ID: 962287906

View in Genome Browser
Species Human (GRCh38)
Location 3:134103802-134103824
Sequence TGCAGGGGAGATCAGAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 449}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962287906_962287917 21 Left 962287906 3:134103802-134103824 CCTCCTCTCTGATCTCCCCTGCA 0: 1
1: 0
2: 4
3: 54
4: 449
Right 962287917 3:134103846-134103868 CCAGCTCCATCTTTTCAAAGTGG 0: 1
1: 0
2: 1
3: 23
4: 225
962287906_962287911 -6 Left 962287906 3:134103802-134103824 CCTCCTCTCTGATCTCCCCTGCA 0: 1
1: 0
2: 4
3: 54
4: 449
Right 962287911 3:134103819-134103841 CCTGCAAACTCAAGCCGCCTTGG 0: 1
1: 1
2: 3
3: 33
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962287906 Original CRISPR TGCAGGGGAGATCAGAGAGG AGG (reversed) Intronic
900004371 1:35032-35054 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
900024096 1:205548-205570 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
900202817 1:1419009-1419031 TGGAGGGGACATCAGGGAAGAGG - Exonic
900374544 1:2347455-2347477 TCCAGGGGACACCAGGGAGGAGG + Intronic
900807086 1:4774605-4774627 TGCAGGGGAGGGCAGTGGGGAGG - Intronic
901521298 1:9787043-9787065 TGCAGGGGTGAGAAGAGAAGGGG + Intronic
901530718 1:9850923-9850945 GGCAGGGAAGACCAGAGGGGAGG - Intronic
901917515 1:12511332-12511354 GGCAGGGGAGAGCTGAGAAGTGG - Exonic
902432855 1:16377034-16377056 TGCAGGGGAGAGCAGAGGAGAGG - Intronic
902532287 1:17098150-17098172 TGCAGGGAACAGCAGAGAGCAGG - Intronic
902682669 1:18054674-18054696 TGGATGGGAGAACACAGAGGAGG - Intergenic
902850494 1:19152072-19152094 TGTAGAGGACATCAAAGAGGTGG - Intronic
903028346 1:20445178-20445200 TGCTGGGGAGATCCTACAGGGGG - Intergenic
903032414 1:20473346-20473368 TGCAGGGCACATGGGAGAGGTGG - Intergenic
903220279 1:21865464-21865486 AGCTTGGGAGAGCAGAGAGGTGG - Intronic
903328138 1:22583043-22583065 TGCGGGGGAGAGCAGAGAGGTGG + Intronic
903655117 1:24944224-24944246 AGCAGATGAGGTCAGAGAGGTGG - Intronic
903707211 1:25295068-25295090 CCCAGGGGAGACCAGAGATGGGG + Intronic
904024975 1:27497068-27497090 TGCAGGGGAGGGGAGTGAGGAGG - Intergenic
905173461 1:36122713-36122735 GGCAAGGGAGATCACAGAGGAGG - Intronic
905656051 1:39686761-39686783 TCCCAGGGAGGTCAGAGAGGAGG - Intronic
905995565 1:42378351-42378373 AGAAGGGGAGATCACAGAGCTGG + Intergenic
906063032 1:42960642-42960664 TCCAGGGGTGAGGAGAGAGGTGG - Intergenic
906637497 1:47419009-47419031 AGCAGGGGAGGTAAGACAGGGGG - Intergenic
907330282 1:53666548-53666570 TGAAGATGAGATTAGAGAGGAGG - Intronic
907423228 1:54361587-54361609 AGCAGGGGGCCTCAGAGAGGAGG + Intronic
907437999 1:54461924-54461946 TTCAGGGGAGTTCAGAGTGGGGG + Intergenic
908122706 1:61001112-61001134 TGCAGGGGAGATGAGAGAAAAGG - Intronic
909516314 1:76511290-76511312 TGGAGGTGAGGTCAGAGAGGAGG - Intronic
910456317 1:87400985-87401007 TGCAGAGGAGATAAGGGAGCAGG + Intergenic
911068363 1:93812338-93812360 TGAAGGGCAGATAGGAGAGGGGG - Intronic
912238272 1:107876386-107876408 TGCAGAGGAGAACAGAGAAATGG + Intronic
912866299 1:113260509-113260531 TGGAGGGGAAATCAGTGGGGAGG - Intergenic
913076168 1:115342242-115342264 GGCAGATGAAATCAGAGAGGTGG - Intergenic
915338204 1:155160350-155160372 AGGAGGCGACATCAGAGAGGTGG + Intergenic
915393044 1:155562005-155562027 GGGAGGGGAGAGCAGGGAGGGGG - Intronic
915409200 1:155687923-155687945 GGGAGGGGAGAGCAGGGAGGGGG - Intronic
915563465 1:156700981-156701003 AGCAGTGGAGATCAAACAGGAGG - Exonic
915633860 1:157173021-157173043 GGCAGGCGAGAGCAGAGAGATGG + Intergenic
915791045 1:158671739-158671761 GGCAGGGTACATCAGAGTGGAGG - Intronic
916057696 1:161079527-161079549 TGCAGGGGGAAGCAGAGATGGGG - Intronic
917340697 1:173974628-173974650 TGGAGGTGGAATCAGAGAGGAGG + Intronic
917680765 1:177364762-177364784 GGCAAGCGAGGTCAGAGAGGTGG + Intergenic
918102742 1:181390737-181390759 TGCTGTGGAGGTCAGAGAGTTGG + Intergenic
918623041 1:186626843-186626865 TGCAGGTGAGTTCAGAGACCTGG - Intergenic
919116831 1:193290522-193290544 TAGAAGGGAGATCAGAAAGGAGG + Intergenic
919711489 1:200733736-200733758 TGCAGGGGAAACCTGAGAGGAGG + Intergenic
919727540 1:200893935-200893957 TGGTGGGAAGATCAGAGAGTGGG + Intronic
920169884 1:204065376-204065398 TGGGGGGGAGATGAGGGAGGAGG - Intergenic
920232579 1:204480489-204480511 TGCAGGGGAGAGCACAGGGCTGG - Intronic
920334910 1:205238532-205238554 TGCAGGACAGCTCAGGGAGGTGG + Intronic
921300547 1:213747453-213747475 TGCAAAGGAGATCAAAGAGTTGG + Intergenic
922049025 1:221972805-221972827 AGGAGAGGAGAGCAGAGAGGGGG + Intergenic
922919248 1:229287562-229287584 TGCAGGGGAGTTCTCTGAGGAGG - Intronic
