ID: 962285131

View in Genome Browser
Species Human (GRCh38)
Location 3:134078940-134078962
Sequence AACCTTTCCCAGCCACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962285129_962285131 -6 Left 962285129 3:134078923-134078945 CCAAAAGCCTTGTCAAAAACCTT 0: 1
1: 1
2: 9
3: 20
4: 231
Right 962285131 3:134078940-134078962 AACCTTTCCCAGCCACAGACTGG 0: 1
1: 0
2: 2
3: 12
4: 227
962285128_962285131 1 Left 962285128 3:134078916-134078938 CCAAAGGCCAAAAGCCTTGTCAA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 962285131 3:134078940-134078962 AACCTTTCCCAGCCACAGACTGG 0: 1
1: 0
2: 2
3: 12
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962285131 Original CRISPR AACCTTTCCCAGCCACAGAC TGG Intronic
900176928 1:1295104-1295126 AGCCTGGGCCAGCCACAGACGGG - Intronic
900885220 1:5410325-5410347 AACCTCTCCCAGACCCAGGCAGG - Intergenic
900901304 1:5518126-5518148 AAACTTTCACAGCCACAGGGAGG - Intergenic
901685368 1:10940722-10940744 AACCTTCCCCAGCCAGGCACAGG + Intergenic
902301424 1:15505331-15505353 AGCCCTGCCCAGCCACAGGCTGG + Intronic
902634225 1:17724628-17724650 CACCTTGCCCAGCCTCAAACAGG - Intergenic
903225287 1:21891033-21891055 AGCCTTTCCCAGTCACACGCAGG - Intronic
903541353 1:24098073-24098095 AGCCTTTCCCACCCACACAGGGG - Intronic
903680693 1:25094700-25094722 AACCTGTCTCTGCCAGAGACTGG - Intergenic
904883166 1:33715672-33715694 CACCTTTCTCAGCCACGGCCAGG - Intronic
905366880 1:37457007-37457029 AACCTTTACCCTCCACAAACTGG + Intergenic
906544252 1:46610261-46610283 AACTTTTCCCTCCCACACACAGG + Intronic
906710356 1:47924824-47924846 CACCTTTCCCATCCCCAGGCAGG - Intronic
907304617 1:53506776-53506798 ACCCTTTCCCAACCACTCACAGG - Exonic
907842874 1:58173607-58173629 ACCCCTTTCCAGCCACACACCGG + Intronic
908154990 1:61343979-61344001 AGCCTCTCACAGCCACAGTCAGG + Intronic
908168951 1:61485862-61485884 AACCTTTGCCTCCCACACACGGG - Intergenic
908189049 1:61682291-61682313 AAGCTTTCATAGACACAGACAGG - Intronic
910895932 1:92069340-92069362 AACCATTCCCATACCCAGACAGG + Intergenic
911471869 1:98328965-98328987 TACCTTTCTCAGCCCCACACTGG + Intergenic
912631331 1:111248973-111248995 GCCCCTTCCCAGCCAGAGACAGG + Intergenic
913602269 1:120433455-120433477 AAAGTTTTCCAGCCACACACAGG + Intergenic
914084781 1:144443182-144443204 AAAGTTTTCCAGCCACACACAGG - Intronic
914190789 1:145408348-145408370 AAAGTTTTCCAGCCACACACAGG - Intergenic
914363441 1:146957061-146957083 AAAGTTTTCCAGCCACACACAGG + Intronic
914488236 1:148130073-148130095 AAAGTTTTCCAGCCACACACAGG - Intronic
914588598 1:149085193-149085215 AAAGTTTTCCAGCCACACACAGG - Intronic
917978938 1:180257491-180257513 AGCCTTCTCCAGACACAGACGGG - Intronic
919911414 1:202113250-202113272 AACCTATCTCAGCTACAGCCTGG + Intergenic
920235396 1:204499990-204500012 AACCTTTCCTAGCCGAAGTCAGG + Intergenic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
923898236 1:238296447-238296469 GACCTTTCCCAGCCATACACAGG + Intergenic
