ID: 962278701

View in Genome Browser
Species Human (GRCh38)
Location 3:134034347-134034369
Sequence TGTGGGCTCTTCAAGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962278698_962278701 -10 Left 962278698 3:134034334-134034356 CCTTCAACTCAGCTGTGGGCTCT 0: 1
1: 1
2: 4
3: 18
4: 207
Right 962278701 3:134034347-134034369 TGTGGGCTCTTCAAGGGCAAAGG 0: 1
1: 0
2: 6
3: 38
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962278701 Original CRISPR TGTGGGCTCTTCAAGGGCAA AGG Intronic
900145148 1:1155987-1156009 TGTGGGGTCCTGAAGGCCAAAGG - Intergenic
902758943 1:18568283-18568305 TGGGGGCTCAGCCAGGGCAATGG - Intergenic
903258822 1:22120340-22120362 CGTGGGCTCCTCCAGGGCACTGG - Exonic
904362627 1:29986855-29986877 TGTGAGCTCCACAAGGGCAGGGG - Intergenic
905036693 1:34923333-34923355 TGTGGGCCCTACAAGGGAGAGGG + Intronic
905423259 1:37862896-37862918 AGTGGGCTTTCCAAGGGGAATGG + Intronic
906076509 1:43055937-43055959 TGTGAGCTCCCCAAGAGCAAGGG - Intergenic
906300734 1:44679903-44679925 TGTGAGTTCCTCAAGGGCAGGGG - Intronic
907045218 1:51296493-51296515 AGTGGGCCCCTGAAGGGCAATGG + Intronic
907398790 1:54211302-54211324 TGTGAGCTCCTCAAAGGCAGTGG + Intronic
907619346 1:55960417-55960439 TTTGTGTTCTTCAAGGGGAATGG + Intergenic
907855273 1:58297378-58297400 CATGGGCTCTTCGAGGGCAGGGG - Intronic
908247326 1:62238201-62238223 TCTGCCCTCTTCAAGGGCGAGGG + Exonic
909139578 1:71846542-71846564 TCTGGGTTCTTCAAGGGTATGGG - Intronic
909388041 1:75082844-75082866 GGTGAGCTCTTCAAAGGCAAAGG + Intergenic
909468164 1:75997989-75998011 TGTGAGCTACTCAAGGACAAGGG + Intergenic
910798833 1:91124946-91124968 TGTGGGCTTTTTCAGAGCAATGG - Intergenic
910848066 1:91622995-91623017 TGTGGTCAATTGAAGGGCAAAGG + Intergenic
911563699 1:99436695-99436717 TGTGAGTTCCTCTAGGGCAAGGG + Intergenic
911692271 1:100847892-100847914 TGTAGGCTATTGAAAGGCAAGGG - Intergenic
915203969 1:154255397-154255419 TGTGGTCTCTGCCAGGTCAAGGG - Intronic
915280285 1:154817868-154817890 TGGTGGGTCATCAAGGGCAAAGG + Intronic
915294478 1:154910449-154910471 TGTGAGCTCCCCAAAGGCAAGGG + Intergenic
916158559 1:161884682-161884704 TGTGGGCTCTGGAAAAGCAAGGG - Intronic
916256411 1:162792228-162792250 TCTAGGCTCCTCAGGGGCAAGGG - Intronic
918235248 1:182574258-182574280 TGTAGGCTCCTCACGGGCGATGG - Exonic
918662918 1:187112262-187112284 TGTGGGCACATCAAGGGCTGTGG - Intergenic
920186992 1:204165914-204165936 TGTGAGCTCCTCAAGTGCAAGGG + Intronic
920209675 1:204319185-204319207 TGTGGGCGCCTCACGGGGAAAGG - Intronic
920335535 1:205242746-205242768 TGTGGGAGCTTCAAGGGAGAGGG + Intronic
922471776 1:225881654-225881676 GGTGTCCTCTTCAAGGGCAGGGG - Intronic
922861989 1:228826862-228826884 TCTGGGCTCTGCATAGGCAAAGG - Intergenic
923079251 1:230638074-230638096 TCTGAGCTCTTCAGGGTCAAAGG + Intergenic