923024101 1:230190638-230190660 TTCAGGAGAGAAGAGAGAGGAGG - Intronic
923219887 1:231883471-231883493 TGTGGGGCAGGTCAGAGAGGAGG + Intronic
923262031 1:232276654-232276676 TCCAGGGGAGATCAGGGCAGAGG + Intergenic
923464491 1:234236063-234236085 TGCAAGGGAGCTGAGAGTGGGGG + Intronic
923759117 1:236823952-236823974 TGCAGGGGACCTCAGTGAGATGG + Intronic
924116712 1:240754250-240754272 TCCAGGGGACATCCCAGAGGAGG - Intergenic
924262891 1:242250360-242250382 TGCAGGGATGCTCAGAGAGAGGG + Intronic
924435654 1:244038729-244038751 TGCAGGGAAGATCTGACAAGTGG - Intergenic
924468512 1:244318812-244318834 TGCAGGGAAGCCCAGAGAGGAGG + Intergenic
1063175224 10:3544719-3544741 TGCAGGGGAGAGCCCAGAGGTGG - Intergenic
1063878946 10:10510974-10510996 TGAAAGGGAACTCAGAGAGGTGG + Intergenic
1064068263 10:12202565-12202587 TGCAGCTGACATCAGAGTGGGGG - Intronic
1064073089 10:12247166-12247188 TGAGGGGGAGGTGAGAGAGGGGG - Intronic
1064073120 10:12247300-12247322 TGAGGGGGAGGTGAGAGAGGAGG - Intronic
1064073148 10:12247434-12247456 TGAGGGGGAGGTGAGAGAGGAGG - Intronic
1064073157 10:12247468-12247490 TGAGGGGGAGGTGAGAGAGGGGG - Intronic
1064073167 10:12247502-12247524 TGAGGGGGAGGTAAGAGAGGAGG - Intronic
1065399908 10:25287336-25287358 TGTAGGGGAGAAAAGAAAGGTGG + Intronic
1068962752 10:62882081-62882103 TGCTGGGGAGCTCTGAAAGGGGG + Intronic
1070954712 10:80456008-80456030 AGCAGTGGAGTTCAGAGATGTGG - Intronic
1073084989 10:100882605-100882627 TGCTGGGGAGAGCAGGGAGGGGG + Intergenic
1073111112 10:101063531-101063553 AGCAGGAGAAAGCAGAGAGGTGG - Intronic
1073510335 10:104038793-104038815 TGCTGGGGAGTTGAGAGAAGGGG - Intronic
1073542448 10:104324721-104324743 TGCAGTGGACAGCTGAGAGGAGG + Intronic
1073915735 10:108401082-108401104 TACAGGGGAGAAAAGAGAGGAGG + Intergenic
1074882501 10:117669738-117669760 TGCTGGGTAGAAGAGAGAGGTGG + Intergenic
1075588137 10:123672066-123672088 TCCAGGTGAGAACAGGGAGGTGG - Intronic
1075980176 10:126731632-126731654 TGCAGGAGAGTTCTCAGAGGTGG + Intergenic
1076294016 10:129369924-129369946 TTCATGTGAGATCAGAGAGCAGG + Intergenic
1076564078 10:131386428-131386450 TGGAGGGAGGAGCAGAGAGGGGG + Intergenic
1076722525 10:132398958-132398980 CACAGGGGAGATGAGGGAGGGGG - Intronic
1076722554 10:132399050-132399072 CTCAGGGGAGATGAGGGAGGGGG - Intronic
1077179166 11:1204506-1204528 TGCTGGGGAGAGCTGGGAGGGGG - Intergenic
1077611589 11:3646257-3646279 AGGCGGGGAGATCAGCGAGGAGG + Intronic
1077662737 11:4084089-4084111 TGCAGGGGAGAAAAGGGAGAGGG - Intronic
1080267074 11:30412951-30412973 TGGAGGGGAGACTAGGGAGGTGG - Intronic
1080386150 11:31812217-31812239 GCCAGGGGAGATAAGAGGGGAGG + Intronic
1080434172 11:32224517-32224539 TGCAAAAGAGATAAGAGAGGAGG - Intergenic
1080794091 11:35547422-35547444 TCAAGGGAAGATCAGAAAGGGGG + Intergenic
1080886871 11:36376172-36376194 TGCTGGGGAGAGCGGAGAGGGGG - Intronic
1083233891 11:61339773-61339795 GGCAGGGGAGCCCAGTGAGGAGG - Intronic
1083488581 11:62998736-62998758 TGCAGGAGAGAGCAGGGATGGGG - Intronic
1084534419 11:69748281-69748303 TGCAGGGAAGGCCAGGGAGGGGG - Intergenic
1085157889 11:74312588-74312610 TGGAGAGGGCATCAGAGAGGAGG + Intergenic
1085274974 11:75292574-75292596 TGCAGAGAAGACCAGAGAAGTGG + Intronic
1086625147 11:88941505-88941527 AGGAGGGGAGAGGAGAGAGGAGG + Intronic
1086814428 11:91351162-91351184 AGCAGGGGAGATTAGAGAGAAGG - Intergenic
1086884254 11:92185715-92185737 TGCAAGGGAGATGAGAATGGCGG + Intergenic
1088950468 11:114564579-114564601 TGCAGGAGTGCACAGAGAGGGGG + Intergenic
1089554026 11:119305001-119305023 TGCCAGGGAGAGCAGAGATGTGG + Exonic
1089758202 11:120702583-120702605 TGCAGAGGAGCCCATAGAGGAGG + Intronic
1089836704 11:121376637-121376659 TACTGGGGAGATCACAGAGAGGG + Intergenic
1090178485 11:124673305-124673327 TGCAGGGGAGCTCGGAGGGAAGG - Intronic
1090262536 11:125331752-125331774 TGCAGGGGTGGTCAGAGAGGAGG - Intronic
1090385236 11:126354690-126354712 TGCAAGGGGGTTCAGAGAAGTGG - Intergenic
1091377792 12:37080-37102 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
1091532309 12:1371195-1371217 TGCAAGGCAGAGGAGAGAGGGGG - Intronic
1091752715 12:3032728-3032750 GGCAGGTGAAATCAGAGATGAGG + Intronic
1091843429 12:3636761-3636783 TGCAGGGGAGAGTGGAGAGCTGG - Intronic
1092043721 12:5409200-5409222 TGAAGGGAATGTCAGAGAGGAGG - Intergenic
1094761371 12:33537194-33537216 GGCAGGGAAGATGAGAGAGGTGG - Intergenic
1095989494 12:48024861-48024883 GGCAGGGGTGATCTGGGAGGAGG + Exonic
1096220597 12:49826320-49826342 TGAAGAGGAGCTGAGAGAGGAGG - Intronic
1096410223 12:51371806-51371828 TGGAGTGGAGGTCAGAGAGCAGG + Intronic
