ID: 962283335

View in Genome Browser
Species Human (GRCh38)
Location 3:134067934-134067956
Sequence CCCCGGGGCGAGGAAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962283335 Original CRISPR CCCCGGGGCGAGGAAGGCAC AGG Intronic
900340757 1:2187911-2187933 TGCAGGGGCTAGGAAGGCACAGG - Intronic
900747020 1:4367428-4367450 GCCAGGGGAGAGGTAGGCACTGG + Intergenic
900865747 1:5267583-5267605 CCCCCAAGCCAGGAAGGCACAGG + Intergenic
901808059 1:11750220-11750242 CCCAGGCACGAGGAAGGCCCGGG - Exonic
902488026 1:16760872-16760894 CCCTGGAGAGAAGAAGGCACAGG + Intronic
905800069 1:40837689-40837711 GCCCGGGGACAGGAAGGCCCGGG + Exonic
906615215 1:47229114-47229136 GCCTGGGGTGAGGAAGGCTCAGG - Intronic
907243077 1:53091359-53091381 CCCGGGGGAGAGGAAGACACAGG - Intronic
914680546 1:149935661-149935683 CCCAGGGGTGAGGAAGGGCCTGG - Exonic
915340512 1:155174511-155174533 CCCCTGGGAGAGCCAGGCACGGG - Intronic
916694246 1:167220772-167220794 GCCCGGGGAGAGGAAGGAGCGGG + Intergenic
923563285 1:235057995-235058017 CTCAGGGGCCAGGAAGGCTCAGG - Intergenic
923744431 1:236686922-236686944 CCCCGGGGCTGCGAGGGCACAGG - Intronic
1063661198 10:8036022-8036044 CCCGGGGGCGCGGAAGGTGCGGG + Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1065099169 10:22316645-22316667 CCCCGGGAAGAGGAAGTCTCCGG + Intronic
1067716961 10:48697349-48697371 GCCAGGGGCCAGGAAGACACGGG - Intronic
1067836213 10:49643466-49643488 CCCCGGGGCTCTGAAGGCACTGG + Intronic
1069513275 10:69057670-69057692 CCCCAGGAGGAGGAAGTCACAGG - Intergenic
1070032724 10:72692551-72692573 CACCAGGGCGGGGAAGGCACGGG + Intronic
1073051690 10:100671237-100671259 CGCAGGTGCGAGGAAGGCTCGGG - Intergenic
1073131055 10:101189589-101189611 CATCCGGGCTAGGAAGGCACTGG - Intergenic
1073538075 10:104295822-104295844 TCCCGGGGCAGGGATGGCACTGG - Intronic
1075729386 10:124627280-124627302 CCCCGGGGCATGGAGGGCACAGG - Intronic
1076431051 10:130402584-130402606 CCCCTGGGAGAGGAAAGCTCGGG - Intergenic
1077034054 11:486388-486410 CCCCGGGGCCAGGTGGGCACAGG - Intronic
1077406809 11:2386414-2386436 CCCCGTGGTGGGAAAGGCACAGG - Intronic
1082789208 11:57335692-57335714 CCCCGGTCCCAGGAAGGCAGGGG - Intronic
1083853390 11:65380359-65380381 GCACTGGGCCAGGAAGGCACTGG + Intronic
1084192571 11:67505491-67505513 GCCCGGGGGAAGGAAGGCAGGGG - Intronic
1088495842 11:110430391-110430413 GCCCGGCGCGCAGAAGGCACTGG - Intronic
1090201955 11:124863780-124863802 CCCTGGAGCGAGGAAGGGAGGGG + Intergenic
1091344461 11:134843584-134843606 ACCCGGGGCAAGGAAGGCCTGGG - Intergenic
1091686120 12:2563895-2563917 CCCGGGGGCTAGGAAGGAATAGG + Intronic
1095891074 12:47235562-47235584 CCTGTGGGCGAGGAAGTCACCGG + Exonic
1096264205 12:50110779-50110801 CCCTGGGGTGAGGAAAGAACAGG + Exonic
