ID: 962290975

View in Genome Browser
Species Human (GRCh38)
Location 3:134136098-134136120
Sequence GGACCCACTGCAGGCTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962290975_962290979 14 Left 962290975 3:134136098-134136120 CCTGAGGAGCCTGCAGTGGGTCC 0: 1
1: 0
2: 3
3: 23
4: 259
Right 962290979 3:134136135-134136157 TCAGCTTCTCCTACGCTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 145
962290975_962290981 24 Left 962290975 3:134136098-134136120 CCTGAGGAGCCTGCAGTGGGTCC 0: 1
1: 0
2: 3
3: 23
4: 259
Right 962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962290975 Original CRISPR GGACCCACTGCAGGCTCCTC AGG (reversed) Intronic
900394662 1:2448312-2448334 GCTCCCTCTGCAGGCTCCCCGGG + Intronic
900694337 1:4000611-4000633 GGACCCTCTGCAGGCTGCTCTGG + Intergenic
900694979 1:4004226-4004248 GGAATCACTGCAGGCTCCTGAGG + Intergenic
901050766 1:6424862-6424884 GGCCGCACCGCGGGCTCCTCTGG + Exonic
901167962 1:7233287-7233309 AGCCCCACCGCAGTCTCCTCCGG - Intronic
901876341 1:12168866-12168888 GGAGCCACAGGAGGCTCCCCAGG - Intronic
902207745 1:14881903-14881925 GAACTCACTGTAAGCTCCTCCGG + Intronic
903188385 1:21642262-21642284 GCACCCACTGCAGGCGCAGCAGG + Intronic
903229233 1:21911731-21911753 AGCCCCACTGCAGGCCCTTCAGG + Intronic
905236330 1:36552407-36552429 GGACCCTCTGCAGGTTTCTGGGG + Intergenic
905418171 1:37819073-37819095 GGACCCTCTGCAGAGTCCTGAGG - Intronic
905464231 1:38140600-38140622 AGATCCACTCCAAGCTCCTCTGG - Intergenic
906568507 1:46817211-46817233 GGAGTCCCTGCATGCTCCTCTGG + Intronic
906614931 1:47227503-47227525 GGATCATCTGCAGCCTCCTCTGG + Intronic
919049710 1:192499016-192499038 GGCCCCAGTGCAGGATCCACTGG - Intergenic
920563031 1:206952646-206952668 CTCCCCACGGCAGGCTCCTCAGG - Intergenic
920959449 1:210651640-210651662 GGACCCACTGCTGCCTTCTAGGG + Intronic
921089467 1:211830108-211830130 GAAACCGCTGCAGGCTCCACCGG - Intronic
922193681 1:223341422-223341444 GGACCCTCTCCAGGCTCTGCTGG - Intronic
923592063 1:235328052-235328074 GGACCCTCTGCAGCTCCCTCCGG + Exonic
924118124 1:240767730-240767752 GGACTCTCTGCAGGGTCCTAAGG + Intergenic
924539930 1:244970829-244970851 GCACCCCCTGCCGGCGCCTCCGG - Exonic
1062786743 10:271263-271285 GGACCAACTTCAGGCCCCACTGG - Intergenic
1065834958 10:29648548-29648570 GCAGCCAATGCAGGCTTCTCTGG + Intronic
1066598271 10:37076384-37076406 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1067080157 10:43208264-43208286 TCTCCCACTGCAGGCTGCTCTGG + Intronic
1069821138 10:71229471-71229493 CCGCCCTCTGCAGGCTCCTCAGG - Intronic
1070987730 10:80702722-80702744 GGTCCCAGTGCAGTCACCTCAGG + Intergenic
1071085279 10:81862624-81862646 GGCCCCAGTGCAGGATCCACTGG - Intergenic
1072070292 10:91908824-91908846 GGGCCCACTGGCGGCTCCTCGGG - Exonic
1072802392 10:98401783-98401805 TGCCCCACTGCAGGGTCTTCAGG + Intronic
1074092940 10:110279994-110280016 GGAACAGCTGCAGGGTCCTCAGG + Exonic
1075653196 10:124143536-124143558 GGACTCTCTGCAGGGTCCTGAGG + Intergenic
1076229706 10:128809835-128809857 GGACTCTCTGCAGGCTCCAGAGG - Intergenic