1096810913 12:54169246-54169268 CGCAGGGGAGACCAGTTAGGGGG + Intronic
1097258687 12:57700193-57700215 TGCTGGGGGGTTGAGAGAGGGGG + Intronic
1098830956 12:75361674-75361696 AGCAGGAGAGATAAGAGAGAAGG + Intronic
1099187116 12:79527539-79527561 TGCACTAGACATCAGAGAGGAGG + Intergenic
1099953098 12:89325821-89325843 GTGAGAGGAGATCAGAGAGGTGG - Intergenic
1100021133 12:90070770-90070792 TGCAGGGGAAGACAGACAGGAGG + Intergenic
1100587732 12:95995437-95995459 TGGAGGAGAAATCAGAGAGGAGG - Intronic
1102408285 12:112693525-112693547 AGCAGTTGAAATCAGAGAGGTGG - Intronic
1102926146 12:116827974-116827996 TGCAAGGAAGAACAGAGAGAGGG + Intronic
1103927154 12:124429424-124429446 TGCAGGGGCGAGCAGAGAGAGGG - Intronic
1105790289 13:23791599-23791621 TGCAGGGGAGAATAGACAAGGGG - Intronic
1106788483 13:33130386-33130408 TGCATGGGAGGACAGAGGGGAGG - Intronic
1106827944 13:33544591-33544613 TTCAGGCTAGAGCAGAGAGGGGG - Intergenic
1106867043 13:33976418-33976440 AGCCGGGGAGAGCAGAGATGAGG + Intergenic
1107015685 13:35706409-35706431 TGCAGGAGAGAGAAGAGGGGTGG + Intergenic
1107677002 13:42807902-42807924 TGCATGGGATATCAAAGGGGAGG - Intergenic
1109373465 13:61456905-61456927 TGCAGAGGAAACTAGAGAGGTGG - Intergenic
1109622313 13:64925870-64925892 TGCAGGGGAGGTGCGGGAGGAGG - Intergenic
1111330742 13:86760269-86760291 TGCAGAGGAGATGACAGATGAGG + Intergenic
1111763875 13:92500904-92500926 TTCAGGGGAGATTACAGAGAGGG + Intronic
1112210077 13:97367710-97367732 AGCAGGAGAGAGCAGAGAGTGGG + Intronic
1114184490 14:20389898-20389920 TACAGGGGACATCAAAGTGGAGG + Intronic
1114315236 14:21503708-21503730 TTAAGGCCAGATCAGAGAGGTGG + Exonic
1114612330 14:24051265-24051287 TTGAGGGGAGATGAGAGAGAAGG + Intergenic
1114613011 14:24054340-24054362 TGGAGGAGGGAGCAGAGAGGAGG + Intronic
1115951711 14:38728553-38728575 TGCAGGGGAGCACAGAGAACAGG + Intergenic
1118747663 14:68785721-68785743 TGCAGAGGAGCTCAGAGATAGGG + Intergenic
1119220441 14:72901980-72902002 AGCAGGGAAAATCAGCGAGGTGG + Intergenic
1119408483 14:74413035-74413057 TCCTGGAGAGATCAGACAGGAGG - Intronic
1119495121 14:75071227-75071249 TGCAGGGGAGAGCTTAGAGGAGG + Exonic
1119715607 14:76856932-76856954 TGGAGGGGAGAGCAGTGAGATGG + Intronic
1120546466 14:85818299-85818321 TGCATGGGAGGTAAGGGAGGAGG + Intergenic
1121176710 14:91896146-91896168 TGCAGGGGAGAAAGGGGAGGAGG - Intronic
1121667766 14:95686006-95686028 GGCAGGGGTGCTCAGGGAGGAGG + Intergenic
1121766005 14:96486231-96486253 TGCAAGGCAGGACAGAGAGGGGG - Intronic
1121767573 14:96501397-96501419 TGGAGGGCATATGAGAGAGGAGG + Intergenic
1122250921 14:100439121-100439143 TGCAGGGAGGGTCAGAAAGGAGG - Intronic
1122413868 14:101539315-101539337 GGCAGGGGAGGGCAGGGAGGAGG + Intergenic
1122623045 14:103070610-103070632 TGCAGAGCAGAACAAAGAGGAGG - Intergenic
1124393158 15:29278101-29278123 TGGGGGTGGGATCAGAGAGGCGG - Intronic
1125151930 15:36542371-36542393 TGCCAGGGAGATCAGCTAGGAGG + Intergenic
1126215279 15:46146860-46146882 TGATGGGGAGAGAAGAGAGGAGG + Intergenic
1126858166 15:52859029-52859051 TGCAGGGGGGATCTGTGTGGAGG + Intergenic
1127784813 15:62346389-62346411 TAAAGGGGAGATCAAAGAGAAGG + Intergenic
1128441888 15:67717771-67717793 TGAAGGGGAGATGGGAGAGGAGG - Intronic
1128469914 15:67943548-67943570 TGGAGAGGAGCACAGAGAGGAGG + Intergenic
1128546984 15:68575009-68575031 TGCAGGTGAGCTCAGAGGTGGGG - Intergenic
1128550229 15:68593615-68593637 TACAAGGGAGCTCAGAGAGGAGG + Intronic
1128599505 15:68983900-68983922 GGCACAGGAGATCAGAGAGATGG - Intronic
1129149026 15:73675832-73675854 AGCAGTGGAGACCAGAAAGGTGG + Intergenic
1129334713 15:74845059-74845081 TGAGGGGGAGAGAAGAGAGGAGG + Exonic
1129815829 15:78552839-78552861 TGCTGGGGAAATAAGAGAGAAGG + Intergenic
1130548982 15:84877441-84877463 GGCAGGGCAGAGCAGAGAGCTGG - Intergenic
1130558818 15:84943224-84943246 TGAAGGACAGATAAGAGAGGGGG + Intronic
1130609959 15:85352058-85352080 TGCAGTGGTGATCAGAGATAAGG - Intergenic
1131131441 15:89903242-89903264 TGCAGCGGAGATCCGAGAGCAGG - Exonic
1131353811 15:91725368-91725390 TGCAGGCCAGAACAGAGAAGTGG + Intergenic
1132395726 15:101472620-101472642 TTCAGGAGAGACCAGGGAGGAGG + Intronic
1132449134 15:101955912-101955934 TGGAGGGGAGACTAGAGAGGTGG - Intergenic
1132573481 16:654279-654301 TGGCGGGGAGGTCAGGGAGGGGG - Intronic
1132670965 16:1102196-1102218 GGAAGGGGAGCCCAGAGAGGTGG + Intergenic
1132891631 16:2207661-2207683 GCCAGGGGAGGTCAGGGAGGGGG - Intronic
1132989646 16:2786179-2786201 TGGAGGGGAGGCCAGAGATGAGG + Intronic
1133502036 16:6375818-6375840 TGCAGGGGACAGGAGAGAGAAGG - Intronic
1133834985 16:9359859-9359881 TGCAGGGAGGATTAGAGATGAGG - Intergenic