1098105868 12:67068973-67068995 AGCCGGGGAGAGGGAGGCACCGG + Intergenic
1102346292 12:112163312-112163334 CCCCAGGGCTGGGGAGGCACTGG - Intronic
1102597695 12:114005487-114005509 CCCCGGGGTGATTAAGGCAGGGG + Intergenic
1104221222 12:126786745-126786767 CCCTGGGGCCTGGAATGCACAGG + Intergenic
1104962758 12:132495937-132495959 CCCCGAGGCCAGCAAGCCACTGG - Intronic
1108112203 13:47086786-47086808 CCCTGGAGAGAGTAAGGCACAGG - Intergenic
1112467605 13:99657974-99657996 AGGCAGGGCGAGGAAGGCACGGG - Intronic
1113765489 13:112878312-112878334 CCCAGGTGCGTGGAAGGCAGAGG - Intronic
1113777807 13:112958692-112958714 CCCAGGGGTAATGAAGGCACGGG - Intronic
1114035907 14:18626965-18626987 CCCCTGGGCGAGGCGAGCACAGG + Intergenic
1114466210 14:22924597-22924619 GCCCAGGGTGAGGAAAGCACAGG - Intronic
1114706658 14:24734268-24734290 GCCCGGGGGGAGAAAGGCAGGGG - Intergenic
1118235051 14:63995305-63995327 CCCCGGGGAGAGGAGGGCTAGGG - Intronic
1118404850 14:65412892-65412914 CCGCGGGGAGACGAAGGGACGGG - Intronic
1121955682 14:98210519-98210541 GCCCAGGGCGAGGAAGGCGGGGG + Intergenic
1122058546 14:99121588-99121610 ACCAGGGGCCTGGAAGGCACAGG - Intergenic
1122270925 14:100568188-100568210 CCCCGGGGCGAAGAAGGGGCCGG + Intronic
1122411611 14:101528714-101528736 CCCAGGGGAGAGGAAGGCAGGGG + Intergenic
1122590659 14:102848035-102848057 CCCCACTGCAAGGAAGGCACAGG + Intronic
1122830749 14:104394481-104394503 GCTCGGGGGCAGGAAGGCACAGG - Intergenic
1122953728 14:105060397-105060419 CCCCGGGGCTCAGAAGGAACAGG - Intronic
1124115684 15:26841690-26841712 CCCATGGTAGAGGAAGGCACAGG + Intronic
1127963339 15:63906394-63906416 CCCAGGGTGGAGGGAGGCACAGG + Intergenic
1129115113 15:73361297-73361319 CCCAAGGGCTAGGAAGCCACTGG - Intronic
1129975286 15:79816478-79816500 CCCAGTGGTGAGGAAGGCTCTGG + Intergenic
1132215593 15:100059393-100059415 TCCCGGGGAGAGGAAAACACAGG + Intronic
1133042548 16:3068159-3068181 TCCTGGGGAGAGGAGGGCACAGG - Exonic
1136028037 16:27482436-27482458 CTCCCGGAAGAGGAAGGCACAGG - Intronic
1136110967 16:28063506-28063528 CCCCGGGGCGCGGCGGGCAGCGG - Exonic
1136483151 16:30555316-30555338 CCCCGGGCCGATGAACCCACTGG + Exonic
1136593066 16:31229315-31229337 GCCCGGGTCCCGGAAGGCACAGG - Intergenic
1137988508 16:53130606-53130628 CCTCGGGGCGGGGAAGGCTTGGG - Intronic
1138327955 16:56191299-56191321 CCCCGGGACGGGGAGGGCGCGGG - Intergenic
1138458279 16:57133428-57133450 CCCAGGGGAGGGGAGGGCACTGG + Intronic
1139966731 16:70749891-70749913 CCCTGGTGAGAGGAAGGCCCTGG + Intronic
1141638615 16:85328803-85328825 CCCCGGGGCGGGGAGGCCCCGGG - Intergenic
1142093388 16:88226961-88226983 CCCCGGCGCGGAGGAGGCACGGG - Intergenic
1142093399 16:88226998-88227020 CCCCGGCGCGGAGGAGGCACGGG - Intergenic
1142093410 16:88227035-88227057 CCCCGGCGCGGAGGAGGCACGGG - Intergenic