923695068 1:236240743-236240765 TGTGAGCTATTTGAGGGCAAGGG - Intronic
924386976 1:243508258-243508280 TCTGGGTTCTTCTAGGGCAACGG - Intronic
1065112033 10:22449641-22449663 TGTAAGCTCTTTGAGGGCAAAGG + Intronic
1065921817 10:30399602-30399624 TGTTGGCTATTCAAGGCCCAAGG - Intergenic
1066290630 10:34011466-34011488 TGTGGACTCATAAAAGGCAAAGG + Intergenic
1066722874 10:38357881-38357903 TCTAGGCTCCTCAGGGGCAAGGG - Intergenic
1066800289 10:39180876-39180898 TGGGAGCTCTTTAAGGCCAATGG + Intergenic
1066803052 10:39210927-39210949 TGTGAGCTCTTTGAGGACAATGG - Intergenic
1067474644 10:46557355-46557377 GCTGGGCTCTTGAGGGGCAATGG - Intergenic
1069383415 10:67863048-67863070 TGTGGGATCTTCAGGAGCACAGG + Intergenic
1069670646 10:70199338-70199360 TGTGAGTACTTCTAGGGCAAAGG + Intergenic
1069812190 10:71170255-71170277 TGTGGGCTCCTGAGGGGCCAGGG - Intergenic
1070284201 10:75071630-75071652 TGAAGGATCTTCATGGGCAAAGG - Intergenic
1072542029 10:96405934-96405956 TCTGGGCTCCCCAAGGGCAAAGG - Intronic
1073419965 10:103416767-103416789 TGTGGGGTCACCAAGGGTAAAGG - Intronic
1073543051 10:104327947-104327969 TGTGAGCTCCTCCAGGGCAAGGG + Intronic
1073816869 10:107216993-107217015 TGTAAGCTCTTCAGAGGCAAGGG - Intergenic
1074046129 10:109840991-109841013 TTTGAGCTCTCCAAGGGCAGGGG + Intergenic
1074103016 10:110368456-110368478 TGAGGGCCAGTCAAGGGCAAGGG - Intergenic
1074572634 10:114638078-114638100 TGTGGGCTCTCTGAGGGAAAGGG + Intronic
1075069185 10:119309277-119309299 TGTGAGCTCTTGTAGGGCAGGGG + Intronic
1076225269 10:128769642-128769664 CTTGTGCTCTTCAAGGGCAGAGG - Intergenic
1078340117 11:10492663-10492685 TGGGAGCTCCTCAAGGACAAGGG - Intronic
1078396190 11:10984232-10984254 TGTGAGCTCCTTGAGGGCAAAGG - Intergenic
1079381048 11:19937798-19937820 TGAGAGCTCTTCAGAGGCAAAGG - Intronic
1080710990 11:34748073-34748095 TGTGGGCTCATCTAAGGAAAAGG - Intergenic
1081615215 11:44586908-44586930 TATGGGCTCCTCAAGGGGAGGGG - Intronic
1081925948 11:46828474-46828496 TGTGAGTTCCTCAAGGGCAAGGG + Intronic
1082148074 11:48695971-48695993 TGTGGGCTCATTGAGGCCAATGG + Intergenic
1082588063 11:54968074-54968096 TGGGAGCTCATTAAGGGCAATGG + Intergenic
1082593542 11:55045501-55045523 TGGGAGCTCTTTAAGGTCAATGG - Intergenic
1083316555 11:61818068-61818090 TTTGGGCACTTCAAAGGGAAAGG + Intronic
1083695652 11:64440600-64440622 TGTGGCCTTGTCATGGGCAATGG - Intergenic
1085802151 11:79600621-79600643 TGTGAGCTCTTCCAGGGTAGGGG + Intergenic
1086984626 11:93234452-93234474 AGGTGGCTCTTCCAGGGCAATGG + Intergenic
1090027570 11:123180845-123180867 TTTGGCATCTTCAAGGGCAGAGG + Intronic
1091560050 12:1605430-1605452 AGTGGGCTTTTCAAGGATAAAGG - Intronic
1092488177 12:8920968-8920990 TGTGGCCTATTAAAGGGGAAGGG - Exonic
1093373762 12:18398342-18398364 TGTGGGCTTTTCAGAGGAAAAGG + Intronic
1094866576 12:34539957-34539979 TGGGAGCTCATCAAGGCCAATGG - Intergenic
