ID: 962290228

View in Genome Browser
Species Human (GRCh38)
Location 3:134129631-134129653
Sequence GTGGATGCCTAGTTGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 15, 3: 57, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962290228_962290233 14 Left 962290228 3:134129631-134129653 CCTCTTCTCAACTAGGCATCCAC 0: 1
1: 1
2: 15
3: 57
4: 245
Right 962290233 3:134129668-134129690 ACTTGAATTAAACACTAACATGG 0: 1
1: 0
2: 1
3: 17
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962290228 Original CRISPR GTGGATGCCTAGTTGAGAAG AGG (reversed) Intronic
901148146 1:7082105-7082127 GTGGTGGCCTGGTAGAGAAGAGG - Intronic
903834136 1:26191689-26191711 ATGGGTGCCTTGTGGAGAAGGGG + Intronic
904345081 1:29862590-29862612 GTGGAGGCCTAGTGGAGAAGAGG - Intergenic
905481423 1:38264614-38264636 GTAGATGCCTTGTTCAGAACAGG + Intergenic
906054636 1:42905721-42905743 ATGGATGCCAAGTTCACAAGGGG - Intergenic
906263712 1:44412363-44412385 GTGGAGGTGTAGTAGAGAAGGGG - Exonic
907982014 1:59492408-59492430 CTGGATGGCTTGTTTAGAAGGGG + Intronic
909459711 1:75895887-75895909 ATGGATGCCAAGTTTACAAGGGG + Intronic
910377448 1:86587926-86587948 GTGGAGGGATAGTGGAGAAGAGG - Intergenic
911974500 1:104474320-104474342 ATGGATTCCAAGTTGATAAGGGG + Intergenic
912200627 1:107453662-107453684 GTGGATGCCATGTAGGGAAGTGG + Intronic
912692559 1:111815389-111815411 ATGGAGGCCTAGTTGGGAAGAGG - Intronic
913128244 1:115813262-115813284 GTGAGTGCCAAGTTGACAAGGGG - Intergenic
915115266 1:153594585-153594607 GTGCATGCTTAGTAGAGATGTGG + Intergenic
915120891 1:153629035-153629057 GTGGAGGTCGAGTTGGGAAGGGG - Intronic
916370091 1:164082425-164082447 GTGGGTGCCAATTTGACAAGGGG + Intergenic
920019206 1:202941330-202941352 GTAGATGCCTTGCTGAGGAGGGG + Exonic
921986615 1:221319287-221319309 ATGGGTGCCAAGTTGACAAGGGG + Intergenic
923247180 1:232143769-232143791 GATGAGGCCTAGTGGAGAAGGGG + Intergenic
923849670 1:237780165-237780187 GTTGAGGCCAAGTTGAGAAGAGG + Intronic
924062904 1:240194795-240194817 GCTAAGGCCTAGTTGAGAAGAGG + Intronic
924272614 1:242349433-242349455 GAATATGCCTAGCTGAGAAGAGG + Intronic
924476956 1:244390831-244390853 ATGGGTGCCAAGTTGACAAGGGG - Intergenic
924937093 1:248781281-248781303 GTTGAGGGCTCGTTGAGAAGAGG - Intergenic
1063849223 10:10165000-10165022 GTGAAGGCCTAGTGGAGAACAGG + Intergenic
1063909143 10:10811848-10811870 GTGGAGGCCTAGTTGAGAAGAGG + Intergenic
1065119633 10:22515929-22515951 GTTGATGCTTAGTTGAAAACTGG + Intergenic
1065867589 10:29927310-29927332 GGGGAGGCCTTGCTGAGAAGGGG - Intergenic
1066173865 10:32882407-32882429 GATGAGGCCTAGTTGAGAAGAGG + Intronic
1066393927 10:35000794-35000816 GTGGGTGCGAAGTTGACAAGAGG + Intergenic
1068771325 10:60825049-60825071 GTTGATGCCTAACTGAGCAGGGG + Intergenic
1068897639 10:62225063-62225085 GTTGAGGCCTAGTTGAGTAAAGG - Intronic
1069054740 10:63832798-63832820 GTTAAGGCCTAGTTGAGAAGAGG + Intergenic