1142093421 16:88227072-88227094 CCCCGGCGCGGAGGAGGCACGGG - Intergenic
1142130767 16:88430575-88430597 CCCCAGGAAGAGGAAGGCTCGGG + Exonic
1142138036 16:88460504-88460526 CCCTGGTGCGAGGAAGAAACAGG + Intronic
1142518694 17:490176-490198 CCCAAGGTCGAGGAAGGCTCTGG + Intergenic
1142905317 17:3037260-3037282 CCCCAGGGCTGGTAAGGCACAGG - Exonic
1144114637 17:12075546-12075568 CACCTGGGCCAGGAAGGCTCAGG + Intronic
1144871602 17:18375619-18375641 CCCTGGGGAGAGGAAGGGAGAGG - Intergenic
1147634867 17:41957648-41957670 CCACAGGGGTAGGAAGGCACTGG + Intronic
1148139217 17:45316737-45316759 GCCCGGGGCGAGCGCGGCACCGG + Intronic
1148153298 17:45409136-45409158 CAGCGGGGAGAGGAAGGCAGAGG + Intronic
1149430665 17:56593924-56593946 CCGCGGGGCGCGGGAGGCGCCGG - Exonic
1151213637 17:72562638-72562660 CCCCGGGGCCAGGCAGGAATGGG + Intergenic
1151696953 17:75722607-75722629 CTCTGGGGCGAGGAAGGGCCTGG + Intronic
1152001016 17:77645245-77645267 CCGCAGGGCGAGGCAGCCACCGG - Intergenic
1152067406 17:78119208-78119230 CCCCAGGGGGAGGCAGGTACAGG + Intronic
1152516023 17:80825351-80825373 CCGCGTGGCGAGGTTGGCACAGG + Intronic
1152561738 17:81082052-81082074 CCCCGGGGCCAGGAGGGAGCAGG - Intronic
1154111065 18:11568759-11568781 CCCCTGGGAGAAGAAGGCAGGGG - Intergenic
1155858543 18:30866828-30866850 GAGCGGGGAGAGGAAGGCACTGG + Intergenic
1157703450 18:49780384-49780406 ACCCAGGCCCAGGAAGGCACAGG + Intergenic
1157849117 18:51030675-51030697 CCCCGGGGCGGGGAAGCCACAGG - Intronic
1160011805 18:75111703-75111725 CCCCAGGGCGATGAAATCACAGG + Intergenic
1160590309 18:79940930-79940952 CCCCGGGGGAGGGCAGGCACAGG + Intronic
1160780110 19:873760-873782 CCCCGGGGGGGGGCAGGCAGTGG - Intronic
1160865048 19:1252715-1252737 CCTCGGGGCCAGGGAGGCCCGGG - Intronic
1160914041 19:1488305-1488327 CCCAGGGGCGAGCAGGGGACAGG - Intronic
1161028277 19:2046573-2046595 CCCGAGGGGGAGGAGGGCACAGG - Intronic
1161400856 19:4065809-4065831 CCCCGGGGCGGGGAGGGGGCCGG + Intronic
1161768057 19:6217573-6217595 CCCCAGGGCCAGCGAGGCACTGG - Intronic
1162372973 19:10290021-10290043 CGCCGCGGCGGGGAAAGCACAGG - Exonic
1162722843 19:12672765-12672787 CCACTGGGCTGGGAAGGCACAGG + Intronic
1163426945 19:17245314-17245336 CCCCGGCGCGCGGGGGGCACGGG + Exonic
1164556492 19:29256691-29256713 TCCCAGGGCCAGGAGGGCACTGG - Intergenic
1164813627 19:31177419-31177441 CCCCGAGGCTGGGAAGGCAAGGG - Intergenic
1164958499 19:32406313-32406335 CCCCTGGACGAGGCAGGCACCGG - Intronic
1165596056 19:37011926-37011948 CCCAGGGGCGAGGGAGGCAGAGG + Intronic
1167420148 19:49397908-49397930 CCCCGGGTCGAGGTAGGTGCTGG - Intronic
1167628424 19:50607628-50607650 CCCTGAGGCGAGGGAGGCAGGGG - Intergenic
1168100316 19:54138024-54138046 CGCCGGGGGGAGGAAGGGAAGGG - Intronic
1202703173 1_KI270713v1_random:3368-3390 CCCTGGAGAGAAGAAGGCACAGG - Intergenic
