ID: 962285597

View in Genome Browser
Species Human (GRCh38)
Location 3:134083697-134083719
Sequence GTTGATTCACTTGAAAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962285597 Original CRISPR GTTGATTCACTTGAAAAGAT TGG Intronic
904033170 1:27545815-27545837 GTAAATTTCCTTGAAAAGATGGG + Intronic
905693385 1:39958413-39958435 GTGGATTCATTTGAATTGATGGG + Intronic
906371204 1:45255426-45255448 GTTAATTCATTTGAATAGTTGGG + Intronic
908756813 1:67476434-67476456 ATTGATTTATTTGAAAAAATTGG + Intergenic
909067473 1:70952783-70952805 GTTGATTGACTCGGAAAGGTGGG - Exonic
909370187 1:74874507-74874529 GTTGCTGAACTTGAAAAGCTAGG + Intergenic
909406088 1:75291209-75291231 TTTGATTCACATTAGAAGATAGG + Intronic
912183543 1:107247862-107247884 CTGGCTTCACTTGAAAAGGTGGG - Intronic
912621684 1:111166355-111166377 GTTCAATCACTTAAAAAGTTTGG - Intronic
915749387 1:158191603-158191625 GTTAATTCACTTTAAAAGTGGGG - Intergenic
915808880 1:158885773-158885795 GTTGTTTCAATTGAAATGAAAGG - Intergenic
919592084 1:199516813-199516835 GATGAAGCACTTGAAAAGCTAGG + Intergenic
922323245 1:224505945-224505967 GTTATTTCTCTTGAAATGATTGG + Intronic
922850530 1:228730026-228730048 CATGTTTCACTAGAAAAGATGGG - Intergenic
1065552784 10:26886442-26886464 GTTTATTCAAATGAAAAGCTGGG - Intergenic
1066706270 10:38182320-38182342 TTTGATTCACATGTAAATATAGG - Intergenic
1066983684 10:42443786-42443808 TTTGATTCACATGTAAATATAGG + Intergenic
1067915836 10:50397101-50397123 GATGATTCATTTGAAGAGAATGG - Intronic
1069965100 10:72108589-72108611 GTTTATTCAAGTGAAAAGCTGGG - Intronic
1070985934 10:80689921-80689943 GTTGATTCAGTGGAGAACATTGG + Intergenic
1071034107 10:81222625-81222647 GTTGTTTCACTTGAGAAAAATGG - Intergenic
1071159805 10:82732578-82732600 GTTTCTTCAGTTGAAAAGCTGGG + Intronic
1071310013 10:84334374-84334396 GTCAATTCACTTAAAAAGAAAGG - Intronic
1073564157 10:104521073-104521095 GTTGCTTCACTTCAAGAGCTTGG - Intergenic
1074876006 10:117613876-117613898 GTTGAATGACTTGATAAGTTAGG - Intergenic
1075474715 10:122724225-122724247 GGTGATTCACATGAAAAGTGAGG + Intergenic
1076002894 10:126926532-126926554 GTTGAGTCCCCTGAAAAGACAGG + Intronic
1077917350 11:6619968-6619990 GTTGATTTCCTTGAAAACCTTGG - Intergenic
1080370782 11:31639935-31639957 ATTGATACATTTGAAAAGTTTGG - Intronic
1081013994 11:37853210-37853232 ATTGATTCAATTTAAAATATAGG - Intergenic
1082986413 11:59173665-59173687 CTTGATTCTCATGAAAAGATAGG - Intronic
1083499955 11:63095952-63095974 GATGATTCACTTTAAAATATTGG - Intronic
1083921873 11:65785784-65785806 CTGGATTCACCTCAAAAGATAGG + Intergenic
1085153095 11:74267907-74267929 GTTTATTCACCTGACCAGATAGG - Intronic
1085237339 11:75025290-75025312 GTTGATTTTCCAGAAAAGATGGG + Intergenic
1085474034 11:76778207-76778229 GTTAATTCACTTTACAACATAGG - Intergenic
1086230242 11:84560216-84560238 GTTGCTTCATTTGAGAACATTGG - Intronic
1086482223 11:87254568-87254590 GTTGAATAACTTTTAAAGATGGG - Intronic