1077523702 11:3051282-3051304 GGCCCCACTGAAGGCGCCTGGGG + Intronic
1077877503 11:6320421-6320443 GGACCCCCCGCCGGCGCCTCGGG + Exonic
1078102154 11:8336313-8336335 CCACCCACTGCAGGCTCCTCCGG - Intergenic
1078473027 11:11606832-11606854 GGACCCAGTAGAGGCTCCTCAGG + Intronic
1078571846 11:12465286-12465308 GGACTCTCTGCAGGGTCCTGAGG - Intronic
1080204500 11:29713075-29713097 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1083173679 11:60936764-60936786 GGGGCCCCTACAGGCTCCTCAGG - Exonic
1083466245 11:62848364-62848386 CGGCTCACTGCAAGCTCCTCTGG + Intergenic
1084374006 11:68763880-68763902 GGAGCCTCTGCAGGCTCCCCAGG + Intronic
1084643223 11:70438187-70438209 GGAGCCACTGCTGGCCACTCTGG + Intergenic
1085800036 11:79580816-79580838 GGACTCTCTGCAGGGTCCTGAGG - Intergenic
1088840628 11:113624674-113624696 CCACCACCTGCAGGCTCCTCAGG - Intergenic
1090534471 11:127625647-127625669 TGACCCTCTCCAGGCCCCTCGGG - Intergenic
1091430875 12:433176-433198 GGAAGCACTGCAGGCTCAGCTGG + Exonic
1091659594 12:2373477-2373499 TGTCCCAGGGCAGGCTCCTCAGG - Intronic
1091682488 12:2537057-2537079 GGCCTCCCTGCCGGCTCCTCTGG - Intronic
1091830946 12:3551007-3551029 AGACCCACTGAATGCTGCTCAGG - Intronic
1094838936 12:34334932-34334954 GGACCCAATGCATGCACCGCAGG - Intergenic
1095974631 12:47930876-47930898 GTACTCCCTGCAGACTCCTCAGG + Intronic
1096769779 12:53927760-53927782 GGCCCCTCTCCAGGCTTCTCCGG - Intergenic
1096976745 12:55703699-55703721 GGACCCACTGCCCCCTCATCAGG + Intronic
1101955986 12:109212910-109212932 GGACCAACTGCACGATGCTCTGG - Exonic
1103561753 12:121796512-121796534 GGCCCCTCTGCAGGGTTCTCAGG - Intronic
1103996621 12:124834263-124834285 AGAACCACTCCAGGGTCCTCAGG + Intronic
1104959603 12:132482252-132482274 ACACACACTGCAGTCTCCTCTGG + Intergenic
1109854220 13:68107658-68107680 GGCCCCAGTGCAGGATCCACTGG - Intergenic
1112324239 13:98432818-98432840 GGACCCACTGGAGGGTCTGCAGG + Intronic
1113455192 13:110443761-110443783 GGACCCAGTGGAGGCTCCGCCGG - Intronic
1113775703 13:112943720-112943742 CGAGCCACCGCAGGCTGCTCGGG - Intronic
1117438927 14:55742551-55742573 GCACTCACTGCTGGCCCCTCAGG - Intergenic
1119734735 14:76974740-76974762 GGACCCTCTGCTTGCTCCTCAGG - Intergenic
1122774735 14:104112097-104112119 GGACCCATCTCAGCCTCCTCCGG - Intronic
1122835987 14:104431364-104431386 CGTCCCACTGCGGGCTCATCTGG + Intergenic
1123050260 14:105538010-105538032 GGCGACACTGCAGGCTCCGCCGG - Intergenic
1123478528 15:20610584-20610606 GGCCCCAGTGCACCCTCCTCTGG + Intergenic
1123639485 15:22389801-22389823 GGCCCCAGTGCACCCTCCTCTGG - Intergenic
1124036431 15:26057294-26057316 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1124375262 15:29125537-29125559 GGACCCACTGCGCCCTCTTCAGG + Intronic
1124509327 15:30309658-30309680 GGGCCCATTGCAGTCACCTCAGG - Intergenic
1124734233 15:32229004-32229026 GGGCCCATTGCAGTCACCTCAGG + Intergenic
1127969323 15:63946222-63946244 GGCACCACAGCAGGCACCTCTGG - Intronic
1128497326 15:68205999-68206021 AGCCCCACCACAGGCTCCTCGGG + Intronic