925165618 2:1713924-1713946 TCCCAGAGCCAGGAAGGCACAGG + Intronic
927481426 2:23457099-23457121 CCCCGGCGTCGGGAAGGCACAGG - Intronic
928125469 2:28612450-28612472 CCCCAGAGTGAGGAAGGGACGGG - Intronic
930130822 2:47848223-47848245 CCCCGGGGCCAGTTAGGAACTGG + Intronic
932346828 2:71001185-71001207 CCCAGGGGCTAGGAAGGTGCGGG + Intergenic
932624197 2:73284686-73284708 GCCCAGGGCGGGGAATGCACTGG - Intergenic
932733175 2:74234862-74234884 TCACGAGGTGAGGAAGGCACTGG - Intronic
934952354 2:98585587-98585609 GCCCGGGGCGAGGCATGCAGAGG - Intronic
938237645 2:129719450-129719472 CCCAGGGGCTGGGAAGGCAGAGG + Intergenic
938645385 2:133325151-133325173 CCTGGGAGGGAGGAAGGCACTGG + Intronic
941849173 2:170161953-170161975 CCTCTGGGAGAGGAAGGCGCAGG + Intergenic
942069538 2:172304030-172304052 CCCCAAGGTGAGTAAGGCACAGG + Intergenic
945471309 2:210230453-210230475 CCCTGGGGCCAGGAAGGCCTTGG - Intergenic
946235903 2:218324124-218324146 CCCTGGGGCCAGGAAGGAAGGGG - Intronic
946416227 2:219541124-219541146 CCCTGGGGAGAGGAAGGGAAGGG + Exonic
948462083 2:238134605-238134627 CCCCGGGGGCAGGCAGGCACTGG + Intergenic
1168764253 20:371226-371248 CCCCAGGTCGAGGAAGGCTGAGG - Intronic
1170893799 20:20396560-20396582 CCCCGGGGAGGGGAAGGCCCAGG + Intronic
1171173617 20:23035508-23035530 CCCGGGGGCGAGGAAGGGCTGGG + Exonic
1174727450 20:52877930-52877952 GACAGGGGCGAGGGAGGCACTGG + Intergenic
1175769007 20:61611204-61611226 CCCCAGGGAGAGGAAGGAAAGGG - Intronic
1175926554 20:62474251-62474273 CGCCGGCGCGAGGGAGGCCCGGG + Intronic
1175930180 20:62490171-62490193 CCCAGGAGCGTGGAAGGCCCTGG - Intergenic
1175963436 20:62648385-62648407 CCCTGGGGCGGGGCAGCCACAGG + Intronic
1176038004 20:63049697-63049719 CGCCGGGGCGAGGGTGACACAGG + Intergenic
1176044279 20:63084287-63084309 CCCCCGGGCGAGGAGGGCACTGG - Intergenic
1176117752 20:63440392-63440414 GCCGGGGCCGAGGAAGGCAGGGG + Intronic
1179430281 21:41316794-41316816 CCCCTGGGTCAGGAAGGCAAGGG - Exonic
1179654761 21:42838051-42838073 CCCGGGGTCCAGGGAGGCACGGG + Intergenic
1180154458 21:45971308-45971330 CCCAGGGGTGAGGAGGGCTCAGG - Intergenic
1180460030 22:15554019-15554041 CCCCTGGGCGAGGCGAGCACAGG + Intergenic
1180702553 22:17789547-17789569 CGCCAGGGTGAGGCAGGCACCGG + Exonic
1181110781 22:20601725-20601747 CCCCTGGGCAAGGAAAGCAAAGG + Intergenic
1184259882 22:43308695-43308717 ACCCTGGGGGAGGAAGTCACCGG - Intronic
1184379868 22:44138515-44138537 CCACGGGGAGGGGAAGGAACAGG - Intronic
1184499989 22:44865702-44865724 ACCCGGGGCAAGGAGGGGACTGG + Intergenic
1185394160 22:50578310-50578332 CACAGGGGCGAGGACGGCGCTGG - Intronic
950138885 3:10601691-10601713 CCCCGGGGAGGGGAACGCCCAGG + Intronic
950214638 3:11150739-11150761 GCCCGGGGAGAGGAAGGCCTGGG - Intronic