1095178121 12:39116866-39116888 AGTGGGAACTTCAAGGCCAAAGG - Intergenic
1096399963 12:51297738-51297760 TTTGGGCTCTTGAAGGGCTGAGG + Intronic
1096504535 12:52084430-52084452 TGTGAGCTCTTCAGGGGCAGGGG - Intergenic
1096596936 12:52701781-52701803 TTTTGGCTCATCAAGGGCCAAGG - Intronic
1097243654 12:57593142-57593164 TGTGAGCTCTTCAAGAACAAGGG - Intronic
1097627358 12:62016847-62016869 TATGAGCTCTCGAAGGGCAAAGG - Intronic
1099000177 12:77170181-77170203 TGTAAGCTCTTTAAGGGCAGAGG - Intergenic
1099153821 12:79149597-79149619 TATGGATTCTTCAAGGGCAAAGG - Intronic
1102025219 12:109710812-109710834 TGAGGGCTTTTCCAGGGCAAAGG - Intergenic
1103030305 12:117607108-117607130 AATGAGCTCTTCAAGGGCAAGGG + Intronic
1104194279 12:126517539-126517561 TGTTGTCTCATCAAAGGCAATGG + Intergenic
1106697217 13:32188656-32188678 AGTGGACTATTCAAGAGCAAAGG - Intronic
1108848845 13:54704217-54704239 TGTGGGATCCTCAAAGGCAAAGG - Intergenic
1112353961 13:98659277-98659299 TGTGGGATGTTCTAGGGCAGGGG - Intergenic
1113360318 13:109624931-109624953 TGTGAGTTCTTCAATGGCAGGGG - Intergenic
1114215380 14:20654010-20654032 TGTGGGCTCTGAAAAAGCAAAGG + Intergenic
1115882844 14:37939559-37939581 GGTGAGCTCCTCAAGGGCAGTGG + Intronic
1116203083 14:41824854-41824876 TGTGGTCTCTGCAAGGGGAGAGG + Intronic
1118180901 14:63492043-63492065 TCTGGGCTCTTCCAGGGCCTAGG - Intronic
1120462014 14:84809295-84809317 TCTGGGCTTTTCTAGGTCAAGGG + Intergenic
1120501408 14:85301718-85301740 TGTGTGCTGTGCAAGAGCAAGGG - Intergenic
1121189417 14:92012410-92012432 TGTAAGCTCTTCGAGAGCAAGGG - Intronic
1121401507 14:93681983-93682005 TGTGAGCTCTTCAAGAGCACAGG - Intronic
1122499331 14:102186260-102186282 TGTGGCCCCTTCAAGGGCAGCGG + Intronic
1123809814 15:23912473-23912495 TGTGGGGTCTGCACCGGCAAGGG + Intergenic
1124145465 15:27121325-27121347 TGAGCACTCTCCAAGGGCAAAGG - Intronic
1124183614 15:27501303-27501325 TCTGTGCTCTTCAGGGACAAAGG - Intronic
1125006520 15:34823422-34823444 TGTGTGCTCTGCTAGAGCAAGGG + Intergenic
1125692275 15:41605808-41605830 TGTGGAATCTTCAAGGGGAGAGG + Intergenic
1130646083 15:85728513-85728535 TGTGAGCTTCTCAAGGGCAAGGG - Intronic
1131032239 15:89195924-89195946 TGTGGCTTCTTAAACGGCAAAGG + Exonic
1133002508 16:2858344-2858366 TGTGGCCTCTGGAAGGGCAGGGG + Intergenic
1133244941 16:4442343-4442365 TGTGAGCGCTGCAACGGCAAGGG + Exonic
1134887738 16:17808870-17808892 TGTGATCTCTTAAATGGCAAAGG - Intergenic
1135413688 16:22253238-22253260 TGTGGGCTCATGCAGGGCAGAGG - Intronic
1135606181 16:23826776-23826798 TGGAGGCTCTTCAAGGGAAGAGG + Intergenic
1135892061 16:26366160-26366182 TGTGTGCTCTTCAAGGGCAGTGG - Intergenic
1136738145 16:32482758-32482780 TGAGAGCTCATTAAGGGCAAAGG + Intergenic
1138193735 16:55036800-55036822 TGTAGGCTCCTGAAGGACAAGGG + Intergenic
1140076001 16:71699368-71699390 TCTGGGGTCTTCATGGGCACAGG - Intronic
