGGGTGGTAAGAGATGG + Intronic
1019294670 7:267389-267411 GGTCCTGGGGAGGCAGGAGCAGG - Intergenic
1019511037 7:1417381-1417403 GGTTCTGGGGAGGCGGGAGAAGG - Intergenic
1019600780 7:1882681-1882703 GCTGCTGGGTGGGCATGACATGG + Intronic
1019785154 7:2972107-2972129 GCTCCTGGGGAGGCTTGAGGTGG - Intronic
1019913428 7:4115645-4115667 GAAGCTGGGGAGTCAAGAGATGG + Intronic
1019969512 7:4528865-4528887 GCTGCTCGGGAGGCAAAGGCAGG + Intergenic
1020096058 7:5370209-5370231 GCTACTGGGGAGGCTGGGGAGGG + Intronic
1020253498 7:6487439-6487461 CATCCTGGGGAGGCAAGAGGTGG + Intergenic
1020262941 7:6540946-6540968 GCTACTCGGGAGGCTAAAGAGGG - Intronic
1021005232 7:15386797-15386819 TCTTCTGGGGAAGAAAGAGAAGG - Intronic
1021131659 7:16919774-16919796 GCTGCTGGGAATGCAAAATAGGG - Intergenic
1021338873 7:19438907-19438929 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
1021615291 7:22497805-22497827 GCTTCTGGGGAGGCCTCAGAGGG + Intronic
1021853568 7:24832093-24832115 GCTGCTTGGGAGGCAGAAGTGGG + Intronic
1022467027 7:30658885-30658907 GCTGCTGGGGAGTGTAGGGATGG + Intronic
1022976515 7:35562643-35562665 GATGTTGGGGAGGAAAGAAAGGG - Intergenic
1023733982 7:43218938-43218960 AGTGCCGGGGAGCCAAGAGAGGG + Intronic
1023908943 7:44540575-44540597 CATGCTGGAGAGGCCAGAGATGG + Intronic
1024075609 7:45816453-45816475 GCTGCTGGGGCAGCATGAGCAGG - Intergenic
1024426478 7:49232026-49232048 GCTGCTAGGATTGCAAGAGAGGG + Intergenic
1024922525 7:54574625-54574647 GCTACTAGGGAGGAAAGAGAAGG + Intergenic
1025051844 7:55739343-55739365 GCTGCTGGGGAAGCATGAGCAGG + Intergenic
1025210482 7:57017383-57017405 GCAGTTTGGGAGGCCAGAGATGG - Intergenic
1025270530 7:57508713-57508735 GCTTCTGGGGAGGGAAGCGAGGG - Intergenic
1025661474 7:63559464-63559486 GCAGTTTGGGAGGCCAGAGATGG + Intergenic
1025857778 7:65298198-65298220 GCTACTGGGGAGGCTAAAGTAGG - Intergenic
1026052491 7:66959071-66959093 CCTGCTGGGGAGGGAAGGGAAGG - Intergenic
1026170659 7:67951179-67951201 GCTGCAGGGGCGACTAGAGAAGG + Intergenic
1026217005 7:68358474-68358496 GCTGCTGGGGTGGCAGATGAGGG + Intergenic
1027422987 7:78035207-78035229 GCTGCTGTGCAGGTGAGAGATGG + Intronic
1028443363 7:90890259-90890281 GCTACTTGGGAGGCTAAAGAGGG + Intronic
1028460726 7:91089220-91089242 GAGGCTGGGGAAGAAAGAGAAGG - Intronic
1029228200 7:99044059-99044081 GCTACTGGGGAGGGAAGCCAAGG + Intronic
1029388656 7:100259999-100260021 GCTGCTGTGCAGGGCAGAGAAGG + Intronic
1030121249 7:106112417-106112439 GCGGCTGGGGAGGCGAGGGGCGG + Intronic
1030532745 7:110730634-110730656 GCTGCTGGGGAGGCTGAAGCAGG - Intronic
1031315587 7:120254440-120254462 GCGGCAGGGGAGAGAAGAGAGGG - Intergenic
1031711530 7:125052959-125052981 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