1128662079 15:69508899-69508921 GGTCTCTCTGCAGGCTCCTGTGG + Intergenic
1128944990 15:71813860-71813882 GGAGCCCCTGGTGGCTCCTCTGG + Intronic
1129270511 15:74417078-74417100 AGACCCAGTGCAGGGTCCCCAGG - Intronic
1129726163 15:77902878-77902900 GGAGCCACTGAAGGTTCCACAGG + Intergenic
1130608069 15:85335394-85335416 GCACCTCCTGCTGGCTCCTCAGG - Intergenic
1131257015 15:90869725-90869747 AGACCCACTGCGGGCTCCCCTGG + Intronic
1132320944 15:100924681-100924703 GGACACACAGCTGACTCCTCCGG - Exonic
1133111458 16:3550406-3550428 GGACTCACTCCAGGCTCTCCAGG + Exonic
1135328465 16:21542745-21542767 GGACAAGCTGCAAGCTCCTCAGG - Intergenic
1136276657 16:29182824-29182846 GGACATGCTGCAGGGTCCTCAGG + Intergenic
1136338811 16:29628718-29628740 GGACAAGCTGCAAGCTCCTCAGG - Intergenic
1138552062 16:57753584-57753606 GGAGCCACAGCAGGCTACCCTGG - Intronic
1141472952 16:84252011-84252033 GGGGCCACAGCAGCCTCCTCTGG - Intergenic
1142081038 16:88148884-88148906 GGACACGCTGCAGGGTCCTCAGG + Intergenic
1142602107 17:1058612-1058634 GGAGCCATGGCAGCCTCCTCAGG + Intronic
1143088750 17:4436034-4436056 GGACCCCCTGCTGGCTGCTGTGG + Intronic
1143729534 17:8873173-8873195 GGACCCCCTTCAGTCTGCTCTGG + Intergenic
1144783918 17:17821521-17821543 GCACCCCCAGCAGGATCCTCTGG + Intronic
1146458478 17:33025346-33025368 AGACCCCCCGCAGGCCCCTCAGG + Intronic
1147239081 17:39078789-39078811 TCAGCCACTGCTGGCTCCTCTGG - Intronic
1147740082 17:42666325-42666347 GGATCCTCTGCAGGCTCTTGTGG - Exonic
1148545327 17:48514405-48514427 GGACCCTCTACAGGTTCCCCAGG + Intergenic
1148666829 17:49381276-49381298 GGAGCTACTGCAGGTTCTTCAGG + Intronic
1149893863 17:60413921-60413943 TGACCTTCTCCAGGCTCCTCAGG + Intronic
1151681744 17:75626108-75626130 GGAGCCGCTGCAGGCTCTTCAGG - Intergenic
1151767594 17:76140278-76140300 GCAGCCACTGCAGGCTGGTCAGG + Exonic
1151937847 17:77274248-77274270 GGACCAGCTGAAGGCTCATCGGG - Intergenic
1157399781 18:47377740-47377762 GGACACAGAGCAGGCACCTCTGG - Intergenic
1157776541 18:50401048-50401070 GGACTCATTCCAGGCTCCCCCGG + Intergenic
1157901982 18:51526719-51526741 GGACCACCTGCAGGCCCCTGGGG + Intergenic
1160690142 19:457931-457953 GGACCCACTTCCGCCTCCCCCGG - Intronic
1160761712 19:788825-788847 GGCCCCGCTGCACGCTCCCCCGG - Intergenic
1161323646 19:3652676-3652698 GGAGCCAACGCAGGCTCCACGGG + Intronic
1162746513 19:12801687-12801709 GGACCCCCTTCAGGCTGCTTTGG - Intronic
1163556058 19:17993427-17993449 GCCCCCACTGCAGCCTCCACGGG + Intronic
1163650821 19:18516665-18516687 GGACCCAGAGCTGGCTCCTGGGG - Intronic
1164544485 19:29148350-29148372 GGACTCACTCCAGGATCCTTGGG + Intergenic
1164830615 19:31317332-31317354 TGACCCACTGCAGCCACATCGGG + Intronic
1165090674 19:33386744-33386766 GGGCTCAAAGCAGGCTCCTCGGG + Intergenic
1165154824 19:33780665-33780687 GGACCCTCTTCAGCCTCCTCTGG + Intergenic
1166518526 19:43464278-43464300 CACACCACTGCAGGCTCCTCCGG - Intronic
1167338366 19:48900444-48900466 GCACCCAGTGCATCCTCCTCCGG - Intronic
925936482 2:8766526-8766548 TGACAGACTGCAAGCTCCTCGGG + Intronic
925949192 2:8895153-8895175 GGAGCCACTGCTGGCTCACCTGG + Intronic