1140497483 16:75401870-75401892 TGTGAGCTCCTTAAGAGCAAAGG - Intronic
1141240599 16:82261922-82261944 TGTGAGCTCTTCGAAGGCACAGG - Intergenic
1141427674 16:83954191-83954213 TGGGGTGTCTTCAAAGGCAAAGG + Intronic
1203014928 16_KI270728v1_random:346819-346841 TGAGAGCTCATTAAGGGCAAAGG - Intergenic
1203033263 16_KI270728v1_random:619977-619999 TGAGAGCTCATTAAGGGCAAAGG - Intergenic
1143968196 17:10772264-10772286 AGTGGCCTGTTCAAGGTCAAAGG - Intergenic
1144417948 17:15069514-15069536 TGTGGACTCCTCCAGGGCAGGGG + Intergenic
1145263592 17:21368897-21368919 TGGGGGCTCCTCAAGGGCAGAGG - Intergenic
1145304469 17:21665744-21665766 TGTGAGCTCCTCAAGGCCAGGGG + Intergenic
1145862318 17:28221352-28221374 TGTGAGCTCTATGAGGGCAAGGG + Intergenic
1146544669 17:33727966-33727988 TGTAGGCCCTTGGAGGGCAAAGG - Intronic
1149569391 17:57661748-57661770 AGTGGCCACCTCAAGGGCAAAGG - Intronic
1151682870 17:75630924-75630946 TGTGGGCTCTTCCCGGGGCATGG - Intronic
1152015446 17:77747517-77747539 TGTGGGGTCTTCTGGGGCAAGGG + Intergenic
1152555171 17:81049502-81049524 TGTGGGCTTTAAAAGGGGAAGGG - Intronic
1156545096 18:37956420-37956442 TCTGGGCTCCTCAAAGGCCAAGG + Intergenic
1158539770 18:58342579-58342601 TGTGAGCTCATTAAGAGCAAGGG + Intronic
1160659829 19:292664-292686 TGAGGGAACTCCAAGGGCAAGGG + Intergenic
925158222 2:1663020-1663042 TGTGGCCTCTGCAAGAGCGAAGG - Intronic
925390781 2:3492488-3492510 CGTGGGCACTTCACGGGCCATGG - Intergenic
926760993 2:16278982-16279004 TGTTGGCTTTTCAAGGGCAAGGG + Intergenic
927149953 2:20189851-20189873 CGTGGGCTCTTCAAAGGCCAGGG + Intergenic
927438765 2:23093963-23093985 TGTAAGCTCTTCAAGGCCAATGG - Intergenic
929625094 2:43398495-43398517 TATGGGCTCTTCAAAGACAATGG - Intronic
931204949 2:60137824-60137846 TCTGGGCTCTTTATGGCCAAAGG + Intergenic
931633781 2:64323879-64323901 TGTGGGCTTCTTGAGGGCAAGGG + Intergenic
932035173 2:68238231-68238253 TGTTGGCTCCTCGAGGGCAGTGG - Intronic
932698316 2:73975636-73975658 TGTGGGCACTCCTGGGGCAAGGG - Intergenic
933584205 2:84162065-84162087 TGAGAGCTCCCCAAGGGCAAGGG - Intergenic
933695819 2:85216366-85216388 TGTCGGGTCTTCATGGGCAGCGG - Intronic
936158932 2:110069749-110069771 TGTGAGCCCCTCAAGGGCAGAGG + Intergenic
936185728 2:110301583-110301605 TGTGAGCCCCTCAAGGGCAGAGG - Intergenic
936282060 2:111150620-111150642 AATGGGCTCTGCAAGGGCAATGG - Intronic
937962149 2:127468381-127468403 TGTGACCTCTTTAAGGGCAGAGG + Intronic
938389123 2:130891151-130891173 TGTGAGCTCCTCGAGGGCAGGGG + Intronic
939968830 2:148638018-148638040 TGGGGGATCTGCATGGGCAAAGG - Intergenic
941136590 2:161724945-161724967 TGTGAACTGTTTAAGGGCAAAGG + Intronic
941385587 2:164847173-164847195 CGTGAGCCCCTCAAGGGCAAAGG - Intergenic
941557205 2:166996095-166996117 TGTAGGCTCCTTGAGGGCAAGGG + Intronic