1031829652 7:126610873-126610895 ACTGCTGAGGCTGCAAGAGATGG + Intronic
1031993386 7:128212107-128212129 GATGCTGGGGAAGAAAGGGAAGG - Intergenic
1032381264 7:131484343-131484365 ACAGCTAGGGAGGGAAGAGATGG - Intronic
1033209209 7:139448104-139448126 GCTGCTTGGGAGGCTGAAGATGG - Intergenic
1034089937 7:148354532-148354554 GGTCCTGGGGAGACAGGAGATGG - Intronic
1034276626 7:149826622-149826644 GCAGGTGGGGAGGGAAGAGGCGG + Intergenic
1034434590 7:151057314-151057336 GCAGGTGGGGAGGGAGGAGAAGG + Intronic
1034521680 7:151625397-151625419 GAGGCTGGGGAGGGAGGAGAAGG + Intronic
1034966108 7:155392142-155392164 GCTGGTGAGGTGGCAGGAGAAGG - Intronic
1035236839 7:157502788-157502810 CCTGCTGCAGAGGGAAGAGAGGG - Intergenic
1035249616 7:157588390-157588412 ACTGCCGGGGAGGCAGGGGAGGG - Intronic
1035524532 8:301882-301904 GCTGCTGTGGAGACAAAAGCTGG - Intergenic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035778510 8:2209004-2209026 CCGGCTGGGGAGGCTGGAGAAGG + Intergenic
1036500686 8:9311261-9311283 GCTCCTGGGTTGGAAAGAGAGGG - Intergenic
1037442325 8:18928927-18928949 GCTGCTTGGGAGGCTGGAGGTGG - Intronic
1037751812 8:21687130-21687152 GCTGCTGGAGACGGAGGAGAAGG + Intergenic
1037765684 8:21770899-21770921 TCACCTGGGGAGGCAGGAGAGGG - Intronic
1037807027 8:22063759-22063781 CCTGCTGGGGTGTCAAGAGAGGG - Intronic
1037841483 8:22248330-22248352 GCTTCTGGGGAGCCAGGTGAGGG + Intronic
1037882766 8:22580922-22580944 GCAACTGGGGAGGCAAGAGCCGG - Intronic
1037889837 8:22618200-22618222 GCTGCTGGGGAGGCTAAGGCAGG - Intronic
1037944405 8:22977909-22977931 GCTACTGGGGAGGCTGGAGTGGG + Intronic
1038452623 8:27649647-27649669 GCTGCTGGAGAGGCCTGGGATGG + Intronic
1039469389 8:37803868-37803890 CCAGCTGGGAAGGGAAGAGAAGG + Intronic
1041319991 8:56603098-56603120 GCCTCTGGGGAGGTAAGAGTGGG - Intergenic
1042248876 8:66736567-66736589 GCTACTGGGGAGGCTAACGAAGG - Intronic
1042290039 8:67160936-67160958 GCTACTGGGGAGGCTAGGGCAGG - Intronic
1042991198 8:74641960-74641982 GCTGCTGGTGAGGCAGTACAGGG + Intronic
1043390525 8:79787246-79787268 GTTGCTGGGGAGGTAAGTTAGGG + Intergenic
1043413923 8:80029722-80029744 GCTGCTGGGGAGGCGATCTAGGG - Intronic
1044229926 8:89762074-89762096 GCTGCTGGGGAGGCTAAGGTGGG + Intronic
1044345797 8:91102979-91103001 GTTGCTGGAGAGGCATCAGAAGG + Intronic
1044412736 8:91902139-91902161 GCTGCCGGGAAGGCACGGGAAGG - Intergenic
1044989146 8:97779937-97779959 GCTGCTGGGGAGGCAGAGGCAGG + Intronic
1045136233 8:99221818-99221840 GCTGCTGGGGAGGCTGGGGCAGG - Intronic
1045158429 8:99506743-99506765 GCTGCTGGGGAGGCTAAGGTGGG + Intronic
1045564471 8:103299108-103299130 GGTGCTGGGGAGGCAACGGCGGG + Intronic
1045971329 8:108082718-108082740 GCTGCTGGGGAGGACTCAGAGGG + Exonic