924377061 1:243422028-243422050 AGCCTCTGCCAGCCACAGAGTGG + Intronic
924454093 1:244204241-244204263 ACCCTTTCCCAGGCACAGGCAGG - Intergenic
1063944644 10:11165098-11165120 TTTCTTTCCCAGCCACAGCCAGG + Intronic
1064313529 10:14234091-14234113 CACCCTGCTCAGCCACAGACAGG + Intronic
1066280604 10:33914008-33914030 CCCCATCCCCAGCCACAGACTGG - Intergenic
1069220542 10:65877764-65877786 AACCATTCCCATCCTCAGATGGG + Intergenic
1069616346 10:69808790-69808812 AACCTTCCCCAGCCTCTAACAGG - Intronic
1069888493 10:71638602-71638624 GACCTTTCCCTGCCTCAGAGGGG - Intronic
1072080445 10:92024662-92024684 AACCTTTTCTTGCCACAGAGAGG + Intronic
1073419645 10:103414157-103414179 AACCCTTCCCAAGCACAGCCAGG - Intronic
1073481363 10:103788026-103788048 CATTTTTCCCAGCCACAGAAGGG - Intronic
1074690436 10:115999345-115999367 CACCTATCCCAGCCTCATACTGG - Intergenic
1081300863 11:41449562-41449584 AACCATACCCAGGCCCAGACAGG + Intronic
1081483762 11:43511962-43511984 AACATTTCCCAGGCAGACACAGG - Intergenic
1081881562 11:46457278-46457300 ACCATTACCCAGCGACAGACAGG + Intronic
1084492402 11:69486022-69486044 ACCCTTTCTTAACCACAGACAGG + Intergenic
1084945854 11:72638015-72638037 AATGTTTCCCAGCCACAGCTGGG - Intronic
1087682559 11:101232865-101232887 ACCCCTTCCCAGCCACTCACTGG - Intergenic
1089671733 11:120061783-120061805 AACCTCTCCCAGCCCCAAATAGG - Intergenic
1090551260 11:127822386-127822408 TAATTTTCCCAGACACAGACAGG + Intergenic
1091078621 11:132644631-132644653 TCCCTTTCCCAGACACACACAGG + Intronic
1091563028 12:1629267-1629289 ACCGTTTCCGAGCCAAAGACAGG - Exonic
1091564477 12:1638437-1638459 AACCATTCCCACCCACAGTATGG + Intronic
1092973332 12:13719994-13720016 AACCTTTCCCAGCCTTGCACAGG - Intronic
1096862662 12:54541089-54541111 AACCTGTGCCAGGAACAGACTGG - Intronic
1097966461 12:65586824-65586846 AACCTAGCCCAGACACAGAGTGG - Intergenic
1100016535 12:90017267-90017289 AACCTATACCTGCCACAGATTGG - Intergenic
1101167254 12:102051208-102051230 AACTTTTCCCACCCCCCGACAGG - Intronic
1103341796 12:120224823-120224845 AGGCTTTCCCAGCCCCCGACTGG + Intronic
1103409362 12:120699867-120699889 AACAGTTCCCAGGCACAGAAAGG - Exonic
1106057582 13:26253400-26253422 AACCTTTCCTATCCATATACAGG - Intergenic
1113615624 13:111678540-111678562 CACAGCTCCCAGCCACAGACGGG - Intergenic
1113621092 13:111763442-111763464 CACAGCTCCCAGCCACAGACGGG - Intergenic
1114699845 14:24665706-24665728 AATCTTCCCCAGCCAGTGACAGG - Intergenic
1115073726 14:29359641-29359663 AAACCTTCCCAGCAAAAGACAGG - Intergenic
1115633603 14:35269112-35269134 AACCTTTCCCAGACAGGGAGTGG - Intronic
1119635656 14:76271210-76271232 AGCCTTTCCCAGCCAGTGAGGGG - Intergenic
1121127319 14:91416900-91416922 AAGCTCTCCCAGGCAGAGACTGG + Intronic
1122262507 14:100531359-100531381 CAGCTTCCCCACCCACAGACAGG - Intergenic
1123425550 15:20167861-20167883 AACCTCACTCAGCCACTGACAGG - Intergenic
1123534772 15:21174379-21174401 AACCTCACTCAGCCACTGACAGG - Intergenic
1127389253 15:58492042-58492064 AGCCTTCCCCAGCCCCAGAGAGG + Intronic
