ID: 962287915

View in Genome Browser
Species Human (GRCh38)
Location 3:134103845-134103867
Sequence CACTTTGAAAAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962287915_962287922 23 Left 962287915 3:134103845-134103867 CCCAGCTCCATCTTTTCAAAGTG 0: 1
1: 0
2: 4
3: 24
4: 277
Right 962287922 3:134103891-134103913 CTCCCCTCTAGGCATTAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 111
962287915_962287923 24 Left 962287915 3:134103845-134103867 CCCAGCTCCATCTTTTCAAAGTG 0: 1
1: 0
2: 4
3: 24
4: 277
Right 962287923 3:134103892-134103914 TCCCCTCTAGGCATTAACCTGGG 0: 1
1: 0
2: 0
3: 11
4: 91
962287915_962287925 25 Left 962287915 3:134103845-134103867 CCCAGCTCCATCTTTTCAAAGTG 0: 1
1: 0
2: 4
3: 24
4: 277
Right 962287925 3:134103893-134103915 CCCCTCTAGGCATTAACCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 74
962287915_962287919 12 Left 962287915 3:134103845-134103867 CCCAGCTCCATCTTTTCAAAGTG 0: 1
1: 0
2: 4
3: 24
4: 277
Right 962287919 3:134103880-134103902 CTCTCCCTAGACTCCCCTCTAGG 0: 1
1: 0
2: 2
3: 24
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962287915 Original CRISPR CACTTTGAAAAGATGGAGCT GGG (reversed) Intronic
901097513 1:6694130-6694152 CTCTTAGAAAAAATGGGGCTGGG - Intronic
901504226 1:9674377-9674399 CACTTTGAAAATACGAAGGTTGG + Intronic
901890542 1:12259746-12259768 CGCTTTTAAAAAATGTAGCTGGG + Intronic
905855292 1:41307413-41307435 CAGTTAGAAAAAATTGAGCTGGG - Intergenic
906699018 1:47844036-47844058 CACAAGGAAAAGCTGGAGCTCGG + Intronic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
907356336 1:53877740-53877762 CACTTTGACTAGGTGGAGATTGG - Intronic
907662431 1:56405645-56405667 TACTTTGAAAACATGAAACTTGG - Intergenic
908438506 1:64130544-64130566 CACCTTGAAATGATGGCCCTGGG - Intronic
910251902 1:85206614-85206636 CATTTTGAAATAATGGATCTAGG + Intergenic
910488421 1:87741677-87741699 CTCTATGTAAAGCTGGAGCTTGG - Intergenic
912094798 1:106125740-106125762 CTCATTGAAAACATGGAGTTGGG + Intergenic
915757206 1:158273685-158273707 ATCTTTTAAAAGATGGAGCCAGG - Intergenic
918162395 1:181913719-181913741 CACTGTTAAAAGATGGTGCTGGG + Intergenic
919997385 1:202765685-202765707 CACTTTGGTAAGTTGGAGATAGG - Intronic
920037438 1:203075446-203075468 CCCTTTGGAAAGAGGGAGCGAGG - Intronic
921663801 1:217841675-217841697 CACTTTGAGAGGATTGAGGTGGG + Intronic
921744064 1:218717725-218717747 CATTTTGAAAAGAATGAGCATGG + Intergenic
921814411 1:219547715-219547737 CACTTAGTAAAGAAGGAGGTTGG - Intergenic
923126094 1:231035818-231035840 CAGTTTGCAAAAATGGAGCAAGG - Intronic
923547682 1:234934914-234934936 CACTTTGAAAGGCTGAAGTTGGG + Intergenic
923647539 1:235839400-235839422 CACTTTGGAAGGGTGGAGGTGGG - Intronic
923955698 1:239016765-239016787 CAATTTGAGAAGATCAAGCTAGG - Intergenic