1046550366 8:115708347-115708369 GCTGCTGGTGGGGAAAGAGATGG - Intronic
1047132768 8:122039544-122039566 GCTGCTGGGGAGGCTGAAGCAGG - Intergenic
1047361767 8:124175649-124175671 GCTGATGGGGAAGGAAGAGGAGG - Intergenic
1048806846 8:138249068-138249090 GCTGAAGATGAGGCAAGAGAAGG - Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049426140 8:142538689-142538711 TCAGCTGGGGAGGCAGGAGTGGG - Intronic
1049690885 8:143958361-143958383 GCTGCAGGGGAGAGAGGAGAAGG - Intronic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1050264505 9:3875755-3875777 CCAGCTGGGAAGGCAAGGGATGG + Intronic
1051084712 9:13334887-13334909 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
1051585891 9:18726397-18726419 GCTACTTGGGAGGCTAGAGTGGG + Intronic
1051659050 9:19409010-19409032 GCTGCTGCGGAGGCAAAACGCGG - Intergenic
1051756457 9:20406140-20406162 GCTGCTGGGGGTACAGGAGAAGG - Intronic
1051768378 9:20548924-20548946 GCTACTTGGGAGGCAAAAGTGGG - Intronic
1054823003 9:69542910-69542932 ACTACTGGGGAGAGAAGAGAGGG + Intronic
1055436545 9:76297441-76297463 GCTTCTGAGGAGGGAGGAGAGGG + Intronic
1055736899 9:79340070-79340092 GCTGCTGGGGAGGCTAAGGCAGG + Intergenic
1056182921 9:84102861-84102883 GCTGTTGGTTAAGCAAGAGATGG - Intergenic
1056216165 9:84408102-84408124 GCTACTGGGGAGGCTGAAGAAGG + Intergenic
1056591536 9:87969211-87969233 GCTGGTGAGGAGGGTAGAGAAGG + Exonic
1056617808 9:88183607-88183629 GGGGCTGGGGAGCCAATAGAGGG + Intergenic
1056914782 9:90736647-90736669 GCTGCTGGGGAGGGTGCAGAAGG + Intergenic
1057070022 9:92089299-92089321 GCTACTGGGGAGGCTAAAGCAGG + Intronic
1057211729 9:93204285-93204307 TCTGCTGGGGAGGCAGACGAGGG + Intronic
1057747277 9:97762268-97762290 GCTGCTGGGTGGGTATGAGAGGG + Intergenic
1058504124 9:105651904-105651926 GCTCCTGGGGAGGAAACAGAGGG - Intergenic
1058762425 9:108147888-108147910 GCTCCTGGGGAGGCATGGTATGG + Intergenic
1058935090 9:109762863-109762885 GGTGGAGGGGAGGAAAGAGATGG + Intronic
1058964490 9:110023878-110023900 GCTACTTGGGAGGCAAGAGATGG + Intronic
1060047471 9:120352040-120352062 CCTGCAGGGGAGGGAAGTGAAGG - Intergenic
1060195448 9:121620671-121620693 GTGTCTGGGAAGGCAAGAGAGGG - Intronic
1060504385 9:124187319-124187341 GCTGCTCTGGAGGCAAGAGGAGG - Intergenic
1060537301 9:124400422-124400444 GCTGCTGGGCAGCCCAGAAAAGG - Intronic
1060833474 9:126735497-126735519 GCTGCTTGGGAGGCCAAAGCAGG + Intergenic
1060977186 9:127771542-127771564 GCTGCTGGGGAAGCGAGCGTTGG - Intronic
1061263779 9:129494204-129494226 GCAGCTGGGGTGGCCAGAGCTGG - Intergenic
1061306364 9:129735476-129735498 GGTGCGGGGGAGAGAAGAGAGGG - Intergenic
1061555299 9:131364475-131364497 GCTGCTGGGGAGGCTAAGGCAGG - Intergenic