1135580982 16:23626122-23626144 TGCAAGGCAGAACAGAGATGAGG - Intronic
1135670124 16:24368171-24368193 TGGAGGGGAGATCAAAGAAGAGG + Intergenic
1136278363 16:29192512-29192534 TGCCGGGGACAGCAGAGATGAGG - Intergenic
1136463710 16:30428052-30428074 GGCAGGGGACACCAGAGAGTTGG - Intronic
1137254035 16:46760565-46760587 TGCAGGGGACATGAGTGAGATGG + Intronic
1138093689 16:54195889-54195911 TAAAGGGGAGATAATAGAGGGGG + Intergenic
1138340805 16:56287865-56287887 AGCAGGAGAGATCACAGAGAGGG + Intronic
1138423132 16:56912808-56912830 TGGAGGAGTGATCAGGGAGGAGG + Intronic
1138649543 16:58451531-58451553 TGGAGAGGAGAGCAGAGAGTGGG + Intergenic
1139991841 16:70945952-70945974 AGGAGGGGAGCTGAGAGAGGAGG + Intronic
1140894678 16:79314528-79314550 TGGAGGGGAGAGCAGAGGAGGGG + Intergenic
1141430041 16:83966622-83966644 CGCATGGCAGAACAGAGAGGAGG - Intergenic
1141473879 16:84258780-84258802 TGAAGAGGAGAAGAGAGAGGGGG + Intergenic
1141689065 16:85586421-85586443 GGAAGGCGAGATCAGAGAGATGG - Intergenic
1141786697 16:86205596-86205618 TTCAGTGGAGCTCAGAAAGGTGG - Intergenic
1142155184 16:88529787-88529809 TCCAGGGAGGGTCAGAGAGGAGG + Intronic
1142525524 17:537555-537577 AGCCTGGGAGATGAGAGAGGTGG + Intronic
1142601300 17:1054313-1054335 TGCATGGGAGCTCAGAAATGTGG - Intronic
1143368958 17:6426581-6426603 TGCAGGGGCGGACAGTGAGGGGG - Intronic
1143409966 17:6702885-6702907 TGCAGAGGAGCAGAGAGAGGTGG + Intronic
1143672312 17:8405232-8405254 AGCAGTGGAGAGAAGAGAGGTGG + Intergenic
1144062880 17:11599016-11599038 TGCAGGGGAGGTCCAAGAGGCGG + Intronic
1144580557 17:16456650-16456672 GGCAGGGTAGAGCAGCGAGGAGG + Intronic
1144826624 17:18108886-18108908 TGCAGGGGTGATAAGGGAAGGGG + Intronic
1145009398 17:19359094-19359116 AGCAGTGGAGATGGGAGAGGAGG - Intronic
1145979412 17:29002972-29002994 TCAAGTGGAGCTCAGAGAGGTGG + Intronic
1146059764 17:29598397-29598419 TGCTGGGGAGGTGGGAGAGGCGG - Intronic
1146458524 17:33025595-33025617 TGCAGGGGAGAGGACAGAGGTGG - Intronic
1146472719 17:33137535-33137557 TGCAGGGGACCTCTGAGAGATGG + Intronic
1146503705 17:33386361-33386383 TTCAGGGGTGGTAAGAGAGGTGG - Intronic
1146560188 17:33861960-33861982 TGCAGGAGGGACCAGAAAGGTGG - Intronic
1146568562 17:33934173-33934195 TGCAGGTGAGATCACAGGGCAGG - Intronic
1146570336 17:33946950-33946972 GGAAGGGCAGATCAGAGATGTGG - Intronic
1147427098 17:40351137-40351159 TGCAGGGGAGAGAAGGGAGAGGG - Intronic
1147583423 17:41639171-41639193 TGCAGGGCAGAGTGGAGAGGGGG - Intergenic
1148205324 17:45776105-45776127 TGAAGGGGAGCCCAGGGAGGGGG - Intergenic
1148727920 17:49809114-49809136 TGCAGGTGAGAGCACAGAGCCGG + Exonic
1148758723 17:49988187-49988209 TGCAGGCGGGAGCAGCGAGGCGG - Intergenic
1148860161 17:50600483-50600505 TGCAGGGGAGGAGAGGGAGGAGG + Intronic
1149151235 17:53566334-53566356 TATAGGGGAGGTAAGAGAGGGGG + Intergenic
1150321725 17:64219798-64219820 GGCAGGGGAGATAAGGGACGTGG + Intronic
1150464626 17:65381583-65381605 TGCAGGGAGAATCAGAGAGCAGG + Intergenic
1151159261 17:72151021-72151043 AGGAGGGGAGAACAGAGAGGAGG + Intergenic
1151264918 17:72947393-72947415 TTCAGGGTTCATCAGAGAGGGGG + Intronic
1151935159 17:77256842-77256864 TGCAGGGGATGGGAGAGAGGAGG + Intergenic
1152037458 17:77881881-77881903 AGCAGGGGCGGTCAGAGGGGTGG + Intergenic
1152234859 17:79133235-79133257 TGCAGGGGAAACCAGAGGAGCGG + Intronic
1152248155 17:79196957-79196979 TGGAGGGCAGTGCAGAGAGGTGG - Intronic
1152866633 17:82727554-82727576 TGCACAGGAGAGCAGGGAGGAGG - Exonic
1152929737 17:83103595-83103617 AGGAGAGGAGATCAGAGGGGCGG - Intergenic
1153256024 18:3172288-3172310 TTCGGGGGTCATCAGAGAGGAGG + Intronic
1153873319 18:9341091-9341113 TGCAGGAGAGATCATATAGCAGG - Intronic
1155428731 18:25733252-25733274 TGTAGGGGAGAGAAGGGAGGAGG + Intergenic
1155428815 18:25734262-25734284 TGCAGGGGAGATGGAAGAGGAGG - Intergenic
1156463255 18:37333408-37333430 GGCAGGGAAGATGTGAGAGGAGG - Intronic
1157108514 18:44797865-44797887 TTGAGATGAGATCAGAGAGGTGG - Intronic
1157224294 18:45848794-45848816 TGCAGGGGAGATGGGCGCGGTGG + Exonic
1159076141 18:63684010-63684032 TGCAGGGAAGATCCCAAAGGTGG + Intronic
1159393956 18:67831709-67831731 TGCAGGGGACTTCACAGAAGAGG - Intergenic
1160044484 18:75373922-75373944 TGCACATGAGCTCAGAGAGGTGG - Intergenic
1160636123 19:76641-76663 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
1160658780 19:288645-288667 AGCAGGGGAGATGAGAGTGGAGG - Intronic
1161028316 19:2046693-2046715 TGCAGGGGAGAGGAGAGGAGAGG + Intronic
1161419968 19:4171336-4171358 TGCAGGGGAGGGGAGGGAGGGGG + Intronic
1161849615 19:6731675-6731697 GAAGGGGGAGATCAGAGAGGAGG + Intronic