1070199225 10:74186629-74186651 GTGGTTGCCTGGGTGAGAAGGGG - Intronic
1070446939 10:76514371-76514393 GTGGTTGCTTAGCAGAGAAGTGG + Intronic
1071073692 10:81726764-81726786 GTCAAGGCCTAGTTGAGAAGAGG - Intergenic
1071305399 10:84294913-84294935 GAGGAGGCCTAGTTGAGAAGAGG + Intergenic
1071399301 10:85254174-85254196 GTGGATGCATAATGGAGAGGTGG + Intergenic
1071416599 10:85447419-85447441 GTGCATGCCTAGGTGTGGAGGGG - Intergenic
1071710618 10:88045495-88045517 AGGGTTGCCAAGTTGAGAAGGGG + Intergenic
1071821036 10:89281170-89281192 GTTGAGGCCTAGTCAAGAAGAGG - Intronic
1071930775 10:90467155-90467177 GTCAAAGCCTAGTTGAGAAGAGG - Intergenic
1073444078 10:103570633-103570655 GAGAATGCCGAGGTGAGAAGTGG + Intronic
1073734560 10:106330915-106330937 GTCAAGGCCTAGTTGAAAAGAGG - Intergenic
1074363634 10:112841209-112841231 GTGGGGGCCTAGTTGGGGAGAGG - Intergenic
1074443328 10:113497655-113497677 GTGGATGCATATTTGAGCAGAGG - Intergenic
1076072672 10:127504038-127504060 GTGGATGCCTTTATAAGAAGAGG - Intergenic
1078553893 11:12302201-12302223 GGTGAGGCCTAGTTAAGAAGAGG + Intronic
1082741752 11:56918637-56918659 GTTGAGGCCTAGTCAAGAAGAGG + Intergenic
1083024877 11:59542363-59542385 GTCTAGGCCTAGTCGAGAAGAGG - Intergenic
1085519385 11:77129267-77129289 CTGGATGCCTGGTGGAGATGTGG - Intronic
1085906004 11:80763577-80763599 GTGGTTGTCTAGTTGGGAGGGGG - Intergenic
1086008875 11:82074036-82074058 GAAGAAGCCTAGTTGAGAAAAGG - Intergenic
1086273273 11:85093887-85093909 ATGGATCCCAAGTTGATAAGGGG - Intronic
1086490029 11:87349911-87349933 GTGGATGCCAAGTTGACAAGGGG + Intergenic
1086564254 11:88207131-88207153 GTTGAGGCCTAGGTGAGAAATGG - Intergenic
1086699484 11:89884226-89884248 GTGGAAGTTTAGTTGACAAGTGG - Intergenic
1086706687 11:89960288-89960310 GTGGAAGTTTAGTTGACAAGTGG + Intergenic
1087642329 11:100768467-100768489 GTGGAGGCCTAGTCAAGAAGAGG + Intronic
1088308619 11:108436570-108436592 ATGGATGCCAAGGTGACAAGGGG + Intronic
1092324241 12:7512368-7512390 ATGGGTGCCAAGTTGACAAGGGG + Intergenic
1093653358 12:21669252-21669274 GTGGGTGCCAAGTTGACAAGGGG + Intronic
1093771782 12:23026651-23026673 ATGGATGCTAAGTTGATAAGTGG + Intergenic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1097185046 12:57192263-57192285 GTAGATGCCTTGGTGGGAAGGGG - Intronic
1098965427 12:76783040-76783062 GTTGAGGCCTAGTTGAGAAGAGG + Intronic
1099346084 12:81501326-81501348 GAGAATGCCTTGATGAGAAGGGG - Intronic
1100033032 12:90216319-90216341 ATGGATGCCAAGTTGACAAGGGG - Intergenic
1100150414 12:91729943-91729965 ATGGGTGCCCAGTTGACAAGAGG + Intergenic
1101114293 12:101517200-101517222 ATGGGTGCCAAGTTGACAAGAGG + Intergenic
1102210965 12:111126792-111126814 ATGGGTGCCAAGTTGACAAGGGG - Intronic
1105428898 13:20319202-20319224 CTGGATGCCAAGTTGACAAGGGG + Intergenic
1106340656 13:28823596-28823618 GTTGAGGCCCAGTTGAGAAGAGG - Intronic