954298657 3:49687667-49687689 CCCTGGAGAGAAGAAGGCACAGG + Exonic
954681831 3:52350127-52350149 CACTGGGGCCAGGGAGGCACAGG + Intronic
956406403 3:68932631-68932653 CCGCGGGGCCAGGCAGGGACAGG - Intergenic
961929378 3:130517106-130517128 CGCCGGGGCGGGGAAGGGTCGGG + Intergenic
962283335 3:134067934-134067956 CCCCGGGGCGAGGAAGGCACAGG + Intronic
962377004 3:134866831-134866853 TCCCAGGGTGAGGAAGGAACGGG - Intronic
966684851 3:182682789-182682811 CCCCGGGGCGAAGCGGGCAGGGG - Intergenic
968073686 3:195804110-195804132 TCCAGGGACGAGGAGGGCACTGG + Intronic
968093041 3:195909767-195909789 CCCCGGGGCGGCGCAGGCGCAGG - Intronic
968870782 4:3241069-3241091 CCCCAGGGCTAGCAAGGAACAGG - Exonic
974069438 4:57110452-57110474 CCCCGGGGCGGTGAGAGCACGGG + Intergenic
979099839 4:116599920-116599942 CCCCAGGGCATGGAAGGGACCGG - Intergenic
983472574 4:168174576-168174598 GCCCAGGGCGAGCAAGGCCCAGG + Intronic
985640979 5:1063403-1063425 TCCCGGGCCGAGGAGGACACGGG + Intronic
987087946 5:14487391-14487413 CCGCGGGGTGAGGGAGGAACAGG - Intronic
989102595 5:37836054-37836076 CCCTGGGATTAGGAAGGCACTGG - Intronic
998390967 5:141786878-141786900 CCGGGGGGCAAGGCAGGCACTGG - Intergenic
999395335 5:151223548-151223570 CCCCGGGGGGAGGAAGCCGAAGG + Intronic
1001436346 5:171702565-171702587 CCCCGGGGTGGGGAAGGAAGGGG + Intergenic
1002027535 5:176405689-176405711 CACAGGGGCGTGGAGGGCACGGG + Intronic
1002397776 5:178971429-178971451 CCCTGGGGTGATGAAGGCAGAGG + Intergenic
1002401613 5:178994382-178994404 CCCCAGGGCGAGGACGGGAGAGG + Intronic
1003052829 6:2795672-2795694 ACAGGGGGAGAGGAAGGCACAGG - Intergenic
1003626666 6:7747437-7747459 CCCCAGGCCGAGGAATGCAGTGG + Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006593347 6:35174109-35174131 CCACGAGGCAAGGAAGGCAGGGG + Intergenic
1007476703 6:42124123-42124145 GCCCAGGGAGAGGAAGGGACTGG + Intronic
1007838211 6:44693894-44693916 GCACAGTGCGAGGAAGGCACTGG - Intergenic
1007902285 6:45423011-45423033 CCCCGTGGGCAGGAAGACACCGG - Intronic
1009431555 6:63572265-63572287 CCCCGGGGCGGGGGAGGGAAGGG - Exonic
1009952579 6:70413774-70413796 CCCAGGGGCCAGGAAGGAAGCGG + Intronic
1011719881 6:90144452-90144474 CCCTGAGGCCAGTAAGGCACTGG + Intronic
1012399276 6:98831538-98831560 GCCCGGGGCGGGGGAGGAACCGG + Intergenic
1017737934 6:157381000-157381022 CCCTGGGGTGTGGAAGGCGCGGG - Intergenic
1017737999 6:157381222-157381244 CCCCGGCGCGAGGAGGGCCGCGG - Exonic
1018419748 6:163631075-163631097 CCCCGGGGCGAGGAGGACAGGGG - Intergenic
1020099973 7:5389123-5389145 GCCCGGGGCGAGGAGGCCTCGGG - Exonic
1022375535 7:29807503-29807525 CCCCGTGGGCAGGCAGGCACCGG + Intronic
1023611697 7:41978312-41978334 CCACGGGGCTTGGAAGGCAAAGG - Intronic
1024984768 7:55185501-55185523 CCACGGGGAGAGGGTGGCACAGG - Intronic