926723367 2:15979216-15979238 GGACACACTGCAAGTTCCTGGGG + Intergenic
928106427 2:28473053-28473075 GGCCCCAGTGCAGGATCCACTGG + Intronic
928196636 2:29221022-29221044 AGAACCACAGCAGGCTCCACAGG + Intronic
929915776 2:46134320-46134342 GGACCATCTGAAGGTTCCTCTGG + Intronic
932492852 2:72132658-72132680 GGGCCCTCTGTGGGCTCCTCTGG - Intronic
932572734 2:72946430-72946452 ACACCCACTGCATGCTCCTCGGG + Intronic
933832659 2:86223330-86223352 GGGCCCACTGCAGGCTACACAGG - Intronic
936117146 2:109711367-109711389 GGAGCCACTGCAGGGTCCCAGGG - Intergenic
936826049 2:116582327-116582349 GGACTCTCTGCAGGGTCCTGAGG - Intergenic
937263557 2:120601698-120601720 GGTTCCAGTGCAGCCTCCTCCGG - Intergenic
937378100 2:121351673-121351695 GAACACACTGCAGCCACCTCTGG + Intronic
937423997 2:121782215-121782237 GGCCACAGTGCACGCTCCTCAGG - Intergenic
938229987 2:129649955-129649977 GGACCCTCTTCACGCTCATCTGG - Intergenic
939958450 2:148546092-148546114 GGACCCACAGCAGAGTCCCCTGG + Intergenic
940004170 2:148996453-148996475 GGCCCCACTGCAGGAACCACCGG - Intronic
941416722 2:165230501-165230523 GGACCCAGTGGAGGGTTCTCAGG - Intergenic
941715100 2:168755537-168755559 CACCCCACTGCAGGCCCCTCTGG + Intronic
941759303 2:169223748-169223770 GGGCCCCTTGGAGGCTCCTCTGG - Intronic
943758776 2:191586475-191586497 GCACCCACAACAGGCTCTTCTGG + Intergenic
945299602 2:208203548-208203570 GGGCTCACTGCAGCCTCCCCAGG - Intergenic
945393543 2:209294700-209294722 GGACTCTCTGCAGACTCCTGAGG + Intergenic
947932838 2:233977664-233977686 GAAACCAAGGCAGGCTCCTCGGG - Intronic
948109190 2:235440659-235440681 GTTCCCATTGCAGGCCCCTCAGG + Intergenic
948273054 2:236688483-236688505 GGAGCCACTGCTGACTCCTTTGG + Intergenic
948389203 2:237599941-237599963 GGCCCCTCTCCAGGCTGCTCGGG - Intronic
948648529 2:239424515-239424537 GGCCCCACTGCCAGCTCCCCTGG + Intergenic
948654534 2:239468636-239468658 GGCCCCTCTGCAGCCTCCACTGG - Intergenic
948988534 2:241540434-241540456 GGACACCCTGGGGGCTCCTCTGG + Intergenic
1170705252 20:18738640-18738662 AGACCCTCTGCAGTCCCCTCAGG + Intronic
1171750321 20:29043062-29043084 TCACCCACTGCAGCTTCCTCAGG - Intergenic
1172576281 20:36011195-36011217 GCCCCCACTGCAGCCTCCTTGGG - Exonic
1173745314 20:45432225-45432247 GGACCCTCTGCAGAGTCCTGAGG - Intergenic
1174547545 20:51337048-51337070 GGCCCCACAGCAGGCCCTTCAGG + Intergenic
1174927778 20:54779455-54779477 GCTCCCACTGCCGTCTCCTCAGG + Intergenic
1175793081 20:61754485-61754507 CTGCCCACTGCAGGCTCCACAGG + Intronic
1175948440 20:62569672-62569694 TGACCCACGGGAGGCTGCTCAGG - Intronic
1176169415 20:63690249-63690271 GGACCCATTTCTGGCTCCTCTGG - Intronic
1176314892 21:5232855-5232877 TCACCCACTGCAGCTTCCTCAGG + Intergenic
1177007567 21:15692771-15692793 GGACCTTCTTCAGGCCCCTCAGG + Intergenic
1178552526 21:33552748-33552770 GGACCCTCTGGTGGTTCCTCAGG - Exonic
1178710352 21:34911462-34911484 GAACCCTCTGCAGTCTGCTCAGG + Intronic
1179647898 21:42786335-42786357 GGAGCCACTGGAGGCTCCCGTGG + Intergenic
1180392686 22:12298809-12298831 TCACCCACTGCAGCTTCCTCAGG + Intergenic