1063390032 10:5643984-5644006 CATTTTGAAAAGATGTACATTGG - Intronic
1065267433 10:23992401-23992423 GACTTTGAAAAGATGGCAATGGG - Intronic
1067522654 10:47019837-47019859 TCCTCTGAGAAGATGGAGCTTGG + Intergenic
1067821230 10:49532510-49532532 CACTTTGAAAGGAAGAAGATGGG + Intronic
1068693789 10:59944326-59944348 CACTGTCAAGGGATGGAGCTTGG + Intergenic
1069302823 10:66928988-66929010 AACTATCAAAAGATGGTGCTAGG + Intronic
1069824849 10:71248679-71248701 CACTTTGAAAACAAAGACCTTGG - Intronic
1070445457 10:76496392-76496414 CAGTTTGCTGAGATGGAGCTGGG - Intronic
1074037724 10:109757552-109757574 CACTTTGGAAAGACAGAGATTGG + Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075162377 10:120035512-120035534 CATTTTGGAAGGATGGAGATGGG + Intergenic
1075223727 10:120606529-120606551 CACTTTAAAAAGAAAGATCTAGG + Intergenic
1075663941 10:124217596-124217618 CACTTTGTAAAGATGGAAGCTGG + Intergenic
1076472136 10:130726546-130726568 CACTCTGAAAAGAGGGAGACAGG + Intergenic
1077597730 11:3548257-3548279 CAGTTGGGATAGATGGAGCTGGG - Intergenic
1077872549 11:6274142-6274164 AACTTTTAAAAGATAGAACTAGG - Intergenic
1078247502 11:9588630-9588652 CACTGTGACAAGAGGAAGCTAGG + Exonic
1078858042 11:15222301-15222323 CACTTTTAAAAGAAAGAGGTGGG - Intronic
1082743412 11:56936448-56936470 CAGTTTGAAAAAATTGAGTTGGG + Intergenic
1083057808 11:59839759-59839781 CACTTTGATAAGCTGTACCTGGG - Intronic
1084402013 11:68949965-68949987 TGCATAGAAAAGATGGAGCTGGG + Intergenic
1085374391 11:76045611-76045633 CATTTAGAAAAGATGAAGCGTGG + Intronic
1085775616 11:79363676-79363698 CTTTTGGAAAAGATTGAGCTGGG + Intronic
1086310080 11:85525793-85525815 CTCTCTGAGAAGATGAAGCTGGG + Intronic
1086384768 11:86295825-86295847 CACCTTGAAAATATTGTGCTAGG - Intergenic
1087334378 11:96824827-96824849 CAGTTTGTAAAGATGTAGGTGGG + Intergenic
1087672467 11:101124510-101124532 ATCTTTCAAAAGAAGGAGCTGGG + Intronic
1089159814 11:116428741-116428763 CAGTTTCTGAAGATGGAGCTCGG + Intergenic
1090350419 11:126104469-126104491 CTCTTTGAAAAGACAGAGCCCGG - Intergenic
1090665558 11:128912882-128912904 CACTTTCGAATGATAGAGCTAGG + Intronic
1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG + Intronic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1095328810 12:40932046-40932068 CATTTTTAAAGGATGGAGCATGG - Intronic
1096961910 12:55587987-55588009 CATTTTCAAAAAATGGTGCTGGG + Intergenic
1096992666 12:55817884-55817906 CTCTTTCAAAAGGTGGAACTGGG + Intronic
1097387755 12:58969923-58969945 CAAGTTAAAAAGATGAAGCTGGG + Intergenic
1097924650 12:65113870-65113892 CACTTTGAAACCATGGAACAGGG + Intronic
1097957536 12:65501505-65501527 CACTGAGAAAAGCTAGAGCTGGG + Intergenic
1098213098 12:68186802-68186824 CAATTAGTGAAGATGGAGCTAGG - Intergenic
1101134153 12:101722605-101722627 CACTTTGAGAAGCTGAGGCTGGG + Intronic