1086540025 11:87898079-87898101 GTTTATTCACCTGAAGAGTTGGG - Intergenic
1088882884 11:113985579-113985601 CTTAATTCACTTTTAAAGATAGG + Intronic
1089641509 11:119850711-119850733 AATGATTCACTTTAACAGATGGG + Intergenic
1089984626 11:122801635-122801657 GATGATGCAGTTGAGAAGATTGG + Intronic
1090838106 11:130468246-130468268 GGTGCTTCACTTGCAAAAATGGG - Intronic
1090917607 11:131179764-131179786 GTTTTTTCACTTGTAAAAATAGG + Intergenic
1092807003 12:12233531-12233553 GTTGACTTAATTGAAAAGACTGG - Intronic
1095888115 12:47209592-47209614 GTTGATACACTTTAAATGCTTGG + Intronic
1101239672 12:102825207-102825229 GTTGAATCTCTTGAAATGAATGG + Intergenic
1101477845 12:105067393-105067415 AGTGATTCACTGGAAATGATAGG + Intronic
1104581477 12:130014284-130014306 CTGGATTCACTTAGAAAGATGGG + Intergenic
1106800485 13:33251369-33251391 AGTGATTCACTTGGAAAGAGGGG - Intronic
1107063433 13:36186575-36186597 GTCTATTCACTTGAGAAGAAGGG - Intronic
1108180479 13:47835430-47835452 GATTATTCAATAGAAAAGATGGG + Intergenic
1108784054 13:53872928-53872950 GTTTATTCACTAGTAAAGCTAGG + Intergenic
1109178309 13:59182538-59182560 GTTGTCTCACTTGAAAAAAGGGG + Intergenic
1110146331 13:72195118-72195140 GTTAATTGATTTGAAAACATAGG + Intergenic
1111084758 13:83360876-83360898 TTTAATTAACTTGAAAAGATTGG + Intergenic
1113354372 13:109564429-109564451 GTTGATAAACATGAAAACATGGG - Intergenic
1115259148 14:31435490-31435512 GTTGATTCACATTCAGAGATTGG - Intronic
1117243717 14:53862146-53862168 GTTCATTCACTTCAAAACCTTGG + Intergenic
1122727282 14:103765805-103765827 GTTTATTCACTTTCAGAGATGGG + Intronic
1127238131 15:57078649-57078671 CTAGATTGACATGAAAAGATAGG + Intronic
1127506947 15:59607037-59607059 GTTGTTTTATTTTAAAAGATAGG + Intronic
1131494274 15:92891448-92891470 GTTGGTTTAGTTGAATAGATTGG + Intronic
1132001943 15:98189316-98189338 GTTCATTCATTTGGAAAGGTGGG + Intergenic
1133947726 16:10363238-10363260 GTTTATTCAAGTGAAAAGCTGGG + Intronic
1139186340 16:64810275-64810297 CTTAATTTACTTGAAAGGATAGG - Intergenic
1140807713 16:78548253-78548275 GTTGATTCTCTTCAAAAACTTGG + Intronic
1141230104 16:82159096-82159118 GGTGATACAGTTGAAAAGAGAGG - Intronic
1141351300 16:83300302-83300324 GTTGAGTGACATGAAGAGATAGG + Intronic
1141611663 16:85184920-85184942 ATTAATTAACTTGAAGAGATTGG + Intronic
1144543532 17:16169906-16169928 GATGATTCACATGATAAGGTGGG + Intronic
1144702920 17:17350583-17350605 TGTGATTCATTTGAAAATATTGG + Intergenic
1147749205 17:42718099-42718121 GTCTATCCACTTGACAAGATGGG + Intronic
1149026041 17:52028599-52028621 GTTGCATCACTTGCAAATATTGG + Intronic
1149977486 17:61280674-61280696 GTGTATTCACATGAAAAGATTGG + Intronic
1156173890 18:34519745-34519767 GTTGCTTCAATTGAAAACTTGGG - Intronic
1157297037 18:46452978-46453000 GATGATGCACTTGAACAGCTTGG + Intronic
1157899032 18:51495742-51495764 CTTGATTCACTTGAGTGGATAGG + Intergenic
1158322175 18:56275629-56275651 GTTGCTTCATTAGAAAAGAATGG + Intergenic