1106396593 13:29386568-29386590 GAGGAGGCCTGGTTGAAAAGAGG + Intronic
1107505496 13:41029248-41029270 ATGGGTGCCAAGTTGACAAGGGG + Intronic
1108146129 13:47478954-47478976 ATGGATGCCAAGCTGACAAGGGG + Intergenic
1108224515 13:48274504-48274526 ATGGGTGCCAAGTTGACAAGGGG - Intergenic
1108272766 13:48778389-48778411 GTTGTTGCCTTTTTGAGAAGGGG - Intergenic
1109003924 13:56844865-56844887 ATGGATGCCAAATTGACAAGTGG + Intergenic
1109604558 13:64675636-64675658 GTGGATGCCTATATATGAAGTGG - Intergenic
1110815910 13:79859816-79859838 ATGGGTGCCAAGTTGACAAGGGG + Intergenic
1111409598 13:87857332-87857354 ATGGAGACCTCGTTGAGAAGAGG + Intergenic
1111410381 13:87868334-87868356 GTGGAGGCCTCGTCCAGAAGAGG + Intergenic
1112421335 13:99252114-99252136 CTGGATGACCAGTTGGGAAGTGG - Intronic
1113335503 13:109372670-109372692 GTGGATGCCTAGAGAAGATGAGG - Intergenic
1113699551 13:112374516-112374538 GGCGAGGCCTCGTTGAGAAGAGG - Intergenic
1116012974 14:39372587-39372609 GGGTATGTTTAGTTGAGAAGAGG + Intronic
1116967681 14:51031237-51031259 GTTGAGGCCTAGGTAAGAAGAGG - Intronic
1120250503 14:82057338-82057360 ATGGGTGCTAAGTTGAGAAGGGG - Intergenic
1122339355 14:101018347-101018369 GAGGATGCGTAGCTGAGGAGCGG + Intergenic
1123787496 15:23687528-23687550 ATGGATGCGTACTGGAGAAGGGG + Intergenic
1124019147 15:25903731-25903753 GTGGAGGTATTGTTGAGAAGAGG + Intergenic
1124554853 15:30715725-30715747 GGGGATGCCCAGTCGAGATGGGG + Intronic
1124676394 15:31689955-31689977 GGGGATGCCCAGTCGAGATGGGG - Intronic
1125394584 15:39232956-39232978 GTTGAGGTCTAGTGGAGAAGAGG - Intergenic
1126580807 15:50240989-50241011 GTTGAGGCCTAGTTGAGAAGGGG - Intergenic
1126673109 15:51134445-51134467 GTCAAGGCCCAGTTGAGAAGAGG - Intergenic
1127215396 15:56818229-56818251 GGAGAGGCCTAGTCGAGAAGAGG + Intronic
1129779697 15:78262483-78262505 ACTGAAGCCTAGTTGAGAAGAGG + Intergenic
1131374353 15:91911291-91911313 GGGGAAGGCTAGTTGAGAAGAGG + Intronic
1133376724 16:5293354-5293376 GTGGATGCCTAGCAGAGGTGGGG - Intergenic
1133897639 16:9944611-9944633 GTGGTTGCCTAGTTGCGGAGAGG + Intronic
1135078359 16:19413136-19413158 GTGACTGTCTAGATGAGAAGCGG - Intronic
1135626294 16:23997869-23997891 ATGGATGCCAAGTTGAGAAAGGG + Intronic
1135749541 16:25045922-25045944 GTTAAGGCCTAGTTGAGAAGAGG + Intergenic
1137845018 16:51678466-51678488 GTGTTTGCCAAGCTGAGAAGGGG - Intergenic
1138021758 16:53489933-53489955 GCCGATGGCTATTTGAGAAGGGG - Intronic
1138339148 16:56277252-56277274 CTGGAGGCCAAGTTGGGAAGTGG + Intronic
1138501704 16:57449378-57449400 GTTGAGGCCTAGATAAGAAGAGG + Intronic
1138853177 16:60655046-60655068 ATGGATGGCTAGTTCTGAAGCGG + Intergenic
1139580512 16:67870914-67870936 GTGAGTGCCTAGCTGAGAGGAGG - Exonic
1140824037 16:78689467-78689489 GTCAAGGTCTAGTTGAGAAGTGG - Intronic
1144117417 17:12111925-12111947 GTGGCTGCCTCGTGAAGAAGAGG + Intronic
1145914879 17:28566764-28566786 GTGTATGTTTAGTGGAGAAGGGG + Intronic
