ID: 962286653

View in Genome Browser
Species Human (GRCh38)
Location 3:134092104-134092126
Sequence CTCGGACCTGTTCTCTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962286652_962286653 -10 Left 962286652 3:134092091-134092113 CCATGTAGCTGTGCTCGGACCTG 0: 1
1: 0
2: 2
3: 16
4: 118
Right 962286653 3:134092104-134092126 CTCGGACCTGTTCTCTGTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 94
962286650_962286653 -8 Left 962286650 3:134092089-134092111 CCCCATGTAGCTGTGCTCGGACC 0: 1
1: 0
2: 1
3: 7
4: 67
Right 962286653 3:134092104-134092126 CTCGGACCTGTTCTCTGTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 94
962286651_962286653 -9 Left 962286651 3:134092090-134092112 CCCATGTAGCTGTGCTCGGACCT 0: 1
1: 0
2: 1
3: 3
4: 97
Right 962286653 3:134092104-134092126 CTCGGACCTGTTCTCTGTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962286653 Original CRISPR CTCGGACCTGTTCTCTGTTC TGG Intronic
900793226 1:4692866-4692888 CTCAGCCCTGTGCTCTGTGCTGG + Intronic
904111391 1:28129089-28129111 CACGGACTTGTTCTCTGCCCTGG + Intergenic
906124853 1:43421501-43421523 CTGCCACCTGTGCTCTGTTCAGG - Intronic
906642096 1:47447303-47447325 CTTGGACCTGTTCTCTGGCCTGG + Intergenic
911030209 1:93479433-93479455 GTCAGACCAGTTCTCTGCTCTGG - Intronic
912515689 1:110215315-110215337 CTCGTACCTGTTCCCAGCTCAGG - Intronic
913996727 1:143656811-143656833 GTCAGACCGGTTCTCTGCTCTGG - Intergenic
915789116 1:158648565-158648587 CTCAGATCTGTTCAGTGTTCAGG - Exonic
918600124 1:186348377-186348399 GTCAGACCGGTTCTCTGCTCTGG + Intronic
919207060 1:194431462-194431484 CTCGGCCTTGTTGTCTGCTCTGG - Intergenic
921413261 1:214859497-214859519 CGTGGACCTGTTTTCTGTGCGGG + Intergenic
923784576 1:237054922-237054944 CTCTGCCCTGTTCTATGTTCAGG + Intronic
923790691 1:237108528-237108550 CTCAGCCCTGTTCTCTGTTTTGG - Intronic
1062898293 10:1121746-1121768 CTAGGACCTGATGTCTGGTCGGG - Intronic
1064789402 10:18938780-18938802 ATGGGACCTTTTCTCTTTTCTGG - Intergenic
1065630726 10:27678223-27678245 CCTTGACTTGTTCTCTGTTCTGG - Intronic
1067898339 10:50210754-50210776 CTGGGTTCTGTTCTCTGATCAGG - Intronic
1073372977 10:103007364-103007386 GTCAGACCGGTTCTCTGCTCTGG - Intronic
1073692329 10:105823439-105823461 CTCTGACCTTTCCTCTTTTCAGG + Intergenic
1076342242 10:129757362-129757384 CTCGGAACTGCTCTGTGCTCCGG + Intronic
1077168480 11:1154153-1154175 CTCAGGCCTGTCCTCTGTTGGGG + Intergenic
1077844702 11:6012587-6012609 CTCGATCCTCTTCTCTGCTCTGG + Intergenic
1082726944 11:56747561-56747583 CTAGGAACTGTTCTTTGTGCTGG - Intergenic
1084953789 11:72680763-72680785 CTCAGACCTGTTTTCTCCTCCGG - Intergenic
1085054374 11:73395263-73395285 CTCGGCCTTGTTCTCTGCTGGGG - Exonic
1094647220 12:32337470-32337492 CTCTGACCACTTCTCTGTTTTGG + Intronic