1162422009 19:10570919-10570941 AGCAGGGGAGAGCAGGTAGGTGG + Intergenic
1162764285 19:12908911-12908933 TGCAGGGGCCAGCAGGGAGGAGG - Intronic
1162779280 19:12998247-12998269 TGGAGGGGGGAGCAGAGATGGGG - Intronic
1163152443 19:15423237-15423259 TGCATGGGGGAACAGAGAGAGGG + Intronic
1163804363 19:19386748-19386770 GGCAGGGGTCCTCAGAGAGGCGG - Intronic
1164431869 19:28196009-28196031 GGCAGAGGAGATCAGAGGGAAGG - Intergenic
1164447919 19:28333508-28333530 TGCTGGGGAGTTCTGAGAGCTGG - Intergenic
1164543555 19:29140508-29140530 TGCAGGGGAGTCCAGAGATGAGG - Intergenic
1164802663 19:31090588-31090610 GGCAGGAGAGATCACAGAGGAGG - Intergenic
1164912875 19:32026684-32026706 TGGTGGGGAGAACAGAGTGGAGG - Intergenic
1165305134 19:34999078-34999100 TGCAGGTGAGAACAGACAGTAGG + Intronic
1165448710 19:35870283-35870305 GGGAGGGGTGACCAGAGAGGTGG + Intronic
1166686357 19:44798849-44798871 AGTAGGGGAGATCAGAGAGGTGG - Intronic
1166771439 19:45285427-45285449 TGGAGGGGAGGTCAGAGCGCAGG - Intronic
1167337655 19:48896555-48896577 CGCTGGGGAGATGGGAGAGGTGG + Exonic
1167502501 19:49855885-49855907 CGCAGGGCAGGTCAGAAAGGGGG + Intronic
925518626 2:4714842-4714864 TGCAGGGAAAATCAGGGAGGAGG - Intergenic
925714208 2:6770167-6770189 TGCAGGAGGGGTCAGGGAGGTGG + Intergenic
925894028 2:8457419-8457441 TGCAGGGGAGGTCGGCGAGGGGG + Intergenic
926059163 2:9794477-9794499 CAGAGGGGAGATCAGAGATGGGG - Intergenic
926092176 2:10058217-10058239 TGCAAGGCAGATCAGAGCTGGGG + Exonic
926152725 2:10433942-10433964 TGCAGGGAAGCTCAGTGTGGAGG - Intergenic
926311177 2:11677345-11677367 TGAAGGGGAAACTAGAGAGGGGG - Intergenic
926847590 2:17159500-17159522 TGCTGGGGAGGGCAGTGAGGAGG + Intergenic
927191886 2:20522604-20522626 GGCAGGGGTGATCAGGCAGGCGG - Intergenic
928615273 2:33031939-33031961 TGCTGGGCAGATGAGAGAGAGGG + Intronic
929548630 2:42875013-42875035 TGCTGGGCAGAGCAGACAGGAGG + Intergenic
931078963 2:58747480-58747502 AGCAAGGGAAATCACAGAGGAGG + Intergenic
931466870 2:62496993-62497015 TGTGGGGGAGATAAGAAAGGCGG + Intergenic
931789831 2:65654805-65654827 TGCAGGGGAGAGTAGGCAGGTGG + Intergenic
932329700 2:70891052-70891074 TGAAGGGGAAACCAGAGAGAGGG + Intergenic
935485989 2:103654753-103654775 TCCAGGGGAAAACAGAGAGAGGG + Intergenic
936286518 2:111185571-111185593 TTCAGGGGATTTCACAGAGGAGG + Intergenic
936565358 2:113578409-113578431 TGGAGGGGAGACTAGAGAGGTGG - Intergenic
937937447 2:127257494-127257516 TGGAGGGAAGGTCAAAGAGGTGG + Exonic
937988160 2:127647888-127647910 GGCAGGGGAGAACAGGGAGCAGG - Intronic
940457397 2:153917978-153918000 TGCAGGAGAAAACAGAGAGAAGG - Intronic
941079574 2:161045176-161045198 TGGAAAGGAGGTCAGAGAGGTGG - Intergenic
941706209 2:168661031-168661053 GGCAGCGGGGAGCAGAGAGGCGG + Intronic
942350900 2:175051884-175051906 TTCAGGGAAGATCTGAGTGGTGG - Intergenic
943748807 2:191490091-191490113 GGCAGGGGACACCAGAGAAGTGG - Intergenic
943842139 2:192597239-192597261 AGCAGGGGAGAACAGAGAGTGGG + Intergenic
945503253 2:210604969-210604991 TGCAGGGGAGAATGGAGACGGGG + Intronic
946194883 2:218027006-218027028 TGGAGGGGAAGTCAGGGAGGAGG + Intergenic
947179758 2:227401564-227401586 TGCAGTGGAGCTGAGGGAGGAGG + Intergenic
947375382 2:229489990-229490012 AGAAGGGGAGATCAAAGTGGAGG + Intronic
947524710 2:230871132-230871154 TGCATGGGAGACCCGAGAAGGGG + Intronic
947624541 2:231611589-231611611 TGCCTTGGAGCTCAGAGAGGGGG + Intergenic
947828388 2:233122014-233122036 TGCAGCAGAGACCAGCGAGGCGG - Intronic
947947826 2:234121554-234121576 GGCAGGGGAGAGCAGAGGAGAGG - Intergenic
948677112 2:239603124-239603146 GGCCTGGGAGATCTGAGAGGCGG + Intergenic
948984171 2:241509701-241509723 AGCAGGGGTGATGAGAGATGCGG - Intronic
1168728860 20:60071-60093 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
1168750728 20:279338-279360 CGGAGGGAAGAGCAGAGAGGCGG + Intronic
1169030918 20:2406216-2406238 TGCAGGTCTTATCAGAGAGGTGG - Intronic
1170848581 20:19982900-19982922 TGCTGGGGAGCTCCAAGAGGTGG - Intronic
1171343031 20:24445342-24445364 TGCAGTGTAGACCAGACAGGAGG + Intergenic
1173184663 20:40831300-40831322 TGCAGGGGAGGCCCCAGAGGTGG - Intergenic
1174160871 20:48549538-48549560 AGTTGGGGAGATGAGAGAGGAGG - Intergenic
1174218033 20:48932179-48932201 AGCAGGAGAGAGCAGAGAGTAGG + Intronic
1175230579 20:57471074-57471096 TGCAGGGAAAATGAGAGAGAAGG - Intergenic
1175732339 20:61362401-61362423 CGTAGGGGAGAGCAGAGACGTGG + Intronic
1175997368 20:62817690-62817712 GGCCGGGGAGCTCAGGGAGGTGG - Intronic
1176128566 20:63486853-63486875 TGCAGGTGAGGTCAGGGTGGAGG - Intergenic
1176529954 21:7950380-7950402 TGAAGTGGAGAACAGAGGGGTGG - Intergenic