1130111897 15:80972371-80972393 ATCCTCTCTCAGCCAGAGACTGG - Intronic
1133609651 16:7421492-7421514 GACATTTCCCAGGCACAGCCAGG + Intronic
1134055189 16:11165612-11165634 AGTCTTTCCCAGCCACAACCTGG - Intronic
1137876840 16:52005167-52005189 AACCTTTCCCAGCCTCAGAGAGG - Intergenic
1138133175 16:54499595-54499617 AACTTGTCCCAGCTGCAGACAGG + Intergenic
1138222980 16:55268849-55268871 TGCCCTTCCCAGCCACAAACAGG + Intergenic
1139307907 16:66003636-66003658 AACCTTGCATAGCCACACACTGG - Intergenic
1141517683 16:84557210-84557232 GACCTATCCCAGGCACAGCCAGG - Intergenic
1142006979 16:87694036-87694058 AGCCTGTCCAGGCCACAGACGGG + Intronic
1143461537 17:7107374-7107396 ATGCTTCCCCAGCCACAGGCTGG - Intronic
1143477450 17:7211035-7211057 AACCTCTTCCAGCCACATTCTGG - Intronic
1144110586 17:12027754-12027776 AACCCTTCCTAGGCACAGCCTGG - Intronic
1146244696 17:31269703-31269725 AACCATTACCAGCCACAGCTAGG - Intronic
1146683401 17:34824511-34824533 AACCTTTCCCAGGAACAGAGGGG - Intergenic
1146930653 17:36775263-36775285 TAGATTTCCCAGCCCCAGACAGG + Intergenic
1147331316 17:39700857-39700879 AACCTGTCCCAACCAGAGCCGGG + Intronic
1148122898 17:45222821-45222843 ATCCTTTCCAAGCCACTGAAGGG + Intronic
1148853574 17:50566536-50566558 CACCTTACCCAGGCTCAGACTGG - Intronic
1149512496 17:57255775-57255797 AACCTTTCCCGGGCACGGATTGG + Intergenic
1151238311 17:72737862-72737884 ACTCTTTCCCAGCCCCAGAGAGG - Intronic
1151915595 17:77115557-77115579 ACCCCTTCACAGCCACAGTCAGG - Intronic
1155298035 18:24403213-24403235 GAAAGTTCCCAGCCACAGACAGG - Intergenic
1155927546 18:31673137-31673159 AAACTTTCCCACCAACAGAATGG - Intronic
1156502989 18:37571372-37571394 AACCATTCCCTGCCAGAGCCAGG - Intergenic
1156636145 18:39031942-39031964 AGCCTTTCCCTGACACAGTCAGG + Intergenic
1160160263 18:76465436-76465458 AGCCTTTCTCAGACACAGATTGG - Intronic
1161728076 19:5942047-5942069 ATGCTTTCCCAGCCACTGAGAGG - Intronic
1163881358 19:19925064-19925086 AACTCATCCCAGCCACAGTCTGG - Intronic
1163901706 19:20107260-20107282 AACTCCTCCCAGCCACAGTCTGG - Intronic
1163917370 19:20252901-20252923 AACTTTTCCCAGCCACAGTCTGG - Intergenic
1163959980 19:20680383-20680405 AACTCCTCCCAGCCACAGTCTGG - Intronic
1163974451 19:20836807-20836829 AACTCCTCCCAGCCACAGTCTGG + Intronic
1164116367 19:22223094-22223116 AACTCCTCCCAGCCACAGCCTGG - Intergenic
1164134367 19:22400136-22400158 AACTCCTCCCAGCCACAGTCTGG + Intronic
1164164446 19:22656637-22656659 AACTCCTCCCAGCCACAGTCTGG - Intronic
1164200061 19:23010562-23010584 AACTCCTCCCAGCCACAGCCTGG - Intergenic
1164215192 19:23138518-23138540 AACTCTTCCCAGCCAAAGTCTGG - Intronic
1164253214 19:23503218-23503240 AACTCTTCCCAGCCATAGTCTGG + Intergenic
1164285378 19:23810783-23810805 AACTCTTCCCAGTCACAGTCTGG - Intronic
1164317696 19:24108280-24108302 AACTCTTCCCAGTCACAGTCTGG - Intronic
1164663465 19:30001698-30001720 AGCTTTTCCCAGCCACAGTTAGG + Intronic
1166177868 19:41087717-41087739 CCCCTTTCCCAGCCAGAGATGGG + Intergenic