1101208790 12:102515182-102515204 CTAGGAACTGTGCTCTGTCCAGG + Intergenic
1101364164 12:104056083-104056105 CTTGGCCCAGTTCCCTGTTCTGG + Intronic
1105705630 13:22966044-22966066 CTCGGGCCTGCTCTCGGTCCAGG - Intergenic
1105858532 13:24391029-24391051 CTCGGGCCTGCTCTCGGTCCAGG - Intergenic
1108633490 13:52309981-52310003 GTCGGACCTGTTGTCTGCTCTGG - Intergenic
1110468282 13:75827971-75827993 CTAGGACCTGCTCTCTGTAAGGG + Intronic
1114370249 14:22078614-22078636 CTGGGAACTGTTTTCTGTTTGGG + Intergenic
1116403959 14:44545312-44545334 CTGGCACCTGTGCTCTCTTCTGG - Intergenic
1117693597 14:58335978-58336000 CTCCAATCTGTTCTCTGTACTGG + Intronic
1120797080 14:88645849-88645871 CTAGCCCCTCTTCTCTGTTCAGG + Intronic
1121845130 14:97165960-97165982 GTCCTAACTGTTCTCTGTTCTGG + Intergenic
1136873219 16:33827022-33827044 CTGGGTCCTGCTCTCTCTTCAGG + Intergenic
1137883719 16:52079497-52079519 CTCAGACTTGTACTCTGTTTAGG - Intergenic
1142358323 16:89614378-89614400 CCCGGACTTACTCTCTGTTCTGG + Intronic
1203098953 16_KI270728v1_random:1289033-1289055 CTGGGTCCTGCTCTCTCTTCAGG - Intergenic
1143393382 17:6573639-6573661 CTCTGACCTGGTCACTGTGCTGG + Intergenic
1147596814 17:41723135-41723157 CTGGGCCCTGTTCCCTGCTCAGG + Exonic
1147911282 17:43857737-43857759 CTGGGTCCTGTTCTCTGTTTGGG - Intronic
1154331542 18:13433242-13433264 CTAGAACCTGCTCTCTGTACGGG - Intronic
1167478313 19:49713398-49713420 CTCTGACCTGTTCTCCTTCCAGG + Exonic
929737809 2:44568856-44568878 CTCGTTCCTGTTCTGTGGTCTGG - Intronic
935100424 2:99989457-99989479 CTCAGCCCTGTATTCTGTTCTGG - Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
936868885 2:117109595-117109617 CTTGCACCTGTACTCTCTTCTGG + Intergenic
940325827 2:152423971-152423993 CTGGGACCTTTTCTTTGTTTAGG + Intronic
942483974 2:176419755-176419777 CTCAGACCTGCCCTCTCTTCCGG - Intergenic
945139203 2:206666029-206666051 CTCAAATCTGTTCTCTTTTCAGG - Exonic
947968107 2:234299435-234299457 CTCAGCTCTGTTCTCTGCTCAGG + Intergenic
1170394735 20:15914195-15914217 CTGGGACCGATTCTCTGTCCAGG - Intronic
1171424219 20:25039539-25039561 CTCGGCCCTGTCCTCCATTCTGG - Intronic
1172064364 20:32208428-32208450 CCGGGCCCTGTTCTCTGTACTGG + Intronic
1172609757 20:36241440-36241462 ATTGGACCAGTTCTCTGTTATGG + Intronic
1172649611 20:36493468-36493490 CTCAGAACTCTCCTCTGTTCCGG - Intronic
1176008395 20:62879358-62879380 CTCGGTCCCGCTCTCTGCTCCGG + Exonic
1178437053 21:32569385-32569407 CTCGGCTCTGTCCTCCGTTCCGG - Intergenic
1179590878 21:42407123-42407145 CATGGGCCTGTTCTCTGCTCTGG + Intronic
1179898307 21:44375735-44375757 CTGGGACCTGGTCTCTGTGAGGG + Intronic
1180156985 21:45982641-45982663 CGTGGACCTGTTCTTTGTGCTGG + Exonic