1102494854 12:113312488-113312510 CACTTTATAAAGATGGCTCTTGG + Intronic
1102887124 12:116530603-116530625 CTCATCTAAAAGATGGAGCTAGG + Intergenic
1104531250 12:129573002-129573024 CACATTGAAAAGATGTTACTTGG + Intronic
1105204064 13:18205144-18205166 CATTTTGAATAGAAGGATCTTGG - Intergenic
1105633757 13:22197485-22197507 CATTATGAAAAGGTGGAGCAGGG + Intergenic
1106394081 13:29363487-29363509 CACTCTGAGAAGAAGGAGGTTGG - Intronic
1106448829 13:29861563-29861585 CACTCTGAAGAGAAGAAGCTTGG - Intergenic
1107824243 13:44313023-44313045 CACTTTGAAAATATTCATCTTGG + Intergenic
1109080238 13:57890075-57890097 TACTCTGAAAACATGGAACTAGG - Intergenic
1110520063 13:76465027-76465049 CACGTTGAAATGTTGGAGGTGGG + Intergenic
1112219515 13:97473812-97473834 CACATTTGAAAGATGGAGGTTGG - Intergenic
1112419839 13:99238263-99238285 CACTTTCAAAACATCGACCTGGG - Intronic
1112718655 13:102216336-102216358 CACTTTGAGGAAATGGAGTTTGG - Intronic
1115365755 14:32555244-32555266 CACTTGCTAGAGATGGAGCTGGG + Intronic
1116436852 14:44904756-44904778 AACTTATAAAAGATGGGGCTAGG - Intronic
1116732395 14:48640600-48640622 CATTTTCAAAAAATGGTGCTGGG + Intergenic
1117937282 14:60920232-60920254 AACTTTGAAAAGATTAATCTAGG + Intronic
1118592161 14:67410044-67410066 CCCTTGGAAAAGACGGGGCTTGG - Intronic
1120711678 14:87799051-87799073 AACTTTAAAAACTTGGAGCTGGG - Intergenic
1124388893 15:29235169-29235191 CACTTTGAAAAGATTCAGGTAGG - Intronic
1125088228 15:35757478-35757500 CAGTTGGAAATAATGGAGCTTGG - Intergenic
1128796122 15:70467952-70467974 CACTTTAAAAAGGAGGAACTGGG + Intergenic
1129425844 15:75462217-75462239 CACTTTGAAAACATAAAGCCAGG - Intergenic
1129797522 15:78389405-78389427 CAGTTTGAGAGGAGGGAGCTGGG - Intergenic
1130632658 15:85584367-85584389 AACTTTGAAAAGATGCATCTTGG - Intronic
1133004814 16:2873928-2873950 CACTTTGAAAGGCTTGAGGTAGG - Intergenic
1133597967 16:7311161-7311183 GGCTTTGAGATGATGGAGCTGGG + Intronic
1134804070 16:17109922-17109944 CACTCTGAAAGCATGAAGCTTGG + Intronic
1137401683 16:48158629-48158651 TACTTTGAACTGATGGAGTTTGG - Intergenic
1140748970 16:78006149-78006171 CACTTTGAAAGGAGGGAGCAGGG - Intergenic
1141892594 16:86936545-86936567 CACTTGTAAGAGGTGGAGCTAGG - Intergenic
1143377882 17:6478095-6478117 CACCTGGAAGAGATGCAGCTGGG + Exonic
1146085147 17:29821410-29821432 CTCTTAGTAAATATGGAGCTGGG - Intronic
1147945225 17:44076995-44077017 CACTATGAACCGATGGTGCTGGG + Exonic
1149450007 17:56742621-56742643 CACTATGTAAAGATGGAAGTAGG + Intergenic
1150244873 17:63666895-63666917 GACTGTGTAAAGATGTAGCTTGG + Intronic
1150448391 17:65245286-65245308 CACTTTGAAAAAATGAATCTGGG + Intergenic
1152721028 17:81923893-81923915 AACTTTGAAAAGCTGGGGGTGGG + Intronic
1152812698 17:82389659-82389681 AACTTTTAAAAAATGTAGCTGGG - Intronic