1160337780 18:78058039-78058061 GTTGAGTCACTTGAAGAGCATGG - Intergenic
1162641510 19:12014112-12014134 GTTTATTCAAGTGAAAAGCTGGG - Intergenic
925028200 2:626065-626087 GTTGATGCACTTGAAGAAAAGGG - Intergenic
925480636 2:4269698-4269720 ATATATTCACATGAAAAGATGGG + Intergenic
926652064 2:15357533-15357555 GTTTATTCATTTGAAGAGACAGG + Intronic
926923782 2:17965998-17966020 GGTGATTTACTTGAAAAAAAAGG - Intronic
928739244 2:34330709-34330731 TTTGAATCACTTGAAAATAGCGG - Intergenic
930594412 2:53368690-53368712 GATAATTGACTAGAAAAGATGGG + Intergenic
931320185 2:61168271-61168293 GGTGTTTCACTTGCAAAGGTGGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
933558590 2:83863494-83863516 GCTTATTCACTTGAAAAGGAGGG + Intergenic
934610261 2:95730265-95730287 CTAGAATCACTTGAAAAGATTGG - Intergenic
935294919 2:101640494-101640516 GGTGATTCACTTGAGAAGAAGGG + Intergenic
936543588 2:113371850-113371872 CTAGAATCACTTGAAAAGATTGG - Intergenic
936697034 2:114963288-114963310 TTTGATAAACTTGAAAAGAGAGG + Intronic
937102841 2:119284831-119284853 ATTTATTCACATGAAATGATGGG - Intergenic
939625751 2:144474857-144474879 GTTTATTAACTTGATAACATTGG + Intronic
941439212 2:165512797-165512819 GTTTCTTCTCTTAAAAAGATAGG + Intronic
942625781 2:177898973-177898995 GTTTATTCAAGTGAAAAGCTGGG - Intronic
943403333 2:187445933-187445955 GTTCATTCACTTTGAAAAATTGG - Intronic
944872397 2:203927303-203927325 GTTGAACCACTTGAGAAGAGGGG - Intergenic
945055816 2:205868023-205868045 GTTGATTGAAATGAAAAGACTGG + Intergenic
946547217 2:220757361-220757383 GTTGATTCACTTGATAACCTAGG + Intergenic
947087443 2:226471250-226471272 ATTGTTTCACTTGGAAAGTTGGG - Intergenic
947191524 2:227511064-227511086 ACTGATTCACTTGATAATATAGG - Intronic
1169170519 20:3461056-3461078 GTTTATTCAGTAGAAAAGAGAGG - Intergenic
1173305675 20:41846203-41846225 AGGGATTCACATGAAAAGATAGG - Intergenic
1174915919 20:54653901-54653923 GTTGATTTTCATGAGAAGATGGG - Intergenic
1175663806 20:60840872-60840894 GTTGATTCACTTAATAACATAGG - Intergenic
1178766496 21:35457754-35457776 GTTGATTCACTTTACAGGATGGG - Intronic
1181710945 22:24688145-24688167 GTTGAATGAGTTCAAAAGATTGG - Intergenic
1181983842 22:26785395-26785417 GTGCATTAACTTGAAAAGAATGG - Intergenic
1183866681 22:40709804-40709826 GTTGATAGGCTTGAAAGGATAGG + Intergenic
949461152 3:4296326-4296348 TTTTGTTCACTTTAAAAGATGGG - Intronic
949614105 3:5735243-5735265 GTTGATACAATTTAAAAAATTGG + Intergenic
949894224 3:8757480-8757502 GTTGAATCACTTGGCAAGAAAGG + Intronic
949999674 3:9647310-9647332 GTTGATTTTCTTGTAGAGATGGG + Intergenic
952052041 3:29395637-29395659 AATGATTCACTTGAAAACAATGG - Intronic
952164331 3:30730104-30730126 CTGCATTCACTTGAAAAGAGTGG + Intronic
952283327 3:31944730-31944752 GTTGCTTCACATGAAAAGAGTGG + Intronic
955719660 3:61867529-61867551 ATTTATTAACTTGAAAAAATAGG + Intronic
956453110 3:69393376-69393398 GTTGATTAACTAGTAAAAATGGG - Intronic