1146458371 17:33024628-33024650 GTCAAGGCCTAGTTGAGAACAGG - Intronic
1147708059 17:42441752-42441774 GTGGATACCTGGAAGAGAAGAGG + Intergenic
1149461231 17:56831839-56831861 GTGGAGGCCTAGTTGAAAAGGGG - Intronic
1149482042 17:57011481-57011503 ATGGGTGCCAAGTTGACAAGGGG + Intergenic
1149550413 17:57535346-57535368 GTTGAGGCCTAGTTGAAAGGAGG + Intronic
1151004599 17:70419765-70419787 GTGGATGCCTAGAAGGAAAGTGG - Intergenic
1151448256 17:74181361-74181383 CTGGATCCTTAGTTAAGAAGAGG + Intergenic
1153439169 18:5098325-5098347 GTTGAGATCTAGTTGAGAAGAGG - Intergenic
1154077287 18:11215901-11215923 GTGGATGCCTAGAAGAAAACAGG + Intergenic
1154406126 18:14092782-14092804 ATTGAGGCCTAGTTGACAAGAGG - Intronic
1156317639 18:35985611-35985633 GATGAGGCCTAGTTGAAAAGAGG - Intronic
1157846403 18:51007763-51007785 GTGAGTGCCAAGTTGACAAGGGG + Intronic
1159044701 18:63358281-63358303 GTGACTGCCTAGCTGAGAAGAGG + Intronic
1159773780 18:72580895-72580917 GTGGAAGCCTTATTGAGAAGAGG - Intronic
1160222973 18:76990609-76990631 GAGGAGGCTTAGTTGAAAAGAGG + Intronic
1161723332 19:5915394-5915416 GTGGCTGCCCAGGAGAGAAGGGG - Exonic
1162888672 19:13716026-13716048 AATGATGCCTAGTTGAAAAGAGG - Intergenic
1167409524 19:49336832-49336854 GTGGCTGCCTAGGTGGGAAATGG + Intronic
925681561 2:6427491-6427513 GTCAAGGCCTAGTGGAGAAGAGG + Intergenic
926651793 2:15354730-15354752 GTTAAGGCCTAGCTGAGAAGAGG - Intronic
926802189 2:16668360-16668382 GTGGAGGCCTGGGTGAAAAGTGG + Intergenic
932797639 2:74711346-74711368 GTGGTTGCCTAGGTGTGATGGGG + Intergenic
933576183 2:84071068-84071090 ATGGGTGCCAAGTTGACAAGAGG + Intergenic
937435240 2:121874549-121874571 GTGGAGGCCTGGTGGGGAAGGGG + Intergenic
937786568 2:125906212-125906234 ATGGGTGCCAAGTTGACAAGGGG + Intergenic
938370591 2:130765970-130765992 ATGGATGCCAAGTTGACAAGGGG - Exonic
938856628 2:135319049-135319071 GTGTATACAGAGTTGAGAAGAGG + Intronic
939119787 2:138102350-138102372 GGGGCTGCTTTGTTGAGAAGGGG + Intergenic
939720659 2:145646338-145646360 ATGGATGCCAAGTTGGCAAGGGG - Intergenic
942322252 2:174745917-174745939 ATGGGTGCCAAGTTGACAAGGGG + Intergenic
942344902 2:174992684-174992706 GTGGAGGCCTGGTTGAGAAGAGG - Intronic
943374698 2:187061797-187061819 GTTGAGGCCTATTTGAGAAGAGG + Intergenic
943471698 2:188302685-188302707 GTCAAGGCCTGGTTGAGAAGAGG - Intronic
944312748 2:198252602-198252624 TTGGATGTCTAGTTGAGGACAGG + Intronic
945924997 2:215794402-215794424 GATGAGGCCTATTTGAGAAGAGG - Intergenic
946427159 2:219605519-219605541 GTTGAGGCCTAGTCCAGAAGAGG + Intronic
946904836 2:224406178-224406200 GAGTTTGCCTAATTGAGAAGGGG - Intergenic
1169240148 20:3970202-3970224 GTGAAAGCCTAGTTGAGAGCTGG + Intronic
1170880128 20:20289680-20289702 GGGGCTGCCTAGTTAGGAAGAGG - Intronic
1171302889 20:24079117-24079139 TTTGAGGCCTAATTGAGAAGAGG + Intergenic
1173156570 20:40617511-40617533 ATGGGTGCCAAGTTGACAAGAGG + Intergenic