1153322638 18:3788301-3788323 AACTTTTAAAAGATGAAGATAGG + Intronic
1154491305 18:14924492-14924514 AACTCTGAGAGGATGGAGCTTGG - Intergenic
1155152420 18:23133981-23134003 CCTTTTGAAAACATGGAGCCTGG - Intergenic
1157242583 18:46024976-46024998 CTCTTAGAAAAGATGGAGGAGGG - Intronic
1158321446 18:56268536-56268558 TTCTTTGAAGAGATGGAGCTGGG - Intergenic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1162030487 19:7915219-7915241 CACTTTGAAAAGTTCGAGGCGGG - Intergenic
1162917786 19:13883483-13883505 CACCTGGAAAAGATGGCGCGAGG - Intronic
1163838359 19:19590352-19590374 CACCTTGAAAACATGATGCTGGG - Intronic
1165023676 19:32943925-32943947 TGCTTTGAAAAGATGGCTCTGGG + Intronic
1165644997 19:37428209-37428231 CATATTTAAAAGCTGGAGCTAGG + Intronic
1166307952 19:41945764-41945786 CACTTTGAGAAGATGGATGCTGG - Intergenic
1167824427 19:51959397-51959419 AACATAGAAAAGATGCAGCTGGG + Intergenic
926098695 2:10099498-10099520 CACTTTGGAAAGGTGAAGGTGGG - Intergenic
927555652 2:24029646-24029668 CAGTTTACCAAGATGGAGCTGGG - Exonic
928647539 2:33370423-33370445 CACTTGCAAAAGATGGGGCGGGG + Intronic
929876088 2:45797745-45797767 CAATTGAAAAAGATGGGGCTGGG - Intronic
930662905 2:54072863-54072885 CACTTTTAAAAAAGGTAGCTGGG - Intronic
931655260 2:64505039-64505061 CACTGTGAGAGGATGGAGCGGGG - Intergenic
931994454 2:67826541-67826563 CACTTTGAAATGCTGAAGCCAGG + Intergenic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
934764688 2:96874118-96874140 CACTGTGAAAATCTGGACCTTGG + Intergenic
935733371 2:106085023-106085045 CTCTTTAAAAAGATGGCGGTAGG - Intergenic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
938128648 2:128692428-128692450 CTCTTTAAAAAGATGGAGTTAGG + Intergenic
938225247 2:129610148-129610170 CACTTTGACAATAAGGATCTTGG + Intergenic
938403441 2:131013031-131013053 CACTGTGAAAAGATTCACCTCGG + Intronic
938648788 2:133358630-133358652 AACATTGAAATGATGGAGATGGG - Intronic
939367803 2:141257392-141257414 CACAGTGAAAAGGTGCAGCTGGG - Intronic
941300583 2:163796062-163796084 AATTTTGAAGAGATGGAGCCAGG - Intergenic
943363065 2:186944632-186944654 CCCTTTGGAAAGTTGGACCTGGG - Intergenic
944728221 2:202493909-202493931 CATTTTGAATAGATCTAGCTTGG - Intronic
945376980 2:209089475-209089497 GACCTTGAAATAATGGAGCTTGG - Intergenic
945484193 2:210375552-210375574 CACTTTGAGAAGCCGGAGGTGGG - Intergenic
945541570 2:211093707-211093729 AACTAAGAAAAGATGGAGATAGG + Intergenic
945718833 2:213392479-213392501 CAGTTTGAAAATATGGAAGTTGG + Intronic
946547221 2:220757459-220757481 CATTTTGACATGATGGAGATAGG + Intergenic
946700685 2:222410036-222410058 AACAGTGAAAAGATTGAGCTAGG - Intergenic
946731431 2:222713313-222713335 CCCTTTGAAAAGATCAAACTGGG - Intergenic
946739116 2:222784737-222784759 CTCTTTGAACAAATGGATCTAGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946918561 2:224552716-224552738 CAATGTGAAAAGATGGGTCTTGG + Intronic