1181422483 22:22811472-22811494 CTCTGACCTGTGGTCTGTCCTGG - Intronic
1183953807 22:41367584-41367606 CTCCTACCTGTTCTCTTCTCTGG - Intronic
949524685 3:4891528-4891550 CTTGGAAATGTTCTCAGTTCTGG + Intergenic
950834505 3:15906182-15906204 CTCTGCCCTTTTCTGTGTTCAGG - Intergenic
951847511 3:27100601-27100623 CTTGGCCGTGTTCTTTGTTCCGG - Intergenic
955506762 3:59640270-59640292 CTTTGACTTGTTCTCTGTTGCGG - Intergenic
955750316 3:62179923-62179945 CTCCTACTTGTTCTCTGCTCTGG - Intronic
957356841 3:79099958-79099980 CTAGGTCCTATTCTCTATTCTGG + Intronic
957889753 3:86341168-86341190 CTCCAAACTGTTCTCTGTACTGG + Intergenic
958590638 3:96154473-96154495 CCCTGATCTGTTCTCTGTACTGG + Intergenic
961442283 3:126960174-126960196 CTCTGACCTGTTCTCTTTGTAGG + Exonic
962286653 3:134092104-134092126 CTCGGACCTGTTCTCTGTTCTGG + Intronic
980600522 4:135018878-135018900 GTCAGACCAGTTCTCTGCTCTGG - Intergenic
982123200 4:152161348-152161370 CTAGGACCAGTTCTCTGAGCAGG - Intergenic
990303435 5:54472263-54472285 CTCTGCCCTGTTCTGTGTTCTGG + Intergenic
1005148595 6:22721732-22721754 CTGGGACCTGTTCTCCCTGCTGG - Intergenic
1011872439 6:91912559-91912581 CTCGGTCTTGTTGTCTCTTCTGG + Intergenic
1011920333 6:92566894-92566916 CTCGACCTTGTGCTCTGTTCTGG - Intergenic
1018759321 6:166877285-166877307 CTCCCACCTGTTCACTCTTCTGG + Intronic
1026452936 7:70545228-70545250 CTTTGACCTGTGCTCTGGTCTGG - Intronic
1028361822 7:89977005-89977027 CTCAGACATGATCTCTTTTCAGG + Intergenic
1028364339 7:90010125-90010147 CTTGGACCTGTTCTGTATGCTGG - Intergenic
1034154827 7:148948112-148948134 CTTGGGTCTGCTCTCTGTTCTGG + Intergenic
1034721956 7:153301576-153301598 CTCTGACCTCTTATCTTTTCAGG + Intergenic
1035065390 7:156100611-156100633 CTCGAACCTGTTCTCCCTTCTGG - Intergenic
1039657454 8:39425062-39425084 TTCAGACCTGCTCTCTGTTATGG + Intergenic
1042350420 8:67771872-67771894 CTCCTCCCTGCTCTCTGTTCTGG + Intergenic
1046020002 8:108653360-108653382 CTCTGCCCTGTTCTTTGGTCAGG - Intronic
1048437415 8:134431477-134431499 CTTTGTCCTGATCTCTGTTCAGG - Intergenic
1058952226 9:109914630-109914652 TTCAGACCTGTTCTCTTCTCTGG - Intronic
1059038823 9:110789979-110790001 CTTGGACCTCTTCTCTGTTCTGG - Intronic
1062187570 9:135226907-135226929 CTCTGACCTGCTCTGTGTCCTGG + Intergenic
1187832232 X:23393971-23393993 ATCTGACCTGTACACTGTTCAGG + Exonic
1195750844 X:108161152-108161174 CTCTGAACTGTTCTCTACTCAGG + Intronic
1197004694 X:121481659-121481681 GTCAGACCGGTTCTCTGCTCTGG - Intergenic
1197090782 X:122534053-122534075 CTCCATACTGTTCTCTGTTCTGG - Intergenic
1198857295 X:141032013-141032035 GTCAGACCAGTTCTCTGCTCTGG - Intergenic
1198905400 X:141555353-141555375 GTCAGACCAGTTCTCTGCTCTGG + Intergenic
1200081925 X:153581500-153581522 CTCGGACCTGTGCTCAGCTGAGG - Exonic