1173164696 20:40679121-40679143 GTGGGGGCCTTGGTGAGAAGGGG - Intergenic
1174896255 20:54452808-54452830 GTTGAGGCCTGGTAGAGAAGAGG - Intergenic
1175166570 20:57048453-57048475 CTGGCTGCCAAGTTGAGAATGGG + Intergenic
1176990189 21:15486464-15486486 ATGGATCCTTGGTTGAGAAGGGG + Intergenic
1177460752 21:21406488-21406510 GTCAAGGCCTAGTTGAAAAGTGG + Intronic
1177521834 21:22236847-22236869 GTGGGTGCCAAGTTGATAAGGGG + Intergenic
1177780668 21:25619571-25619593 ATGAATGCCAAGTTGACAAGGGG - Intergenic
1178346419 21:31832391-31832413 GCCGAAGCCTAGTTGAAAAGAGG - Intergenic
1179248005 21:39649910-39649932 GTGGAGGCCTGGTTGGGATGAGG + Intronic
1179442747 21:41406958-41406980 GTGGATGCCTATTTCAGTAAAGG - Exonic
1179709027 21:43201388-43201410 GTTGAGGCCTAGTTGAGAAGGGG + Intergenic
1180606752 22:17064784-17064806 GTTGAGGCCTAATAGAGAAGGGG + Intergenic
1183179160 22:36246952-36246974 GTTGGTGCCTAGAGGAGAAGAGG + Intergenic
1183181636 22:36264075-36264097 GTCGGCGCCTAGTGGAGAAGAGG + Intronic
1184000244 22:41668058-41668080 TTGTATTCCTAGTAGAGAAGGGG + Intergenic
1184365229 22:44046925-44046947 GTGCATGCAGAGTTGAGAACTGG + Intronic
1184378053 22:44127543-44127565 GTGCATCCGTAGTAGAGAAGAGG + Intronic
949615029 3:5744241-5744263 ATAGGTGCCAAGTTGAGAAGGGG + Intergenic
950985045 3:17354365-17354387 GTTTATACCTAGATGAGAAGAGG - Intronic
951288449 3:20845193-20845215 GTTGAGGCTTAGTTGAGAAGAGG + Intergenic
952244472 3:31571038-31571060 GTCAAAGCCTAGTTGAGAAGAGG + Intronic
952576516 3:34780855-34780877 GTGTATGTTTAGTAGAGAAGGGG - Intergenic
953085872 3:39666426-39666448 GGGGATGCAGAGTTGAGAGGAGG + Intergenic
953144619 3:40262969-40262991 GACAAGGCCTAGTTGAGAAGAGG - Intergenic
953408466 3:42673021-42673043 GTGGAAGCCTATTTGTCAAGGGG + Intergenic
953923565 3:46968666-46968688 GTGGAGGCCTAGTGGTGGAGTGG - Intronic
956565916 3:70638484-70638506 ATGGGTGCCAAGTTGACAAGGGG - Intergenic
956908388 3:73790818-73790840 GTAGATGGCTAGTTAAGAATGGG - Intergenic
957298172 3:78358634-78358656 GTGTATGCCAAGTTGACAAGGGG - Intergenic
958667293 3:97157974-97157996 ATGGATGCCAAGTTGACAAGGGG - Intronic
959213036 3:103413380-103413402 ATGGATGCCAAGTTGGCAAGAGG - Intergenic
961263149 3:125618715-125618737 GTGAATGCCAAGTTGACAAGCGG + Intergenic
962290228 3:134129631-134129653 GTGGATGCCTAGTTGAGAAGAGG - Intronic
963030127 3:140962144-140962166 CTTGATGCCAAGTTGGGAAGAGG - Intronic
963909506 3:150803485-150803507 ATGGGTGCCAAGTTGACAAGAGG + Intergenic
965682720 3:171268193-171268215 GTCGAGGCCTGGTTGGGAAGAGG - Intronic
966155975 3:176916962-176916984 TTTCAGGCCTAGTTGAGAAGAGG - Intergenic
966430584 3:179827886-179827908 ATTGAAGCCTAGTTGAGAAAAGG - Intronic
966697235 3:182802831-182802853 GGGGATGCAGAGTTGAGAAATGG - Intronic
967143475 3:186584938-186584960 TAGGATGACTGGTTGAGAAGAGG + Intronic
968713029 4:2134367-2134389 GTGGATGCCTAGGTGTGTAATGG + Intronic