1178244429 21:30936935-30936957 TGCAGCTGACAGCAGAGAGGAGG - Intergenic
1179293813 21:40042996-40043018 TGCAGGTTGGAGCAGAGAGGGGG - Intronic
1179521783 21:41950473-41950495 TGCAGTGGTCATCAGAGAGCAGG + Intronic
1179772313 21:43631417-43631439 TGCAGGGGAGATGGGAAAGAAGG - Intronic
1180233348 21:46441631-46441653 GTCAGGGGAGCTCAGAGACGAGG - Intronic
1180623770 22:17180202-17180224 GAAAGGGGAGATCAGTGAGGAGG + Exonic
1181439060 22:22926566-22926588 AGCAGGGGAGATTCGGGAGGTGG - Intergenic
1181979903 22:26759032-26759054 TGCTGGGGAGAGCGGAGAGCCGG - Intergenic
1182016496 22:27044609-27044631 TGCATGGGAGATCAGATACCAGG + Intergenic
1182019759 22:27071586-27071608 AGCAGAGGAGATCAGGGAGCTGG + Intergenic
1182559381 22:31147829-31147851 TGCAGTGAAGATCAGAGTTGGGG + Intergenic
1183316337 22:37139038-37139060 AGCAGGGAAGATCCCAGAGGAGG + Intronic
1184555446 22:45230214-45230236 TGCAGGGGAGAGCAGACACAGGG + Intronic
1184614325 22:45627754-45627776 GGCAGGGGAGCTCACAGAAGTGG - Intergenic
1184907559 22:47499082-47499104 GGCTGGGGGGCTCAGAGAGGTGG + Intergenic
1185059811 22:48600369-48600391 TCCAGCGGGGATCAGAGTGGAGG + Intronic
1185071982 22:48661606-48661628 TGCAGCAGGGAACAGAGAGGGGG + Intronic
1185217432 22:49609472-49609494 GCCAGGGGAGAGCAGAGGGGAGG + Intronic
950113854 3:10438054-10438076 TGCAGGGGAGAGCAGGGAGGGGG + Intronic
952865674 3:37853736-37853758 TCCAGGGGAGCTGAAAGAGGAGG + Intergenic
952929663 3:38349253-38349275 TGCTGGGGAGCAGAGAGAGGCGG + Intronic
952956908 3:38563260-38563282 TGCAGGGGAGGTCAGGCAGCAGG - Intronic
953760474 3:45683071-45683093 GGCAGGGAGGGTCAGAGAGGAGG - Exonic
953840322 3:46385042-46385064 TGGAGGGCAGAGCAGAGGGGAGG - Intergenic
954128658 3:48548308-48548330 TGCTGGGAAGATCAGACAGTAGG + Intronic
955100880 3:55848545-55848567 TGCAGGGGAGATGACGGCGGAGG - Intronic
955517691 3:59744055-59744077 GGCTGGGGAGATAAAAGAGGAGG + Intergenic
955878857 3:63522801-63522823 TCCAGGGGAGGTCTGAGCGGAGG + Intronic
956388644 3:68748052-68748074 TCAAAGGGAGAACAGAGAGGTGG - Intronic
956396861 3:68835085-68835107 TGCAGAGGCCATGAGAGAGGAGG - Intronic
956736708 3:72244082-72244104 TGCTGGGGAGAGCAAGGAGGTGG - Intergenic
957173047 3:76764757-76764779 TGCATAGGAGATTAGAGAGGTGG - Intronic
957543977 3:81613037-81613059 TGAAGGGGAGGAAAGAGAGGAGG + Intronic
959797588 3:110450183-110450205 TGGTGGGGGGATGAGAGAGGAGG - Intergenic
961589981 3:127971634-127971656 GGCAGGGGAGCTCAGGGAGCAGG + Intronic
962287906 3:134103802-134103824 TGCAGGGGAGATCAGAGAGGAGG - Intronic
963013221 3:140795072-140795094 TGCAGGCAAGAACAGAGAGATGG + Intergenic
963826142 3:149956240-149956262 TAGATGGGAGACCAGAGAGGAGG + Intronic
965749843 3:171964615-171964637 TTCTTGTGAGATCAGAGAGGAGG + Intergenic
965847795 3:172985128-172985150 TGCATGGGGGATAAGGGAGGAGG - Intronic
966431890 3:179840664-179840686 AGCAGGGGGGATGATAGAGGTGG + Intronic
966882237 3:184357144-184357166 GGCTGGGGGTATCAGAGAGGAGG - Intronic
966996671 3:185288102-185288124 TGAAGGGGAAATCAGTGAGTGGG + Intronic
967392709 3:188972838-188972860 GGAAGGTGAGGTCAGAGAGGAGG - Intronic
967412326 3:189179673-189179695 TGCTGGGGAAAACAGAGAGGTGG - Intronic
969147746 4:5138965-5138987 TGGAGGGGACATCGGAGGGGAGG + Intronic
969567984 4:7991568-7991590 AGCAGGGGAGATAAGAGAGCTGG - Intronic
971423108 4:26491724-26491746 AGGACGTGAGATCAGAGAGGGGG + Intergenic
974131649 4:57763447-57763469 AGAAAGGGAGATCAGAGAAGAGG - Intergenic
977296269 4:95212930-95212952 TGCAGGTGTGAGGAGAGAGGAGG - Intronic
977823725 4:101505477-101505499 TGCATGGGGGATGAGAGAGGAGG + Intronic
979234875 4:118388301-118388323 AGCAGGAGAGAACAGAGCGGTGG + Intergenic
982229298 4:153193920-153193942 TGCAGGTGAGAACAGGGATGCGG + Intronic
984602383 4:181743603-181743625 AGCAGAGGGGCTCAGAGAGGTGG + Intergenic
986638944 5:9853018-9853040 TGCACGGGAGAGCAGTGGGGAGG + Intergenic
986724744 5:10585858-10585880 TTCAGGTGAGGACAGAGAGGAGG - Intronic
986784743 5:11103880-11103902 TGCATTGGAGATCAGAGACTAGG - Intronic
987023414 5:13898821-13898843 AGAAGGTGAGATCAGAGATGCGG - Intronic
988615316 5:32769495-32769517 TGAAGGGGAGATGAGAGAAAGGG - Intronic
990407242 5:55503834-55503856 TGAAGGGGAGGGGAGAGAGGAGG + Intronic
990558931 5:56964794-56964816 TGCAGGGGTGAGCAGAGTGGGGG - Intronic
990829725 5:59942803-59942825 TGCAAGGGAGACAAGAGATGAGG + Intronic
991145429 5:63297441-63297463 TACAGGGGAGAGTAGAGAGAGGG - Intergenic
991460131 5:66849397-66849419 TGGAGGGGAGAATAGACAGGAGG - Intronic
991650432 5:68847157-68847179 TGCAGGTGAGATCAGATATATGG + Intergenic
992367939 5:76112448-76112470 GGCTGGCGAGACCAGAGAGGAGG + Intronic