958088582 3:88846065-88846087 ATTGCTTCACTTAAAAAGATTGG - Intergenic
958097595 3:88966773-88966795 GTTTATTCACCTGAAAATGTAGG + Intergenic
959615296 3:108340568-108340590 TTTGATGCATTTGAACAGATGGG - Intronic
960235455 3:115276959-115276981 GTTAATTCAATGGAAAAGAAAGG - Intergenic
962285597 3:134083697-134083719 GTTGATTCACTTGAAAAGATTGG + Intronic
962842111 3:139243511-139243533 ATTGATTCAGTTGAAAGGATAGG + Intronic
963727467 3:148938234-148938256 GTTGTTTCATTTGGAATGATCGG + Intergenic
964312227 3:155406181-155406203 GTTTATTCAAGTGAAAAGCTGGG - Intronic
968352011 3:198065562-198065584 GTTTATTCATTTGAAAATATTGG - Intergenic
970250985 4:14115856-14115878 GTGTATTCACATGAAAAGCTGGG + Intergenic
970832810 4:20362671-20362693 GTTTATTCACTTAAAAAGTAAGG + Intronic
973347721 4:49074458-49074480 GTTGCATCACTGGAAAACATGGG - Intergenic
973543225 4:51955015-51955037 GTTTCTTCACGTGAAAAGCTAGG + Intergenic
975800056 4:78051683-78051705 GTTCTTTCAGTTGAATAGATAGG + Intergenic
977923917 4:102677233-102677255 GTTGTTTTTCTTGAAATGATAGG - Intronic
980559075 4:134448275-134448297 GTCGATTGACTTGAAATTATAGG - Intergenic
980689169 4:136270779-136270801 CTTGATACACTTTAAAAAATCGG + Intergenic
981660355 4:147158854-147158876 GTTCAGTGAATTGAAAAGATTGG + Intergenic
983610905 4:169643902-169643924 GTTGTTTTACTTGAAAAGACAGG + Intronic
989025895 5:37067704-37067726 TTATATTGACTTGAAAAGATAGG + Intergenic
990388784 5:55296950-55296972 ATTCTTTCACTTGAAAAAATGGG + Intronic
994971029 5:106737393-106737415 CTTGATTCAATTGAAATGATAGG + Intergenic
996508679 5:124295199-124295221 ATAGATTCTTTTGAAAAGATAGG + Intergenic
996771450 5:127090693-127090715 GTTGGTTCACTTGGAAATGTGGG - Intergenic
996951564 5:129132780-129132802 GTTTATTCACTGGAAAAATTTGG - Intergenic
996976854 5:129445151-129445173 GTTGAAACACCTGAAAAGATGGG - Intergenic
997008243 5:129845990-129846012 GATGATACACATGAAAAAATAGG + Intergenic
1000105957 5:158059003-158059025 GTTGGCTGACTTGAATAGATGGG - Intergenic
1000345418 5:160310250-160310272 GTTGGTTCAGTTGAAAAGCAAGG - Intronic
1005392665 6:25349579-25349601 GTGGCTTCTCTTTAAAAGATTGG + Intronic
1006329978 6:33383463-33383485 GTTTATTAACACGAAAAGATTGG + Intergenic
1008028002 6:46660145-46660167 ATTGATTCTCTTGGAAAGAGTGG + Intronic
1008028490 6:46666004-46666026 ATTGATTCTCTTGCAAAGAGTGG + Intronic
1008296065 6:49779203-49779225 GTTGACTAATTTGACAAGATGGG - Intergenic
1008812728 6:55524626-55524648 GTTGCTTCACTTGAAGTAATAGG + Intronic
1009924996 6:70109886-70109908 GTTGAGTCAGTTGAACAGTTGGG + Intronic
1010211046 6:73363141-73363163 CTTGATTCACGTGAATCGATTGG + Exonic
1010363807 6:75026537-75026559 GCTGACTCACCTGAAAACATGGG + Intergenic
1010907076 6:81503751-81503773 GTTAATTCACTTAAAATAATTGG - Intronic
1011415971 6:87120454-87120476 GTGGATTCACTGGACTAGATGGG + Intergenic
1013008261 6:106095542-106095564 ATTTATTTAATTGAAAAGATTGG + Intronic
1015326533 6:131929795-131929817 GTTGATTCAATTTGAAAAATGGG + Intergenic