1166346916 19:42172275-42172297 AACCAATCCCAGCCTTAGACAGG - Intronic
1166388278 19:42394436-42394458 AAGGTTTCACAGCCACTGACAGG - Intergenic
924984910 2:262371-262393 TTCCTTCCCCAGCCACAGCCTGG - Intronic
925832016 2:7904910-7904932 GACTTTCCCCAGCCACATACAGG + Intergenic
929033460 2:37670603-37670625 AGCTTGTCCCAGCCACAGCCTGG + Intronic
930870749 2:56168356-56168378 ACTGTTTACCAGCCACAGACAGG - Intergenic
931914877 2:66943168-66943190 TACTTTTCCCAGCCACACGCAGG - Intergenic
935892522 2:107694532-107694554 AACCTTACCTAACCAGAGACAGG - Intergenic
936622675 2:114116840-114116862 GAGCTTGCCCAGCCACAGCCTGG - Intergenic
938593053 2:132758151-132758173 AACCTTTCTCTGCAAGAGACTGG + Intronic
940279399 2:151973951-151973973 ACCCTTCCTCAACCACAGACTGG + Intronic
940974389 2:159926997-159927019 CTCCTTTCCCAGCCCCACACTGG + Intergenic
941989318 2:171539578-171539600 AAATTTTCCCTGACACAGACTGG + Intronic
943018630 2:182546038-182546060 AACTTTCCTCAGCCACAGAGGGG - Intergenic
944671441 2:201997560-201997582 AACCTTTCCCAGAGAAAGAGAGG - Intergenic
945742752 2:213683015-213683037 AACATCTCACAGCCACAAACTGG + Intronic
946431611 2:219629503-219629525 AACCCTACCCAGCCTCACACAGG - Intronic
947515693 2:230802055-230802077 AACCTTACACAGGCACAGTCTGG - Intronic
948707235 2:239802497-239802519 AACACATCCCAGCCACAGCCAGG + Exonic
1170774369 20:19362984-19363006 AAGCTTTCCCAGCGACACATGGG - Intronic
1171021308 20:21586705-21586727 GCCCTCACCCAGCCACAGACAGG - Intergenic
1171297320 20:24029680-24029702 AAGATCTACCAGCCACAGACAGG + Intergenic
1171386114 20:24770396-24770418 CCCTTTTCCCAGGCACAGACAGG + Intergenic
1171427964 20:25060203-25060225 AAGCTGTCCCATCCACAGCCAGG + Intergenic
1172691214 20:36791570-36791592 TACCACTCCCAGCCATAGACTGG + Intronic
1173313833 20:41925467-41925489 GACCTTTCCTGGCCACAGTCTGG + Intergenic
1174106577 20:48166446-48166468 ATCCTATCCCAGCCAGAGCCTGG + Intergenic
1174322496 20:49752979-49753001 AGCCTTTCCTGGCCACAGGCAGG + Intergenic
1174390023 20:50213310-50213332 AACCTTACCCAGCCACTTCCCGG - Intergenic
1174564696 20:51456557-51456579 AACAGATCCCAGCCACAGCCAGG + Intronic
1176366187 21:6034234-6034256 CACATTCCCCAGCCACAAACGGG - Intergenic
1176431274 21:6577912-6577934 AAACATTCCCATCCACAGCCAGG - Intergenic
1179706668 21:43185374-43185396 AAACATTCCCATCCACAGCCAGG - Intergenic
1179757330 21:43504311-43504333 CACATTCCCCAGCCACAAACGGG + Intergenic
1181117194 22:20639576-20639598 CACCTTGCTCAGCCACAGTCAGG + Intergenic
1181736189 22:24883518-24883540 CACCTTTCTCAGCCTCAGTCAGG - Intronic
1181772676 22:25137799-25137821 AAACTTTCCCAGCTGCAGGCAGG - Intronic
1182422992 22:30257580-30257602 AACCTGTGTCAGGCACAGACTGG - Intergenic
1183011572 22:34951106-34951128 AACCTTTCAAAGTCACAGAGCGG + Intergenic
1183428166 22:37750681-37750703 AACCTTCCACAGCCACAGTCGGG - Intronic
1183687398 22:39368994-39369016 AACCTCTCCGAGCCTCAGATTGG - Intronic