947858567 2:233341821-233341843 CACTTTAAAATGATGAAGCTGGG + Intronic
948601987 2:239112518-239112540 CTCTCTGATGAGATGGAGCTGGG + Intronic
1171949496 20:31408077-31408099 CATTTTGAAATGATAGACCTAGG - Intronic
1172090899 20:32431757-32431779 CCCTTTGAGAAGAGCGAGCTTGG - Intronic
1173060342 20:39654355-39654377 CACTTTCAAGAGCTAGAGCTGGG + Intergenic
1173683198 20:44902090-44902112 CAATTTTAAAAGATGGAGGGAGG - Intronic
1174553270 20:51376469-51376491 CCCTCTGTAAAGATGGAGCTGGG - Intergenic
1174916375 20:54658283-54658305 TACTTTAAAAACATGTAGCTGGG - Intergenic
1176713910 21:10332935-10332957 CATTTTGAATAGAAGGATCTTGG + Intergenic
1177336901 21:19740531-19740553 CACCTTGAAGTGATGAAGCTAGG + Intergenic
1177874054 21:26609738-26609760 CACTTTGGAAAGCTGGAGGATGG - Intergenic
1178776828 21:35559482-35559504 GACTTTGAAAAGATGGGAATTGG + Intronic
1179475112 21:41638094-41638116 CCTTTGGAAAAGATGAAGCTGGG + Intergenic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181452964 22:23036126-23036148 CACTTTGAGAAGCTGGGGGTGGG + Intergenic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1182474768 22:30571066-30571088 CACTTTGAAAATCTGCAGCCTGG + Intronic
1183552469 22:38498670-38498692 CACTTTGGAGAGATGAAGCTGGG - Intronic
1184475070 22:44715892-44715914 CACTTTGAGAGGCTGGAGGTGGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949463139 3:4315749-4315771 AAATTTTAAAAGATGGGGCTGGG + Intronic
949791682 3:7799525-7799547 TACTTTGAAAAGCAGGACCTGGG - Intergenic
950219396 3:11183136-11183158 CACTTTAAAAAGGTGGGACTGGG - Intronic
951445018 3:22769087-22769109 CCGTTTGAAAAGATGCAGATGGG - Intergenic
951513272 3:23528414-23528436 CACTCTGAAAAGATGAGGCAGGG + Intronic
952010228 3:28892284-28892306 CAGTTTCAAAAGCTGGAGTTTGG - Intergenic
952902452 3:38119255-38119277 CACTTTGGACAGATTGAGTTTGG - Intronic
953690434 3:45113143-45113165 CAGTTTTAAAGGATGGATCTTGG - Intronic
953696173 3:45161412-45161434 CACTATGAGAAGAGGGAGCAAGG - Intergenic
954056798 3:48033049-48033071 CACTTTTAAAATAAGGAGGTTGG - Intronic
956956091 3:74342541-74342563 CACCTAGAGAAGATGGACCTTGG + Intronic
957221818 3:77391803-77391825 CACTTTGGAAAGGCCGAGCTGGG - Intronic
961915296 3:130368108-130368130 CCTTTTGAAAAGATGGAACCAGG + Intronic
961929860 3:130521880-130521902 CACTATGAGCAGCTGGAGCTCGG - Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
964137421 3:153360322-153360344 TCCTCTGAAAATATGGAGCTTGG + Intergenic
965504800 3:169502663-169502685 CACTTTTTAAATATAGAGCTTGG + Intronic
966464242 3:180212333-180212355 CACTTTTAGAAGATGGAAATGGG - Intergenic
966857999 3:184209191-184209213 CACTTTGCAATGAAGGAGCCTGG + Intronic
967327606 3:188257795-188257817 CACTTTGCAAATAAGGAACTGGG + Intronic