942231689 2:173866503-173866525 TGTGGGCTCCTCCAGGGCGATGG + Intergenic
942406690 2:175663438-175663460 TGTGAGCTCCTCCAGGGCAGGGG - Intergenic
944568856 2:201021663-201021685 TGTAAGCTCTTCATGGGCAGTGG - Intronic
945630206 2:212265160-212265182 TGTGAGCTTCTCAAGGGCAGGGG - Intronic
945763090 2:213939293-213939315 TGTAAGCTCCACAAGGGCAAGGG - Intronic
947169919 2:227300661-227300683 TGTGGGCTCCTCTAGGGCAAGGG - Intronic
947587357 2:231364852-231364874 GGTGGGCTCTGCCAGGCCAAGGG - Intronic
948462347 2:238136220-238136242 TGTGTGCTGTTCAAGGACATTGG - Intergenic
1171138406 20:22719338-22719360 TGTCGCCTTTTCAAGGACAAGGG + Intergenic
1171187513 20:23133339-23133361 TCTGGGCCCCTCTAGGGCAAAGG - Intergenic
1171521985 20:25783176-25783198 TGTGAGCTCCTCAAGGCCAGGGG + Intronic
1171554840 20:26072707-26072729 TGTGAGCTCCTCAAGGCCAGGGG - Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172009472 20:31838003-31838025 TGTGAGCTCCCCAAGGGCAAGGG - Intergenic
1172013981 20:31862206-31862228 TGTGGTCTCATCAAGGACACAGG + Intronic
1172160510 20:32864820-32864842 AGTGAGCTCTTCAAAGACAAAGG - Intronic
1172980393 20:38937286-38937308 TGTGGGCACTTGATGTGCAAGGG + Intronic
1173484269 20:43428885-43428907 TGGGCCCTCTTCAAGGGCTAGGG + Intergenic
1175854526 20:62113407-62113429 AGTGGGCTCTTGATGGGGAAGGG - Intergenic
1176065330 20:63191314-63191336 TGTGGACTCCCCAAAGGCAAAGG + Intergenic
1176655794 21:9588171-9588193 TGTGAGCTCCTCAAGGCCAGGGG + Intergenic
1177784515 21:25656465-25656487 TTTGGGGTCTTCAAGGCTAAAGG - Intronic
1178116511 21:29423251-29423273 TGTGGCTTCTTGAAGGGCAGAGG - Intronic
1178488031 21:33031078-33031100 GGTGGGCTCTTCATTGGCAGTGG + Intergenic
1180969989 22:19810324-19810346 TGAGGGGACATCAAGGGCAAAGG + Intronic
1184252386 22:43268128-43268150 TGTGAGCTCTTCCAGAGCAGGGG + Intronic
1184449387 22:44574063-44574085 TGTGGGCTTCACAAGGGCAGGGG - Intergenic
1184668768 22:46002055-46002077 TGGGGGCTGCTCAAGGCCAAGGG + Intergenic
1184977991 22:48076677-48076699 TCTGAGGTCTTCAATGGCAAAGG + Intergenic
1185145900 22:49136552-49136574 TGTGGGCTGTACGTGGGCAATGG + Intergenic
949655722 3:6216583-6216605 TGTGGCCTCTCCATGGGTAATGG + Intergenic
950783623 3:15413828-15413850 TGTGAGCTCTTCAAGGGCAGGGG + Intronic
951102987 3:18710826-18710848 TGTGGCCTTTTCTAAGGCAAAGG + Intergenic
952342133 3:32455634-32455656 AGTCGGCTCCTCCAGGGCAATGG + Intronic
952681199 3:36095496-36095518 TATGGGTTCCTCAAGGGCACTGG - Intergenic
954372326 3:50175316-50175338 TGAGGGCTCTTCAGGGGAAGGGG - Intronic
954454958 3:50592786-50592808 TGTGCGCCCTCCAAGGGCAGAGG + Intergenic
955082954 3:55674830-55674852 TGTGGGTGGTTGAAGGGCAAGGG - Intronic
957101006 3:75828544-75828566 TGTGGGAACTTCATGGGAAATGG - Intergenic
960440054 3:117675794-117675816 TTTGAACTCTTCATGGGCAAAGG - Intergenic
960818597 3:121701786-121701808 TATAAGCTCTTCAAGGGCAGGGG - Intronic