1184904227 22:47469274-47469296 AACCTATCCCAGGCACATTCAGG - Intronic
1185145401 22:49132284-49132306 AACATTTCCCTTCCAGAGACTGG - Intergenic
951109096 3:18780286-18780308 AACTTTTCCCAGCCCAAGCCTGG - Intergenic
953568980 3:44056836-44056858 GGCCTCTCCCAGCCACAGATGGG - Intergenic
954618126 3:51980662-51980684 AACCCCCCCAAGCCACAGACAGG - Intronic
954710400 3:52502576-52502598 AGCCTCTCCCAGGCACACACTGG - Intronic
955064135 3:55520101-55520123 AACTTTTCCAGGCCACATACAGG - Intronic
958758985 3:98284798-98284820 CACCTTTCGCAGCCACCCACTGG - Intergenic
961335965 3:126180022-126180044 GACCTTTCCCTGTCACAGAATGG + Intronic
961453245 3:127012036-127012058 AACCTGCCACAGCCACAGTCAGG + Exonic
962285131 3:134078940-134078962 AACCTTTCCCAGCCACAGACTGG + Intronic
963296177 3:143549119-143549141 AACCTTTCCCAGTTTCAGAAGGG + Intronic
965044554 3:163559750-163559772 AATAATTCCCAGCCCCAGACTGG + Intergenic
967730528 3:192902799-192902821 AACTCCTCCCAGCCACAGGCCGG + Intronic
977961736 4:103093161-103093183 ATCCTTCCCCTGCCAGAGACTGG + Intronic
978334397 4:107649996-107650018 AATCCTTCCCAGCTACAGAATGG + Intronic
981027833 4:140094458-140094480 AACCATGGCCAGCCACACACAGG + Intronic
984041756 4:174743987-174744009 CACCACTCACAGCCACAGACCGG - Intronic
985227642 4:187780173-187780195 AACCTTTGCCAGCCACAAATAGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986488627 5:8266513-8266535 TACCTCTCCCACCTACAGACAGG + Intergenic
987116594 5:14730944-14730966 AACCTCTCCCTGGCACAGACAGG - Intronic
991084408 5:62635397-62635419 AGACTTTCTCAGACACAGACAGG - Intergenic
994058371 5:95445882-95445904 CTCCTCTCCCAGCCACATACCGG + Intronic
996350783 5:122539089-122539111 AACCTTACTCAGCCACACCCAGG - Intergenic
997883687 5:137612432-137612454 AATCTTTCTGAGCCACAAACTGG - Intergenic
998902637 5:146872270-146872292 AACATTTCCCATCCCCAGAAAGG + Intronic
999573595 5:152948177-152948199 AACTTTTCCCAGGGACAGACAGG + Intergenic
1001382707 5:171314799-171314821 AGCCTTGCCCAGCCAGAGACGGG + Intergenic
1003684841 6:8292261-8292283 AAGCTAACCAAGCCACAGACTGG - Intergenic
1004184236 6:13408207-13408229 AACCTTTGCCTGCCATAGTCTGG - Intronic
1007728676 6:43932589-43932611 CCCCTTTCCCAGTCACAGCCAGG - Intergenic
1008295377 6:49769319-49769341 AGCCTATCCCAGCCACAGAAGGG + Intergenic
1009734972 6:67663846-67663868 AACCTCTCCCACCCAGAAACTGG - Intergenic
1010245612 6:73659258-73659280 TTCCTTTCCCATCCAAAGACAGG - Intergenic
1015557679 6:134479901-134479923 AATTTTTACCAGCCACATACAGG + Intergenic
1017031130 6:150223097-150223119 AACATTTAGCAGCTACAGACTGG + Intronic
1017791773 6:157805963-157805985 AATTTTTCCCGGCCACAGGCTGG + Intronic
1019041734 6:169111438-169111460 AGCCTTTCTCTGCCACAGTCTGG + Intergenic
1019265151 7:111014-111036 AATCTTCCCCAGCCACCCACGGG + Intergenic
1021579948 7:22141893-22141915 TAGGTTTCCCAGTCACAGACTGG - Intronic
1022534355 7:31086545-31086567 AACCTGTCCAAGCCACAGCCAGG - Intronic
1022929201 7:35093179-35093201 TCCCTTTCCCAGTCAAAGACAGG + Intergenic