1031134751 7:117873100-117873122 CCGTGGGGCGCGGAAGGGACAGG + Intronic
1033756986 7:144403844-144403866 CCCCAGGGCGAGGCCGGCCCGGG + Intronic
1033865416 7:145685722-145685744 CCCCAGTGGGAAGAAGGCACAGG + Intergenic
1035019632 7:155792793-155792815 CCGTGGGGCGAGTAGGGCACAGG - Intergenic
1035066411 7:156108427-156108449 CCCCGGGGCGGGGATGGCAGAGG - Intergenic
1035068545 7:156124718-156124740 CCCTGGGGCCAGGATGGCCCTGG + Intergenic
1035261203 7:157662670-157662692 CCACGGGGCGAGGAAGGAGGAGG + Intronic
1035573181 8:687721-687743 CCCCCGGGCGCGGCGGGCACTGG - Intronic
1035580531 8:737227-737249 ACGCGGGGCGAGGGAGGCGCGGG - Intronic
1036601597 8:10265756-10265778 CTGCGGGGTGAGGAAGGCAGGGG - Intronic
1040481814 8:47833582-47833604 CACCGAGCAGAGGAAGGCACGGG - Intronic
1041197021 8:55410648-55410670 CCCGGGGGAGAGGCAGGCAGGGG - Intronic
1044375085 8:91460735-91460757 ACCCAGAGAGAGGAAGGCACAGG - Intergenic
1048060826 8:130917736-130917758 CTCAGGGGTGAGGGAGGCACAGG + Intronic
1048356365 8:133657123-133657145 CCCCAGGGCGAGGTAGGCTTGGG + Intergenic
1049271449 8:141698348-141698370 CGCCGGGGTGGGGAAGTCACTGG + Intergenic
1049591981 8:143466779-143466801 CCCAGGAGGGAGGAAGGCCCTGG - Intronic
1049638932 8:143705593-143705615 CCCCGGGGAGAGGGAAGCCCGGG + Intronic
1049812005 8:144579844-144579866 CCCCAGGGAGAGAAAGGCAGGGG - Intronic
1049845473 8:144798861-144798883 TCCGGGGGCGGGGAAGGAACCGG + Exonic
1053073533 9:35114990-35115012 CCCTGGGGCAAGGAAGGAAGTGG + Intronic
1053123000 9:35560271-35560293 GCCCGGGGCCAGGAGGGCCCTGG + Exonic
1056855727 9:90128120-90128142 ACCCGGGGAGCGGAGGGCACAGG - Intergenic
1057179346 9:93021458-93021480 GCCCGCTGCGAGGAAGGCCCTGG + Intronic
1057852453 9:98576010-98576032 CCCCGGGTCAAGGAAGCCCCAGG - Intronic
1059662732 9:116417892-116417914 CCACGGGGTCAGGAATGCACTGG + Intergenic
1060799031 9:126532123-126532145 GCCCGGGGAGCGGAAGGCCCAGG - Intergenic
1061295617 9:129675317-129675339 CCCAGGGGCGTGGAATGCAGGGG + Intronic
1061816338 9:133199684-133199706 CAGCTGGGAGAGGAAGGCACCGG - Intergenic
1062332794 9:136051845-136051867 CCCTGGGGCGGGGAGGGCGCAGG + Intronic
1062354775 9:136156837-136156859 CCCCGGGGGGAGGTGGGCTCAGG - Intergenic
1185504028 X:619166-619188 CCCCGGGGCGAGGCAGGGGAGGG - Intergenic
1189467913 X:41291533-41291555 CCCAGGGGCCAGGAAGGGAATGG - Intergenic
1189988755 X:46575432-46575454 GCCCGGGGCAAGGCAGGGACCGG + Intronic
1193729908 X:85090337-85090359 CCCTGTGGTGAGGAAGGCAAGGG + Intronic
1198480301 X:137034250-137034272 TCAGGGGGCTAGGAAGGCACGGG - Intergenic
1199690209 X:150303944-150303966 CTCCGGGACAAGGAAGGCACAGG - Intergenic
1199863535 X:151822817-151822839 CCCCTGGGGGAGTAAAGCACAGG + Intergenic
1200279244 X:154762828-154762850 CCCCGCGGCAAGGCACGCACAGG + Exonic