961927207 3:130493833-130493855 AGTGAAGTCTTCAAGGGCAAGGG - Intergenic
962278701 3:134034347-134034369 TGTGGGCTCTTCAAGGGCAAAGG + Intronic
962435448 3:135362255-135362277 TGTGGGCTCCCCAAAGGCACAGG + Intergenic
962931025 3:140036103-140036125 TGTGAGCTCTGCAGGGGCAGGGG + Intronic
962987941 3:140552775-140552797 TGTGAGCACCTCAAGGGCAGGGG - Intronic
965673500 3:171171586-171171608 TGTGGGCTCTTCAAATTTAAAGG + Intronic
965697289 3:171422690-171422712 TATGAGCTCTTCAAGGGTCAAGG - Intronic
966595980 3:181725361-181725383 TGGGGGCTCTTCATTTGCAAAGG - Intergenic
966934526 3:184697148-184697170 TGTAGGCTCTATGAGGGCAAGGG + Intergenic
967305849 3:188058739-188058761 TGCAGGCTCCTCTAGGGCAAGGG - Intergenic
968427126 4:531586-531608 TGTGGGCTGTTCCATGGGAAAGG - Intronic
969247823 4:5946977-5946999 GGTGGTCTCTCCAAGGGCACTGG - Intronic
969831038 4:9797180-9797202 TGTGGTCACTGCAAGGACAAAGG + Intronic
970892581 4:21064703-21064725 TGAGTGCTATTCAAGGGCCAGGG + Intronic
979851215 4:125573269-125573291 TGTGGGGTTTTATAGGGCAAGGG + Intergenic
980410767 4:132414981-132415003 TGTGGCCTCTTAAATGGCAAAGG - Intergenic
980752987 4:137116389-137116411 TGTTGGTTATTCAAGGCCAAAGG - Intergenic
982597198 4:157401645-157401667 TGTAAGCTCCTCAAGAGCAAGGG - Intergenic
982766259 4:159352539-159352561 TGTGGTCTCTACAAGTGAAATGG + Intronic
984429103 4:179625605-179625627 TGTGTGCTGTTCCAAGGCAAAGG + Intergenic
984610711 4:181833830-181833852 TGTTGGCTTCTCAAGGACAAGGG + Intergenic
984661898 4:182383331-182383353 TGTGGGCCCAGCAAGGGGAAGGG + Intronic
984678495 4:182578419-182578441 TGTAAGCTCTACAAGGGCAGAGG + Intronic
985766581 5:1783072-1783094 TGTGGCCTTTTCAAAGGCAGGGG - Intergenic
986306008 5:6517504-6517526 TATGGGCTCTTAAAGTTCAAAGG - Intergenic
986333866 5:6738256-6738278 TGTGTGCTCTTGGTGGGCAAGGG + Intronic
987056673 5:14199951-14199973 TGTGGAGTGTTCAAGGCCAACGG + Intronic
987217261 5:15749834-15749856 CCTGGGCTCTTCAAGGCCCAGGG - Intronic
988297871 5:29390237-29390259 TGTGGGGTTTTATAGGGCAAGGG - Intergenic
988298879 5:29396299-29396321 TGTGGGGTTTTATAGGGCAAGGG - Intergenic
989117802 5:37972755-37972777 TGAGGGCTCTTGGAGGGCAAGGG + Intergenic
989970022 5:50512295-50512317 TGTGGGCTCCTCAGGGGCAGGGG + Intergenic
990793979 5:59519236-59519258 TGTAAGCTCTATAAGGGCAAGGG - Intronic
993494919 5:88597298-88597320 TGTGAGCTGTTCAAGAGCAGAGG - Intergenic
994104967 5:95937308-95937330 TCTGAGCTCTTCAAGGGCAAGGG + Intronic
997266857 5:132499931-132499953 TGTGAGCTCTCCAAGGACAGAGG + Intergenic
997404758 5:133636384-133636406 TGTGGGCTCTTTGAGGACATAGG + Intergenic
998182462 5:139955109-139955131 TGTAAGCTCTTCAAGGGCCGGGG - Intronic
999227135 5:150035027-150035049 TGTAAGCTCTTCAAGGGAAAGGG - Intronic
999302418 5:150499458-150499480 TGTGGGCTCTTCTAAGGCAGCGG + Intronic