992641282 5:78770394-78770416 TGCGCGGGAGAACAGAGCGGGGG + Intergenic
992950568 5:81853122-81853144 AACAGGGGAGAACAGAAAGGGGG + Intergenic
994207890 5:97056418-97056440 TGAAGGGGAGAAAGGAGAGGAGG - Intergenic
994220120 5:97185807-97185829 GGCAGGGGAGGTAAGGGAGGAGG - Intergenic
995923022 5:117336293-117336315 TACTGGGGAGATCATTGAGGTGG + Intergenic
998742825 5:145224587-145224609 TGCAGGGTTGATCACAGAGGAGG + Intergenic
999404650 5:151296270-151296292 TGGAGGGGAGAGGAGAAAGGGGG + Intronic
1000491478 5:161919812-161919834 TGCAGGGGATATCCTGGAGGGGG + Intergenic
1000995115 5:167950603-167950625 TGGATGGGAGTTGAGAGAGGGGG + Intronic
1001322257 5:170692296-170692318 TGCAGTGGAAATTACAGAGGAGG - Intronic
1001670374 5:173468597-173468619 TACATGGGAGATCAGAGAAAGGG + Intergenic
1001939148 5:175728750-175728772 TGTAGGGGTGCTCTGAGAGGAGG - Intergenic
1002198627 5:177514462-177514484 TGCTGGGGACATCTGGGAGGTGG - Intronic
1002534978 5:179871091-179871113 TGCAGAGGACATCAGAGATGGGG + Intronic
1002537565 5:179885914-179885936 AGGAGGTGAGACCAGAGAGGTGG - Intronic
1002774965 6:320750-320772 TTCAGGGCAGGTCAGGGAGGGGG + Intronic
1003020315 6:2504205-2504227 TGGAGGGGAGAGAAGAGGGGAGG + Intergenic
1003502750 6:6715691-6715713 TGGAGGTGAGAACAGAAAGGAGG + Intergenic
1003964920 6:11243562-11243584 TTGAGGGGAGATCATAGAGTTGG - Intronic
1004844534 6:19625204-19625226 TGAATGGGAGAGCAGATAGGAGG + Intergenic
1006640616 6:35487860-35487882 TGCTGAGGAGCACAGAGAGGAGG + Intronic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1006970841 6:38043447-38043469 TGGAGGGGAGAGAAGAGACGGGG - Intronic
1007924869 6:45642837-45642859 GGGAGGGGAGAGGAGAGAGGAGG - Intronic
1007924908 6:45642978-45643000 AGAAGGGGAGATGAGAGAGGAGG - Intronic
1008313435 6:50007678-50007700 TGCTGTGGAGGTCAGAGATGGGG - Intergenic
1015460127 6:133481007-133481029 GGAAGGGAAGATGAGAGAGGTGG + Intronic
1017720750 6:157241481-157241503 AGAAGGGAAGAACAGAGAGGAGG + Intergenic
1018251069 6:161871019-161871041 AGAAGGGGAGAGGAGAGAGGAGG + Intronic
1018290761 6:162290227-162290249 TGCAGGGGAGGTTAGACAGAAGG - Intronic
1018893212 6:167996817-167996839 AGCAGGGGTGGACAGAGAGGTGG + Intronic
1019963516 7:4480961-4480983 TGGAGAGGGGATCAGAGAGTGGG - Intergenic
1020806475 7:12795865-12795887 TGCAGGTGACATCAGAGATATGG + Intergenic
1021866388 7:24962419-24962441 GGGAGGGGAGAGGAGAGAGGAGG + Intronic
1022280143 7:28899999-28900021 GGCTGGGGAAATCAGAGAGGTGG - Intergenic
1022644681 7:32219232-32219254 GACAGGTGAGATTAGAGAGGTGG + Intronic
1023881759 7:44325014-44325036 CGGCGGGGAGGTCAGAGAGGAGG - Intronic
1024570874 7:50722083-50722105 TGCAGGAGAGACAGGAGAGGAGG - Intronic
1024664118 7:51528954-51528976 TGCCCGGGAGATGAGTGAGGAGG - Intergenic
1024815897 7:53271199-53271221 AGCAGGGGAAATCTGAGAGCTGG - Intergenic
1025823749 7:64994575-64994597 TGCAGGGGACACCAGAGGGCAGG - Intronic
1026138833 7:67687140-67687162 TGCAGTGGAGATGGGGGAGGAGG - Intergenic
1026850210 7:73719213-73719235 GGCACGGGAGGTCAGAGATGAGG + Intronic
1027419796 7:78007988-78008010 TGGAGGGGACCTCAGAGAGAGGG - Intergenic
1029440561 7:100584698-100584720 AGCAGGCGAGATCAGTGGGGAGG + Intronic
1030150524 7:106399838-106399860 TCCAGGGGACTTCAGAGAGAGGG - Intergenic
1031845308 7:126798783-126798805 TGCACAGGAGGTCAGAGAGCAGG + Intronic
1032283346 7:130523738-130523760 TGCGGGTGAGAGCAGAGAGCAGG + Intronic
1032284088 7:130527963-130527985 TGCGGGTGAGAGCAGAGAGCAGG + Intronic
1032285657 7:130536872-130536894 TGCGGGTGAGAGCAGAGAGCAGG + Intronic
1032286429 7:130541302-130541324 TGCGGGTGAGAGCAGAGAGCAGG + Intronic
1032916960 7:136501791-136501813 AGCAAGTGAGATCAGAGTGGGGG - Intergenic
1033600226 7:142883987-142884009 ATCAGGGGAGAGCAGAGGGGAGG - Intronic
1034316568 7:150138644-150138666 TGCAGAGGAGAGCAGAGCTGGGG - Intergenic
1034684576 7:152958942-152958964 TGCAGGGGAGATGGGGGAGGAGG - Intergenic
1034790292 7:153962030-153962052 TGCAGAGGAGAGCAGAGCTGGGG + Intronic
1034952405 7:155308052-155308074 TGCAGGGGAGCTGGGAGAGCTGG + Intronic
1035046998 7:155974221-155974243 TCCAGGGGAATTCAGACAGGAGG + Intergenic
1035563935 8:628846-628868 AGCAGGGGAGCTGGGAGAGGGGG - Intronic
1037753426 8:21696983-21697005 GGCAGGGGAGAGAAGAGAGAGGG + Intronic
1039425234 8:37479812-37479834 TGTAGGGGAGAAAAGAGGGGAGG - Intergenic
1041636648 8:60153079-60153101 GGTAAGGGAGATCAGGGAGGAGG + Intergenic
1042655901 8:71096160-71096182 TTCAGGTGAGTTGAGAGAGGTGG + Intergenic
1043529618 8:81135071-81135093 TCCAGGGGAGACAAAAGAGGTGG - Intergenic
1044319052 8:90781606-90781628 GGTAGGGGAGAGCAGAGAGTTGG + Intronic