1023626050 7:42116054-42116076 ACCCTTTCCAAGCAACAGAGTGG + Intronic
1024800186 7:53068167-53068189 AAACCCTCCCAGCCACATACTGG - Intergenic
1025773948 7:64541745-64541767 AACTCCTCCCAGCCACAGTCTGG + Intronic
1025816758 7:64920544-64920566 AACTCCTCCCAGCCACAGTCTGG - Intronic
1025866920 7:65390906-65390928 AACTTCTCCCAGCCACAGTCTGG - Intronic
1026582957 7:71633254-71633276 AACCTTCCCAACCCACAGCCGGG - Intronic
1026888350 7:73967596-73967618 AAGCTCACCCAGCCACAGAGTGG - Intergenic
1032475841 7:132211043-132211065 AACCTCCCCCAGCCCCAGTCTGG - Exonic
1035057138 7:156043272-156043294 CAAACTTCCCAGCCACAGACAGG + Intergenic
1036613853 8:10373523-10373545 TACCTTGCCCAGCTACTGACTGG + Intronic
1037986236 8:23292314-23292336 CACCGTGCCCAGCCACAGAAAGG - Intronic
1041691659 8:60693519-60693541 AACCTTGCCCTGCCCAAGACAGG - Intronic
1042268439 8:66932192-66932214 CACCATGCCCAGCCACAAACAGG - Intergenic
1045145754 8:99341922-99341944 AAACTCTCCCAGCCCCAGTCGGG - Intronic
1047301511 8:123617510-123617532 AACCATTCCAAGGTACAGACTGG - Intergenic
1048533809 8:135274153-135274175 AACCTTACCCACCCACACATGGG + Intergenic
1048878072 8:138852224-138852246 ACCCTTTCCCTGTCACAGCCGGG - Intronic
1049509444 8:143020006-143020028 CCCATTTCCCAGCCACAGAATGG + Intronic
1049811610 8:144576877-144576899 AACTTCTCCCAGCCAGAGACGGG - Intronic
1050893909 9:10860423-10860445 AACCTTTCCCATCTACAGTGGGG - Intergenic
1050990805 9:12149385-12149407 AACCATACCCAGCCACAATCTGG - Intergenic
1055067166 9:72130706-72130728 ACCCTTTCCAAGCCTTAGACTGG - Intronic
1056597052 9:88016260-88016282 CCCCTTTCCCAGCCCCAGCCCGG + Intergenic
1056808095 9:89744153-89744175 AACCTTGCCTACCCACAGAAAGG - Intergenic
1057189116 9:93076443-93076465 AACCATTGCCTCCCACAGACTGG - Intronic
1058741012 9:107942365-107942387 TACCTTACCCAGGCAAAGACTGG + Intergenic
1060888690 9:127174638-127174660 AGCTTTTCCCAGCCCCAAACAGG + Intronic
1061395485 9:130341400-130341422 CAGCTCTCCCAGCCACAGCCTGG + Intronic
1062313098 9:135950081-135950103 AATCTTCCCCAGCCTCAGAAAGG + Intronic
1186454523 X:9700663-9700685 AACCTGCCACAGCCACAGAAAGG - Intronic
1188994549 X:36867140-36867162 AACATTTCCTAGCCAGATACAGG + Intergenic
1189960228 X:46317282-46317304 AACTGTTCCCAGCCTCAGCCTGG - Intergenic
1190126778 X:47712641-47712663 CAACTTTCACAGCCACAGAGTGG + Intergenic
1190574296 X:51817437-51817459 AATATTTACCAGTCACAGACCGG - Intronic
1190738561 X:53272150-53272172 GACCTGTACCAGCCCCAGACAGG + Intronic
1191049699 X:56178003-56178025 TCCCTTTCCCAGCCAAAGAAAGG - Intergenic
1193382716 X:80834468-80834490 AACATTCCCCAGCAACAGTCTGG + Intergenic
1196699520 X:118652978-118653000 AAACTTTCCCAGCCTGAGAGCGG - Intronic
1200108478 X:153726904-153726926 AACCTTTCCCAGCGCCTGTCTGG - Intronic
1200163726 X:154022170-154022192 CACCTCTCCCAACCTCAGACAGG + Intronic
1201455884 Y:14166399-14166421 ACCCTTTTCCAGCCACTCACTGG + Intergenic
1201509744 Y:14745995-14746017 ATCCTTGGACAGCCACAGACAGG + Intronic