999386319 5:151156723-151156745 TGTAGGCCCTACAAGGGGAAAGG - Intronic
1001481023 5:172089318-172089340 TGTAAGTTCTACAAGGGCAATGG + Intronic
1002520825 5:179792621-179792643 TGTGAGCTCCTCCAGGGCAGGGG - Intronic
1003533696 6:6957864-6957886 TTTGGGCTCTCCAAGGTCAAGGG - Intergenic
1003825344 6:9945890-9945912 TGTGGGGTCTTCAAACACAAGGG + Intronic
1005395332 6:25376885-25376907 TGAGGTCTTTTCAAGGGAAAGGG + Intronic
1006028304 6:31161516-31161538 TGGGGGCCCTTCAGGGCCAAAGG - Exonic
1006923233 6:37639746-37639768 TGTAAGCTCTTCAAGGACAGGGG + Intronic
1007586957 6:42996648-42996670 TGTGAGCTCTTTGATGGCAAGGG + Intronic
1007999988 6:46350310-46350332 TCTAGACTCTTCCAGGGCAATGG + Intronic
1009262974 6:61519359-61519381 TGGGAGCTCATCAAGGCCAATGG + Intergenic
1011115610 6:83887860-83887882 TGGGTGCTCTTCAGTGGCAAAGG - Intronic
1015233520 6:130943936-130943958 TGTGAGCTCCTAAAGGGCCAGGG + Intronic
1016232932 6:141828133-141828155 TGTGGCCTGTTAAATGGCAAAGG - Intergenic
1016609924 6:145977143-145977165 TGTAGGCTCCTTGAGGGCAAGGG + Intergenic
1021603653 7:22389606-22389628 GGTGGGCTCTTCCAGTGAAATGG - Intergenic
1022898211 7:34774296-34774318 TGTGAGCTATGCAAGGGCACTGG + Intronic
1023046352 7:36213818-36213840 TGTCGGCTCCACAAGAGCAAGGG + Intronic
1025549785 7:62230650-62230672 TGAGAGCTCATTAAGGGCAATGG + Intergenic
1025582321 7:62735946-62735968 TGTGAGCTCATTAAGGCCAATGG + Intergenic
1025584595 7:62767258-62767280 TGGGAGCTCATCAAGGCCAAAGG - Intergenic
1025593203 7:62890182-62890204 TGGGGGCTCTTTGAGGCCAATGG + Intergenic
1025596026 7:62926994-62927016 TGGGAGCTCATCAAGGCCAATGG + Intergenic
1026056217 7:66986035-66986057 TGTGAGCTCCTTAAGGGCAAGGG - Intergenic
1026171681 7:67959554-67959576 TGTAAGCTCTTTGAGGGCAATGG - Intergenic
1026721869 7:72839033-72839055 TGTGAGCTCCTTAAGGGCAAGGG + Intergenic
1029549342 7:101229131-101229153 TGTGGGTTCTTTGAGGGCACAGG + Intergenic
1029982980 7:104896417-104896439 AGTGAGCTCCTCAAGTGCAAGGG - Intronic
1031108570 7:117576956-117576978 TGTGAGCTTCTCAAAGGCAAGGG - Intronic
1031922097 7:127609508-127609530 TGTGTGCTCTGCAAGGACAGCGG - Intergenic
1032235080 7:130114191-130114213 TATAAGCTCCTCAAGGGCAAAGG - Intronic
1032544466 7:132730073-132730095 TGTGAGCCATTCAGGGGCAAGGG + Intergenic
1034310890 7:150086675-150086697 TGAGGGCACCTCAAGGGCAAAGG + Intergenic
1034795955 7:154013959-154013981 TGAGGGCACCTCAAGGGCAAAGG - Intronic
1038751800 8:30302999-30303021 TGTTGGCTGCTCAAGCGCAACGG + Intergenic
1039791010 8:40875596-40875618 TGTGGTATCTTCATGGGCCATGG + Intronic
1041518817 8:58732318-58732340 TGTGAGCTCCTCTAGGGCAGAGG - Intergenic
1041732317 8:61075158-61075180 TGTGGACTGCTCAAGGGGAAGGG + Intronic
1042599073 8:70480144-70480166 AGTGAGCTCTCCAAGGACAAAGG + Intergenic
1044471617 8:92575758-92575780 TGTGTGCTCTTCAAGAGCAGAGG + Intergenic