967953760 3:194861120-194861142 CACTTTGTGAAGAGGGAGCTGGG - Intergenic
968781760 4:2587721-2587743 AATTTTGAAAAGAAAGAGCTGGG + Intronic
969467372 4:7365818-7365840 CACTTTGCAAAGAAGGTGCCTGG - Intronic
970075979 4:12221171-12221193 CACTTTAAAATGAAGAAGCTGGG - Intergenic
970973335 4:22012171-22012193 TACTATGAAAAGAGCGAGCTAGG - Intergenic
971243796 4:24911596-24911618 CAGTTTGAGAAGATGGAGCCAGG + Intronic
972354495 4:38267653-38267675 CACCTTGAAAGGAAGGAGCTAGG + Intergenic
972465162 4:39348716-39348738 CCTCTTCAAAAGATGGAGCTTGG + Intronic
973255949 4:48113728-48113750 CACTATGAAATGGTGGAGCTGGG - Intronic
973751687 4:54026123-54026145 TACTAGGAAATGATGGAGCTCGG + Intronic
973811103 4:54571160-54571182 CACATTGACAAGATAGAGTTTGG + Intergenic
975573785 4:75843252-75843274 CAATTTGAAGGGATGGAGCTGGG + Intergenic
975770530 4:77716866-77716888 TAATTTGAAAAGAAAGAGCTTGG + Exonic
976644988 4:87377991-87378013 GGCTATTAAAAGATGGAGCTGGG + Intronic
977579795 4:98712680-98712702 GACTAGGAAATGATGGAGCTTGG + Intergenic
979377023 4:119958774-119958796 CAGTTTAAAAAGGAGGAGCTGGG - Intergenic
979382410 4:120022655-120022677 CAGTTTAAAAAGGAGGAGCTGGG + Intergenic
979704345 4:123703728-123703750 CAGTTTGAAAAGAATGAGCATGG + Intergenic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
980224151 4:129959513-129959535 CATTTTGAACAAATGGTGCTGGG - Intergenic
982731526 4:158960571-158960593 CTCTTTGAAAGGAGGGTGCTGGG + Intronic
984021509 4:174489241-174489263 CACTTTGAAAACATGGATCTAGG + Intergenic
984465406 4:180094876-180094898 TACTTGGAAAAGGTGGAGGTGGG - Intergenic
984854576 4:184183772-184183794 CACTGTGAACAGATGTTGCTGGG + Intronic
985825120 5:2185784-2185806 CACCCTGAAAAGATGGAGGTGGG + Intergenic
988186846 5:27875118-27875140 CACTTACAATAAATGGAGCTTGG - Intergenic
989206097 5:38810019-38810041 TACTTAAGAAAGATGGAGCTGGG + Intergenic
990252558 5:53931316-53931338 CACTTAGAAAAGATGTACGTAGG + Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
991479605 5:67063056-67063078 CACTGTGAAATGATATAGCTTGG - Intronic
994757640 5:103814903-103814925 CACTTTGAAAAGAGTGATCAAGG - Intergenic
994860334 5:105184765-105184787 CCCTATGTAAAGATGGTGCTGGG - Intergenic
995987499 5:118196659-118196681 CTCTTTGAGAAGATGGATTTAGG - Intergenic
996686098 5:126282639-126282661 CAGATTGAAAAGAGGGACCTTGG + Intergenic
997750760 5:136343315-136343337 CACTTTGAACTGAAGGAGATTGG + Intronic
997907062 5:137828460-137828482 CACCTTGAAAAGAATGAGCTTGG - Intergenic
998467704 5:142358721-142358743 CACCTAGAAATGATGGAGCAGGG + Intergenic
1000435971 5:161209182-161209204 CACTTTGGAAAGACTGGGCTGGG - Intergenic
1000478115 5:161737663-161737685 CACTTTGAGTAAATGGATCTTGG + Intergenic
1001270600 5:170308520-170308542 CACTTTGAAAGCATTTAGCTGGG + Intergenic