1061895172 9:133643352-133643374 GCTGCTGGGGAGGGGAGGGTGGG + Intronic
1062562097 9:137146251-137146273 GCTGCTGGGGACTCAGGACAGGG - Intronic
1203626832 Un_KI270750v1:33018-33040 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1185478806 X:430972-430994 GAGGCTGGGGACGCAGGAGAGGG + Intergenic
1185603555 X:1354852-1354874 GAGGCGGGGGAGGGAAGAGAAGG + Intronic
1185638040 X:1569324-1569346 GCTGCTGGGGAGGCTGAGGAAGG + Intergenic
1186746411 X:12574607-12574629 GCTGCTGGGGAGGCTGAAGTGGG - Intronic
1186836260 X:13441481-13441503 GCTGCTGGGGAGTCAACACTTGG + Intergenic
1187013961 X:15307984-15308006 GCTGCTGGGTGGGCTGGAGAAGG - Intronic
1187087178 X:16052498-16052520 GCTGCTTGGGAGGCTGGAGCAGG + Intergenic
1187173393 X:16871731-16871753 GCTGAGGGGGTGGCTAGAGAGGG + Intergenic
1187709000 X:22035301-22035323 GATTGTGGGGAGGAAAGAGAGGG - Intronic
1188898196 X:35695627-35695649 GCTACTGGGGAGGCAGGGGCAGG + Intergenic
1189193888 X:39135525-39135547 TCTGCTGGGGAAGATAGAGATGG - Intergenic
1189214184 X:39309203-39309225 GCTGCTGGTGACAGAAGAGATGG + Intergenic
1189703247 X:43733475-43733497 GGGGCTGGGGAGTCCAGAGAAGG + Intronic
1189789072 X:44586169-44586191 GCTGCTGGGGAGGCCACAAGTGG + Intergenic
1189911026 X:45810665-45810687 GCAGGTGGGGAGGGAAGAGATGG - Intergenic
1193130686 X:77916241-77916263 GCTACTGGGGAGGCTAAAGTGGG + Intronic
1195212156 X:102660447-102660469 GCTTCAGGGGAGCCCAGAGAGGG + Intergenic
1195711051 X:107774335-107774357 CCTGCTGGGGAGGCAAGGAGAGG - Intronic
1195974186 X:110508165-110508187 GATGCTGGGGAGGTTAGAGAAGG + Intergenic
1196376206 X:115035420-115035442 GCTGTTGATTAGGCAAGAGATGG - Intergenic
1196393995 X:115239821-115239843 GCTGCTTGGGAGGCTAAAGTGGG - Intergenic
1198215339 X:134549827-134549849 GCTGCGGGGGAGGGCCGAGAAGG + Intergenic
1199328313 X:146528065-146528087 GCTGCTGGGGAGGCTGAGGAAGG + Intergenic
1199743400 X:150756760-150756782 GCTACTTGGGAGGCCAGAGCAGG - Intronic
1200161289 X:154011194-154011216 GCTGCTGGGGAGGCTGAAGTAGG - Exonic
1200181209 X:154151727-154151749 AGTGGTGGGGAGGCAAGAGCAGG - Intronic
1200186854 X:154188841-154188863 AGTGGTGGGGAGGCAAGAGCAGG - Intergenic
1200192505 X:154225979-154226001 AGTGGTGGGGAGGCAAGAGCAGG - Intronic
1200198260 X:154263783-154263805 AGTGGTGGGGAGGCAAGAGCAGG - Intronic
1200842462 Y:7796590-7796612 GCTACTCAGGAGGCTAGAGAGGG - Intergenic
1201948570 Y:19538643-19538665 GCTTCTGGGGAGCCAAGATCAGG + Intergenic
1202370544 Y:24192793-24192815 TCTGCTGGGCAGGCCAAAGATGG + Intergenic
1202381403 Y:24278577-24278599 GCTGCTGGGGCAGCAAGGGCAGG - Intergenic
1202489382 Y:25391549-25391571 GCTGCTGGGGCAGCAAGGGCAGG + Intergenic
1202500240 Y:25477324-25477346 TCTGCTGGGCAGGCCAAAGATGG - Intergenic