1045588595 8:103566683-103566705 TATGGAATCTTCAAGAGCAAAGG + Intronic
1045708632 8:104957502-104957524 TGGGGGCTCTTCAACAGCCATGG - Intronic
1047198484 8:122743228-122743250 TATGAGCCCCTCAAGGGCAAGGG - Intergenic
1048012425 8:130468793-130468815 CGTGAGCTCCTCAAGGGCAAAGG - Intergenic
1048034712 8:130666429-130666451 TGTAAGCTCCTCAAGGGCAATGG + Intergenic
1048203974 8:132400966-132400988 TGTGGCCTCTGCAAAGGCTAGGG - Intronic
1048475572 8:134739629-134739651 TGGGAGCTCCTTAAGGGCAAAGG - Intergenic
1048551025 8:135433685-135433707 TGTGGGCCCTGCAAGGCCATGGG + Intergenic
1048971701 8:139648716-139648738 GGTGGGCTCTTTGAGGGCAGGGG - Intronic
1049963713 9:760071-760093 AGTTGGGTCTTCAAGAGCAAGGG - Intergenic
1050335360 9:4584927-4584949 TGTGGGCTCTCTTTGGGCAAAGG - Intronic
1051162476 9:14223841-14223863 CCTGGTCTCCTCAAGGGCAACGG + Intronic
1051631964 9:19148748-19148770 TCTGGGCTCTTCAAGAGCAGGGG - Intronic
1052973654 9:34396816-34396838 TGTGAGCTCCTCAAAGGCAAGGG + Intronic
1052977642 9:34423179-34423201 TATGAGCTCTTCATGGGCAGGGG - Intronic
1055315059 9:75026926-75026948 TGTGACCTCCTCAAGGGCAGGGG - Intronic
1056226952 9:84505101-84505123 TGTCGGCTGTTGAAGGGGAAGGG - Intergenic
1058802952 9:108562542-108562564 TGTGAGCTCCTTAAGGGCAGGGG - Intergenic
1059658844 9:116381389-116381411 TGTGAGCTCTTCATGGACATGGG - Intronic
1060168594 9:121441863-121441885 TGTGGGCTTTTCAAATGCATGGG - Intergenic
1060186793 9:121568531-121568553 TGGGAGCTCTTCCAGGCCAAGGG - Intronic
1060660265 9:125401247-125401269 TGTGGGCCCTGCAAGGCCCATGG + Intergenic
1060966360 9:127714417-127714439 TGTGGCCCCTTCAAGGGATATGG + Exonic
1061213890 9:129209142-129209164 GGGTGGCTCTTGAAGGGCAATGG - Intergenic
1061443873 9:130626484-130626506 TGTGGCCTCGTCATAGGCAAAGG + Exonic
1062429401 9:136520281-136520303 GGTGGGAGCTCCAAGGGCAACGG - Intronic
1203633511 Un_KI270750v1:91632-91654 TGTGAGCTCCTCAAGGCCAGGGG + Intergenic
1186516519 X:10170332-10170354 TGTGAGCTCCTTGAGGGCAAAGG - Intronic
1188532609 X:31159164-31159186 TGTGAGCTCTTCAAGGGTAAGGG - Intronic
1188548375 X:31335446-31335468 TGTGAGCACTTTAAGGGCATAGG - Intronic
1188581894 X:31723953-31723975 TGTGAGCTCTTTAAAGACAAAGG + Intronic
1190393333 X:49954573-49954595 TGTGAGCTCTTCTAGGTCTAAGG + Intronic
1191574587 X:62684549-62684571 TGTGAGCCCTTTGAGGGCAATGG + Intergenic
1192553616 X:72072829-72072851 TGTAAGCTTTTCTAGGGCAAGGG + Intergenic
1193766820 X:85539871-85539893 TATAAGCTCCTCAAGGGCAAGGG - Intergenic
1197879060 X:131145685-131145707 TATGAGCTCCCCAAGGGCAATGG + Intergenic
1198363570 X:135918791-135918813 TCAGGGCTCTGCAAGTGCAAGGG - Intergenic
1199134546 X:144234936-144234958 TGTGGCTTTTCCAAGGGCAAGGG - Intergenic
1199973001 X:152874269-152874291 TGTGAGCTCTTTGAGGGAAATGG - Intergenic
1200118560 X:153779978-153780000 TCTGGCCACTTCAAGGACAAGGG - Intronic