1044414172 8:91917512-91917534 TGCAGAGGAGAGTAGTGAGGTGG - Intergenic
1044578285 8:93795101-93795123 TGGAGGAGAGATTAGAGGGGAGG + Intronic
1044744173 8:95356156-95356178 TGCAGGGGAGATCATAGCATTGG + Intergenic
1045329082 8:101140136-101140158 GGCAGGGCAGAGCAGAAAGGGGG - Intergenic
1045395121 8:101753251-101753273 TGAAGGGAAGATCAGATGGGTGG + Intronic
1046159605 8:110342856-110342878 TGCAGAGGAGATATGGGAGGGGG + Intergenic
1047215592 8:122873416-122873438 TGCAGGGGAGTGGAGAGAAGTGG - Intronic
1047756519 8:127923101-127923123 TGCTGGGTAGACCAGTGAGGAGG + Intergenic
1048045476 8:130768662-130768684 GCAAGGGGAGGTCAGAGAGGTGG - Intergenic
1048081481 8:131132887-131132909 GGGAGAGCAGATCAGAGAGGTGG - Intergenic
1048342630 8:133552533-133552555 AGCAGGGAAGCTCAGAGAGTGGG + Intronic
1049356810 8:142193094-142193116 GGGAGGGGAGAGCAGGGAGGAGG + Intergenic
1049737737 8:144218764-144218786 GGGAGGGGAGAGCAGAGGGGAGG - Intronic
1049887066 9:34815-34837 TGGAGGGGAGACTAGAGAGGTGG + Intergenic
1049939625 9:532912-532934 TGCAGGAGGGAACAGGGAGGTGG + Intronic
1051164839 9:14250385-14250407 GGAAGGGAAGATCAAAGAGGAGG + Intronic
1051202712 9:14646547-14646569 GGTAGATGAGATCAGAGAGGTGG - Intronic
1052201224 9:25783350-25783372 TCCATGGGAAACCAGAGAGGAGG - Intergenic
1052711907 9:32067493-32067515 TCCAGGAAAGATCAGGGAGGAGG + Intergenic
1053437551 9:38086549-38086571 TCCAGGGGAGAGAAGAGAAGTGG + Intergenic
1054766212 9:69044676-69044698 TGCAGGGGAGGTGACAGGGGAGG - Intronic
1057164616 9:92915950-92915972 TCCAGGGGAGAAGAGAGAGAAGG - Intergenic
1057588325 9:96349199-96349221 TGCAGTAGATTTCAGAGAGGGGG - Intronic
1058463213 9:105202580-105202602 TGCAGGGGGGATTACAAAGGTGG + Intergenic
1059035404 9:110748723-110748745 ATCAGGGAAGATCAAAGAGGTGG - Intronic
1059110616 9:111555660-111555682 AGCAGGGGAGAGCAAAAAGGGGG + Intronic
1059110772 9:111556748-111556770 AGCAGGGGAGAGCAAAAAGGGGG - Intronic
1059351256 9:113666787-113666809 TGCAGGGGAGAACGGGGAGGTGG - Intergenic
1059873750 9:118608188-118608210 TGGAGGGAAAATAAGAGAGGAGG - Intergenic
1060125280 9:121038867-121038889 GGAAGGAGAGAGCAGAGAGGTGG - Intronic
1060327146 9:122628491-122628513 TTTTGGGGAGATCAGAGGGGTGG - Intergenic
1060367146 9:123028606-123028628 TGGAGGTAAGACCAGAGAGGTGG + Intronic
1060408890 9:123386895-123386917 TGCAGGGGACATGAGGGAGAGGG + Intronic
1060519448 9:124286069-124286091 TGCGGGGGAGGGCAGGGAGGGGG - Intronic
1060776750 9:126380260-126380282 TGCAAAGGAGATGGGAGAGGAGG - Intronic
1060824027 9:126677288-126677310 CCCAGGGGAGCTCGGAGAGGAGG - Intronic
1060990587 9:127846599-127846621 TGGCGGGGAGATCAGATAAGAGG + Intronic
1061181902 9:129029386-129029408 AGGAGGAGAGGTCAGAGAGGAGG - Intergenic
1061664839 9:132154544-132154566 TGCACGTGAGATCAGGAAGGAGG + Intergenic
1061917028 9:133760638-133760660 AGGACGGGAGATCAGGGAGGAGG + Intergenic
1062158908 9:135069135-135069157 TGCAAAGGAGGACAGAGAGGTGG + Intergenic
1062195353 9:135270405-135270427 TGCAGGCGAGATGAGCCAGGAGG - Intergenic
1062432601 9:136532738-136532760 AGGAGGGGAGCTCAGAGAGGTGG + Intronic
1062549616 9:137079975-137079997 GGCACGGGAGAGCAGAGGGGAGG - Intronic
1203387212 Un_KI270438v1:66722-66744 TGAAGTGGAGAACAGAGGGGTGG + Intergenic
1185453043 X:292988-293010 TGCAGGGGAGAGAGGAGAGCCGG - Intronic
1186472560 X:9832776-9832798 AGCAGGGGCCATCAGAGAAGCGG - Intronic
1187026176 X:15437825-15437847 AGTAGGGGAAATCAGAGAGGAGG - Intronic
1188483492 X:30657801-30657823 TGAAGGGGAAATGAGAGAAGGGG + Intronic
1189549986 X:42083053-42083075 GGGAGGGAAGAGCAGAGAGGTGG + Intergenic
1189569333 X:42278675-42278697 TGCAGGGGAGAACAGACTGGAGG + Intergenic
1190497978 X:51045377-51045399 TGTAGGGGAGATCAGATCAGGGG + Intergenic
1190508403 X:51152196-51152218 TGTAGGGGAGATCAGATCGGGGG - Intergenic
1190711526 X:53075083-53075105 GGCAGGTGAGGTCAGAAAGGTGG - Intronic
1191119144 X:56885001-56885023 TGCAGGGGAAATAGGAGAGGGGG + Intergenic
1191693851 X:63968007-63968029 GGGAGGGGAGATCAGGGAGCAGG - Intergenic
1194979706 X:100427848-100427870 AGTGGGGGAAATCAGAGAGGAGG + Intergenic
1195637361 X:107133233-107133255 AGCAGGGTAGGTCAGAGAGAGGG - Intronic
1198963869 X:142207805-142207827 ACCAGGAGAGAGCAGAGAGGTGG - Intergenic
1200121492 X:153793169-153793191 CACAGGGGAGGTCAGGGAGGAGG + Intronic
1201728420 Y:17180501-17180523 TCCCGTGGAGATCAGAGATGTGG - Intergenic
1202258814 Y:22948203-22948225 TGCAGAAAAGAACAGAGAGGAGG + Intergenic
1202411802 Y:24581961-24581983 TGCAGAAAAGAACAGAGAGGAGG + Intergenic
1202458980 Y:25088111-25088133 TGCAGAAAAGAACAGAGAGGAGG - Intergenic