1015903315 6:138090045-138090067 GTGGTATCACTTTAAAAGATGGG + Exonic
1023706666 7:42948499-42948521 GTTTATTCAACTGAAAAGCTGGG - Intronic
1025109736 7:56203966-56203988 GTTGATGGTCTTGCAAAGATTGG + Intergenic
1027873370 7:83738823-83738845 TTTGATTAACTTAAAAAGAGGGG - Intergenic
1032205141 7:129857004-129857026 GTTGATTCCCTGTAAGAGATGGG + Intronic
1032356070 7:131211744-131211766 GTTGTTTCTTTTTAAAAGATGGG + Intronic
1039028901 8:33288121-33288143 GTTCCTTCAGTTGAAAAGAGGGG - Intergenic
1041793150 8:61717568-61717590 TTTGATTTCCTTAAAAAGATAGG - Intergenic
1042505857 8:69559559-69559581 ATTGTTTCCCTTGAAATGATAGG + Intronic
1042538274 8:69881242-69881264 GTTGATTTTCTTGAAAAGATAGG - Intergenic
1043122193 8:76340543-76340565 GTGGAATCACATGAAAAGTTTGG + Intergenic
1043199444 8:77346697-77346719 TTGGATTAACTTCAAAAGATAGG - Intergenic
1043389200 8:79775532-79775554 GTTGTTTCACTTAAAGAGAATGG + Intergenic
1043944705 8:86236669-86236691 GTTGTTTCATTTGAAAAGCACGG + Intronic
1045097954 8:98817636-98817658 GTTGTTTCAATTCAAAACATAGG + Intronic
1046101821 8:109623159-109623181 TGTGATCCACTTGAAAATATGGG + Intronic
1046319444 8:112552760-112552782 GTAGATTGTTTTGAAAAGATTGG - Intronic
1047874933 8:129125591-129125613 GTTTATTCATTTCAAAATATTGG - Intergenic
1048288760 8:133163750-133163772 GTTGATTGAGTTGTAAAGAAGGG + Intergenic
1051030526 9:12669987-12670009 GTTTCTTCACTTGCAACGATTGG + Intergenic
1052874227 9:33541395-33541417 GTTTATTCATTTGAAAATATTGG + Intronic
1053501815 9:38602970-38602992 GTTTATTCATTTGAAAATATTGG - Intergenic
1055065220 9:72111893-72111915 CTTGATTCATTTGAGGAGATTGG + Intergenic
1055852373 9:80647567-80647589 ATTTATTATCTTGAAAAGATTGG - Intergenic
1057154279 9:92826746-92826768 GTTTGTTCATTTGAAAATATTGG + Intergenic
1057681197 9:97187264-97187286 GTTTATTCATTTGAAAATATTGG - Intergenic
1060276542 9:122187025-122187047 GTTTCTTCACCTGAAAAAATGGG + Intronic
1061773136 9:132943606-132943628 GTTTCTTCATTTGAGAAGATTGG + Intronic
1186635886 X:11404393-11404415 GAGGATTGACTTGAATAGATTGG - Intronic
1188286798 X:28336459-28336481 GTTTCTTCACTGGAAAAGTTCGG - Intergenic
1188313747 X:28648757-28648779 GTTGATTCTATTGAAAAGTTGGG + Intronic
1188959930 X:36478871-36478893 ATGGATTCCCTTGAAAAGTTGGG - Intergenic
1189135497 X:38545165-38545187 GTAGCTTCACATGGAAAGATAGG + Intronic
1189884721 X:45530157-45530179 GTGGATTCATTTGAAATGGTGGG - Intergenic
1194109431 X:89814559-89814581 GTTGGCTGACTTGAAAAGACAGG + Intergenic
1194861484 X:99004027-99004049 TTTAATTCACTTCAAAATATGGG - Intergenic
1194899780 X:99496574-99496596 CTAGATTCACTTTAAAAGATAGG + Intergenic
1197453625 X:126649314-126649336 TTTAATTGCCTTGAAAAGATAGG - Intergenic
1200385117 X:155882384-155882406 GGTGGTTGACTTGAAAGGATGGG + Intronic
1200462097 Y:3469301-3469323 GTTGGCTGACTTGAAAAGACAGG + Intergenic
1200623763 Y:5486198-5486220 GTTGGTTCAGTTGAAAATAATGG + Intronic