1001661746 5:173398436-173398458 CACTTCATAAAGTTGGAGCTGGG - Intergenic
1001861788 5:175062160-175062182 AACTCTGGAAAAATGGAGCTGGG + Intergenic
1002554585 5:180025752-180025774 ACCTCAGAAAAGATGGAGCTTGG - Intronic
1002625881 5:180528912-180528934 CACTTTTAAAAGATGTGGGTCGG + Intronic
1003293868 6:4806346-4806368 CATTTTGGAAAGATGGCTCTGGG - Intronic
1010073654 6:71773946-71773968 CATTTTAAAAAGATGGATCGAGG - Intergenic
1011381339 6:86744992-86745014 CACATTGGAATGAAGGAGCTGGG - Intergenic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1013384682 6:109614429-109614451 CAATATGAAAAAATGGAGTTTGG - Exonic
1014563954 6:122925704-122925726 TACTTTGAAAAGATAGATCTAGG + Intergenic
1016452251 6:144195304-144195326 CTCTTTGAAAACATGGATTTGGG + Intergenic
1016546225 6:145227631-145227653 CACTTTGAAAATAGGAAACTGGG + Intergenic
1016737972 6:147500988-147501010 CACTTTGAGAAGCTGGGGCCAGG + Intergenic
1017617939 6:156265036-156265058 CACTTTGAAAAGAGAATGCTGGG - Intergenic
1018469695 6:164084426-164084448 CACATGGAGAACATGGAGCTTGG + Intergenic
1019959378 7:4446227-4446249 CACCTTGAAAAGAGGGCACTGGG - Intergenic
1021064050 7:16150479-16150501 CACTTTGAAAATATGAAGCATGG + Intronic
1021465242 7:20935561-20935583 CACTTTGAAAACATGAAGGTAGG - Intergenic
1021937282 7:25643781-25643803 CAGTTGGAAAGGGTGGAGCTAGG - Intergenic
1023672770 7:42596602-42596624 TACTTTTATAAGAAGGAGCTAGG + Intergenic
1025736963 7:64159203-64159225 CACATGGAAAAGTTGGAGCATGG - Intronic
1026480576 7:70775714-70775736 CACTTAGAAAATATGTAGCTGGG + Intronic
1026508092 7:71003691-71003713 CACTTTGGAAAGTGGTAGCTGGG - Intergenic
1028283440 7:88963425-88963447 TACTTTCAACAGATGGTGCTAGG + Intronic
1030080177 7:105770839-105770861 CACTTTGAGAAGCAAGAGCTTGG - Intronic
1030153487 7:106428509-106428531 CCCTTTGAAAGGAGAGAGCTAGG - Intergenic
1032716405 7:134512641-134512663 CACTTTGAAAAAAAGGAAATTGG - Intergenic
1032733453 7:134667410-134667432 CACTATAAAAATATTGAGCTGGG + Intronic
1033439276 7:141364363-141364385 CACATTAAAAAGTTGGGGCTGGG + Intronic
1033470087 7:141639296-141639318 GACTTTGAAGAGAAGGAGATAGG + Intronic
1035778731 8:2210131-2210153 CAATTAGAAAAGATGGAGTTTGG + Intergenic
1038294226 8:26276169-26276191 CACTTTTATAAGATGAACCTTGG + Intergenic
1039128851 8:34237157-34237179 CACATTCAAAAGATGGTGCTGGG - Intergenic
1039204128 8:35130790-35130812 CTTTTTCAAAAAATGGAGCTGGG - Intergenic
1041098616 8:54373855-54373877 CATCTTGTAAACATGGAGCTGGG - Intergenic
1041209899 8:55538689-55538711 CATTCTGAAAAAATGCAGCTTGG - Exonic
1041978619 8:63829251-63829273 CACTCTGAAAAGATAAAGCCTGG + Intergenic
1043489605 8:80735777-80735799 TACATTGAAAACATGGAGCCAGG - Intronic
1044143148 8:88679418-88679440 CACTTTGAAATGCTTTAGCTGGG - Intergenic
1045079555 8:98610412-98610434 CACTTTGGTAAAATGAAGCTAGG - Intronic