968731607 4:2271772-2271794 CTGGGTGACTAGTGGAGAAGGGG + Exonic
969579925 4:8058694-8058716 TTCGAGGCCTAATTGAGAAGAGG - Intronic
970524266 4:16915435-16915457 GTGGGTGCCAAGTTGACAAGGGG + Intergenic
974542637 4:63257945-63257967 GTTGAGGCCTAGTTGAGAAGAGG - Intergenic
975629261 4:76383164-76383186 GTTGAGGCATAGTTGAAAAGAGG - Intronic
976300970 4:83515121-83515143 GTGGGTGCCAAGCTGACAAGGGG - Intronic
978483920 4:109228319-109228341 GTGGGTGCCAAGTAGACAAGGGG - Intronic
978526746 4:109675329-109675351 GTTAACGCCTAGTTGAGAAGAGG - Intronic
979779989 4:124638833-124638855 GTTGAAGCCTAGCTGAGAAGAGG - Intergenic
980861217 4:138501583-138501605 GTTGAGGCCTAATTGAGAAGTGG - Intergenic
980875031 4:138652796-138652818 GTCAAGGCCTAGTTGAGAAGAGG + Intergenic
982612922 4:157599533-157599555 GTTGAGGCCTAGTTGATAAGAGG + Intergenic
983053149 4:163071691-163071713 GTTGAGGCCTAGTTGGGAAGAGG - Intergenic
983432619 4:167670795-167670817 ATGGGTGCCAAGTTGACAAGGGG - Intergenic
983468331 4:168123650-168123672 GTAGATGTCTAGTTGGGAACAGG + Intronic
984445723 4:179833204-179833226 GTGGCTGCCAGGTTGATAAGGGG + Intergenic
984445792 4:179833985-179834007 GTTGAGGTCTAGTTGAGAAGAGG - Intergenic
984865167 4:184274886-184274908 GTTGAGGCCTAGTTGAGAAGAGG - Intergenic
985225911 4:187761789-187761811 ATAGATGCCAAGTTGACAAGGGG - Intergenic
987561800 5:19533282-19533304 GTTGATGCTTTGTTGAGTAGAGG + Intronic
987566169 5:19589482-19589504 GTGGATACAAAGGTGAGAAGAGG - Intronic
989174143 5:38504680-38504702 GTGTATGCCCAGTTGAGTGGCGG + Intronic
989278185 5:39612334-39612356 ATTGAGGCCTAGTTGAGAAGAGG - Intergenic
990405279 5:55484048-55484070 GTTGAGGCCTAGTTGAGAAGAGG - Intronic
990739948 5:58902393-58902415 CTGGTTGCCTTGCTGAGAAGTGG + Intergenic
991550220 5:67827301-67827323 GTGGATGGCTAGTTTAGTGGTGG - Intergenic
992392838 5:76345181-76345203 GTTGGTGCCTAGTTGAGAACTGG - Intronic
992466912 5:77015267-77015289 GTTGAGGCCTAGTTGAGAAGAGG - Intergenic
992733887 5:79699572-79699594 GTGGGTGCCTAGAAGAGGAGAGG + Intronic
994680188 5:102876972-102876994 GTGAAGGCCTAGTCAAGAAGAGG + Intronic
995111560 5:108434626-108434648 ATGGGTGCCAAGTTGAGAAGAGG + Intergenic
995505321 5:112854019-112854041 GTCGAGACCTAGTTGAGAAGAGG + Intronic
996149435 5:120017373-120017395 GTACCTGCCTAGGTGAGAAGTGG + Intergenic
996908661 5:128631652-128631674 ATGGGTGCCAAGTTGACAAGGGG - Intronic
997040105 5:130242797-130242819 CTGGATGCCAAATTGACAAGGGG + Intergenic
997806659 5:136924612-136924634 GTGGGTGCTCAGTGGAGAAGGGG - Intergenic
998593460 5:143502249-143502271 GTGGGTGCCAAGTTGACAAAAGG + Intergenic
1000594106 5:163194257-163194279 GTTGAGGCCTAGGTGAAAAGAGG - Intergenic
1001917099 5:175570914-175570936 CTGGATGACCAGTTTAGAAGTGG + Intergenic
1002326073 5:178407184-178407206 GTGGAGGCCTAGTGGGGAGGTGG + Intronic
1003312956 6:4985303-4985325 GGGAATGCCAAGTTGAGAATCGG + Intergenic
1003770471 6:9293415-9293437 TAGGATGCCGAGTTGTGAAGGGG - Intergenic