1045575234 8:103413435-103413457 AAGTTTGTAAAGATGGATCTGGG - Intronic
1047846810 8:128815027-128815049 CACTTTGACCTGATGAAGCTGGG - Intergenic
1050247570 9:3707076-3707098 CACTTTGAAAAGCAAGAGGTTGG + Intergenic
1050419610 9:5449870-5449892 CATTCTTAAAAGATGTAGCTCGG + Intergenic
1050421012 9:5465284-5465306 GGCTTTGAAAAGGTGGTGCTGGG - Intronic
1050473640 9:6018829-6018851 CTCTTTGAAAAAAATGAGCTGGG + Intergenic
1050719083 9:8564451-8564473 CACTTTGAGAAGCTGGAGGCGGG + Intronic
1051472993 9:17470744-17470766 TCCACTGAAAAGATGGAGCTTGG - Intronic
1051957098 9:22709511-22709533 CACTTTCAACAAATGGTGCTGGG - Intergenic
1052112229 9:24600723-24600745 CTCTTTGAGAAAATTGAGCTGGG - Intergenic
1052380076 9:27760612-27760634 GACTTGGAAAAAAAGGAGCTAGG - Intergenic
1053295062 9:36906760-36906782 GGCTTTGAAAATCTGGAGCTCGG - Intronic
1055124492 9:72703421-72703443 CACTTTTAAAAGATTGAGGCTGG - Intronic
1055720467 9:79167581-79167603 GGCTTTTAAATGATGGAGCTGGG + Intergenic
1055875115 9:80932770-80932792 CACTTTGAAAAGCACAAGCTGGG - Intergenic
1057865686 9:98678687-98678709 CACTCTGAAAATTTGGAGGTGGG - Intronic
1061093986 9:128443751-128443773 AAATTTGTGAAGATGGAGCTGGG - Intergenic
1061624790 9:131835363-131835385 CACTTGGAAAAGCTGAAGGTGGG - Intergenic
1061944981 9:133903527-133903549 CACTTAGAAAATATGGGGGTGGG + Intronic
1062438317 9:136556910-136556932 CCCTTTGAGGAGATGGACCTGGG - Intergenic
1185678405 X:1867597-1867619 CAATATGAAAATATGGGGCTGGG + Intergenic
1185877206 X:3711506-3711528 CCCTTGGGAAAGGTGGAGCTGGG - Intronic
1185936852 X:4266194-4266216 CACCATGAAAAGTAGGAGCTCGG - Intergenic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1187513808 X:19946850-19946872 GACTTTTAAAAAATGTAGCTGGG - Intronic
1187826924 X:23340830-23340852 CTCTTAGAAAAGATTGAGCCTGG + Intronic
1188244912 X:27828298-27828320 CACTTTGAGAAGAAAGAACTTGG + Intergenic
1188870564 X:35365801-35365823 CAATCTGAAAAGCTGGAGCATGG + Intergenic
1189484491 X:41419361-41419383 CACTTGGAAAAAATTGATCTGGG - Intergenic
1190339388 X:49284929-49284951 CCCTTTCAAAAGATGGAGCTAGG + Intronic
1191851523 X:65589214-65589236 CACTTTGAAAACTTGGGACTGGG - Intronic
1193503197 X:82305977-82305999 CCCTAGGAAAAGATGGAGCAGGG - Intergenic
1195790855 X:108583679-108583701 CAATTAGAATAGATGGAGGTAGG + Intronic
1196199352 X:112867965-112867987 CAGTGTTAAGAGATGGAGCTAGG + Intergenic
1198429089 X:136547942-136547964 CACTTTAAAAAGCTGGTGTTTGG + Intronic
1199071838 X:143485952-143485974 CACTATGCAAAGATGTATCTGGG + Intergenic
1199194478 X:145011251-145011273 CAGTTTGACAAGATGGACGTTGG + Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1201017173 Y:9617270-9617292 CACTTTGAAAAGATAGTTTTTGG + Intergenic
1201279409 Y:12328137-12328159 CAGTTTGAAAAGACGCAGTTTGG - Intergenic