1004242987 6:13944471-13944493 GTGGAGGCCTAGTTGAAAAGAGG + Intronic
1004450727 6:15743280-15743302 GTTGAGGACTAGTTGGGAAGAGG - Intergenic
1008989420 6:57585739-57585761 GTCAAGGCCTGGTTGAGAAGAGG + Intronic
1009178007 6:60484296-60484318 GTCAAGGCCTGGTTGAGAAGAGG + Intergenic
1009770081 6:68134516-68134538 ATGGATGCCAAGTTGACAAGGGG - Intergenic
1010002924 6:70966365-70966387 GATGAGGCCTAGTTGAAAAGAGG - Intergenic
1010024234 6:71197217-71197239 GTGGCTGACTTGTTTAGAAGAGG + Intergenic
1011837841 6:91456184-91456206 GTGGAGGCCTAGTTAAAAAGAGG + Intergenic
1014150635 6:118050670-118050692 GTTGAATCCTAGGTGAGAAGGGG + Intronic
1016376296 6:143423896-143423918 GTGGAGGCCTGGTTAAAAAGAGG + Intronic
1016388686 6:143553679-143553701 GTTGAGGCCTAGTTGAGAAGAGG + Intronic
1016566368 6:145459263-145459285 GCTGAGGCCTAGTTGAGAAGAGG + Intergenic
1019142015 6:169954310-169954332 GTGGGTGCCAAGTTGACAAGGGG + Intergenic
1020859977 7:13479718-13479740 GTGGAGGCCTAGTCAAGAAAAGG + Intergenic
1021904556 7:25320457-25320479 GAGTAGGCCTGGTTGAGAAGGGG + Intergenic
1022190885 7:28015980-28016002 GAGGAGGCCTAGCTGAGATGAGG - Intronic
1024227449 7:47336923-47336945 GTTGAGGCCTAGTGGAGAAGAGG - Intronic
1024586753 7:50849017-50849039 TGGGATGCCAAGGTGAGAAGTGG - Intergenic
1026056593 7:66989828-66989850 CTGGGTGCCAAGTTGATAAGGGG - Intronic
1026143640 7:67727063-67727085 GTTGAGGCCTGGTTGAGAAGAGG + Intergenic
1026721503 7:72835233-72835255 CTGGGTGCCAAGTTGATAAGGGG + Intergenic
1027701531 7:81475971-81475993 GTTGAAACCTAGTTGAGAAGAGG + Intergenic
1028432348 7:90762110-90762132 ATGGAAGCCTTGTTGAGGAGAGG + Intronic
1029813548 7:103072536-103072558 CTGGCGGCCTAGATGAGAAGAGG + Intronic
1029865411 7:103622442-103622464 GTGGTTGCCTTGTGGAGAATAGG - Intronic
1029957304 7:104653221-104653243 GTTGAGGCCCAGTGGAGAAGAGG + Intronic
1030354578 7:108527835-108527857 GATGAGGCCTAGTTGGGAAGAGG + Intronic
1032246456 7:130217792-130217814 ATTGAGGCCTATTTGAGAAGAGG + Intergenic
1032728376 7:134613408-134613430 GAGGATGCCAAATTCAGAAGTGG - Intergenic
1032857478 7:135847152-135847174 ATGGATGCCAAGTTGACAAGGGG - Intergenic
1033114157 7:138610665-138610687 GTCAAGGCCTAGTGGAGAAGAGG - Intronic
1035340827 7:158160115-158160137 GTGAGTGCCAAGTTGACAAGGGG + Intronic
1035845619 8:2861354-2861376 TTGGATGCCTAATTGAAATGCGG - Intergenic
1037263072 8:17028793-17028815 GTGGATGTGTATTTGTGAAGGGG - Intronic
1037809737 8:22080449-22080471 CTGGAAGCCCAGGTGAGAAGTGG + Exonic
1037863252 8:22421793-22421815 GTGGATTTCTAGTTTAGGAGAGG + Exonic
1038694415 8:29793326-29793348 GTCGAGGCCTAGTCAAGAAGAGG + Intergenic
1039255905 8:35718806-35718828 CTAGATGCCTAGTGGAGTAGGGG + Intronic
1039526835 8:38224464-38224486 ATGGGTGCCAAGTTGATAAGAGG - Intergenic
1040103842 8:43528065-43528087 CTGGATGCCAAGGTGAGGAGAGG + Intergenic
1040646724 8:49406053-49406075 GTAGGTGCCCAGTTGACAAGGGG + Intergenic
1041512011 8:58662996-58663018 GTTGAGGCCTAGTTGAGAAGTGG - Intergenic
1042440459 8:68820181-68820203 GTTGAGGGTTAGTTGAGAAGAGG + Intergenic
1042448730 8:68920286-68920308 GTCCAGGCCTAGTTGAGAAGAGG - Intergenic
1043403687 8:79908961-79908983 CTGGATGACCACTTGAGAAGAGG - Intergenic
1046244541 8:111541840-111541862 GTTGAAGCCTAGTCAAGAAGAGG + Intergenic
1046244548 8:111542048-111542070 GTTGAAGCCTAGTCAAGAAGAGG + Intergenic
1046545728 8:115648156-115648178 GAGGAAGCCAAGTTGGGAAGTGG + Intronic
1046671057 8:117056592-117056614 GATGAGGTCTAGTTGAGAAGGGG + Intronic
1046738731 8:117806224-117806246 GTGGATTCTATGTTGAGAAGAGG - Intronic
1046946102 8:119975724-119975746 GTGGAGGCCCAGTAGAAAAGAGG + Intronic
1047938215 8:129802361-129802383 GTCAAGGTCTAGTTGAGAAGAGG + Intergenic
1048798118 8:138170565-138170587 ATGGGTGCCAAGTTGACAAGGGG + Intronic
1049495757 8:142931539-142931561 ATGGGTGCCAAGTTGACAAGGGG - Intergenic
1050045052 9:1534171-1534193 TTGGGTGCCAAGTTGACAAGGGG + Intergenic
1053611086 9:39713710-39713732 ATGGATGCCAAGTTGACAAGAGG + Intergenic
1053869128 9:42471761-42471783 ATGGATGCCAAGTTGACAAGAGG + Intergenic
1054087168 9:60757448-60757470 ATGGATGCCAAGTTGACAAGAGG - Intergenic
1054242434 9:62628685-62628707 ATGGATGCCAAGTTGACAAGAGG - Intergenic
1054556561 9:66663203-66663225 ATGGATGCCAAGTTGACAAGAGG - Intergenic
1056018369 9:82416243-82416265 GTTGAGGCCTAGTTGGGAAGAGG + Intergenic
1056462856 9:86825036-86825058 GAGGATCCCTAGTTGAAATGAGG + Intergenic
1056893372 9:90517118-90517140 GTCAAGGCCTAGTTGGGAAGAGG - Intergenic
1057521698 9:95765399-95765421 GTGGATGTCAAAATGAGAAGGGG + Intergenic
1057866491 9:98686019-98686041 GTCAAGGCCTAGTTGGGAAGAGG - Intronic
1058654092 9:107203928-107203950 GTTGAGGCCTAGTTGAAAGGAGG - Intergenic
1060150696 9:121286390-121286412 GTGGATACCTCGGGGAGAAGGGG - Intronic
1060804772 9:126568050-126568072 ATGGATGCCTTGTTGACAAGGGG - Intergenic
1061603197 9:131686478-131686500 GTGGCTGCCCAGTTGTGTAGTGG - Intronic
1061912276 9:133731542-133731564 GTGGATGCCCAGTTGGGGAGGGG - Intronic
1062144443 9:134981222-134981244 GTCAAGGCCTAGTTGAGACGGGG + Intergenic
1190115206 X:47621863-47621885 GTGGAAGCCTAGGGGAGGAGGGG - Intergenic
1190418279 X:50202397-50202419 GTTGAGGCCTAGCTGAGAAGTGG + Intergenic
1190870327 X:54419573-54419595 GTGGCTCCCTGGTTGAGTAGAGG - Intergenic
1192163848 X:68810583-68810605 ATGGGTGCCAAGTTGACAAGGGG + Intergenic
1192670035 X:73130362-73130384 GAGGAGGCTTAGTTGAAAAGAGG - Intergenic
1194463381 X:94200608-94200630 GTGGGTGCCAAGTGGACAAGGGG - Intergenic
1196367106 X:114935500-114935522 ATGGGTGCCAAGTTGACAAGAGG + Intergenic
1196663337 X:118291870-118291892 GTGGAGGCCTAGGTGGGAACTGG + Intergenic
1197860573 X:130965693-130965715 GTCAAGGCCTAGTTGGGAAGAGG + Intergenic
1199013398 X:142783039-142783061 GTGCCTGCCAAGTTGACAAGGGG + Intergenic