1180407063 22:12565959-12565981 TCACCCACTGCAGCTTCCTCAGG - Intergenic
1180937697 22:19636996-19637018 GGACCCACAGAGGGCTGCTCGGG - Intergenic
1181463751 22:23099859-23099881 GGCCCCACTGGAGGCACCTGAGG + Intronic
1181530066 22:23512274-23512296 GGGCCCACGGCAGGTTTCTCTGG - Intergenic
1181800890 22:25347140-25347162 GGACCCAGTGCACCCTCCACAGG + Intergenic
1183255712 22:36760574-36760596 AGTCCCACAGCAGGCTCCGCAGG + Intronic
1183667513 22:39254132-39254154 GGACAATCTGCAGCCTCCTCTGG + Intergenic
1183887512 22:40897100-40897122 CGGCTCACTGCAGGCTCCGCCGG + Intronic
1183912585 22:41091218-41091240 GTACCCACTGCCGGCTGTTCCGG - Intergenic
1183978881 22:41528269-41528291 CCACCCACTGCAGGACCCTCTGG + Exonic
1184285952 22:43471624-43471646 GGACCCACTACCAGCTGCTCAGG + Intronic
1184482819 22:44758077-44758099 GGACCCATGGCAGTTTCCTCTGG + Intronic
1184508280 22:44917228-44917250 GGGCCCAATCCTGGCTCCTCTGG + Intronic
1184858368 22:47158788-47158810 GGACCCTGTGCAGGTGCCTCTGG - Intronic
1185201561 22:49509183-49509205 GGCCACACTGCCGGCTTCTCAGG - Intronic
1185334161 22:50264069-50264091 GGACCCACAGCAGCTTCCTGAGG - Exonic
1185344621 22:50305876-50305898 GGGCCCACTGCAGGCTCAGCAGG + Intronic
953117499 3:40007620-40007642 GAACCCACTGTAGTCTGCTCTGG - Intronic
953673995 3:44986055-44986077 GGCCCCAGTGCAGGATCCACTGG - Intronic
954386689 3:50247810-50247832 GGAACCTCTGCAGGCCTCTCTGG + Intronic
954422790 3:50427351-50427373 GGACCCCCAGCTGGCTCCTGTGG + Intronic
956691499 3:71881886-71881908 GTACCCACTGCAGGCCTCCCTGG - Intergenic
956696338 3:71922255-71922277 GGACCCTCTGCAGTGTCCCCTGG - Intergenic
957885565 3:86282647-86282669 GGCCCCACTGCCGGATCCACTGG + Intergenic
962290975 3:134136098-134136120 GGACCCACTGCAGGCTCCTCAGG - Intronic
963324223 3:143843292-143843314 GCACTCCCTGCAGGTTCCTCAGG - Intronic
963967001 3:151383225-151383247 GGCCCAAGTGCAGGCCCCTCTGG + Intronic
965842127 3:172918298-172918320 GAAACAACTGCAGGCTGCTCAGG + Intronic
966126418 3:176582030-176582052 GGATTAACTGAAGGCTCCTCAGG + Intergenic
968501640 4:952932-952954 GGAGCCCCTGCTGGCTCCTGGGG - Intronic
968894262 4:3389619-3389641 TCACCCACTGCAGCCTCCACAGG + Intronic
968930130 4:3574535-3574557 GGACCCGGTGCGGGCTCCTGTGG - Intergenic
968986947 4:3880648-3880670 GAACCCGGTGCAGGCGCCTCTGG - Intergenic
969179086 4:5423761-5423783 GGACTCACTGCAGTGTCCTGGGG - Intronic
969566823 4:7983683-7983705 GGCCTCAGTGCAGGCTGCTCGGG - Intronic
969611489 4:8229791-8229813 GGACCCACCGGAGGCTGCTGTGG - Intronic
970272184 4:14359035-14359057 GGCCCCATTGCAGGATCCACTGG + Intergenic
974195128 4:58564373-58564395 TGACCCACTGGAGGGTCTTCAGG + Intergenic
978306782 4:107337264-107337286 GGACTAACAGCAGGCTTCTCAGG - Intergenic
978562585 4:110048985-110049007 GGACCCATTGGAGGCTCATCTGG - Exonic
978917905 4:114148518-114148540 GGCCCCAGTGCAGGATCCACTGG - Intergenic
980784291 4:137532393-137532415 AGACACACTGCAGACTCCACCGG - Exonic
980790441 4:137613319-137613341 GGACACCCTGCAGGATCCGCAGG - Intergenic
983186012 4:164701231-164701253 GGATCGACTGCAGACTCCTGTGG - Intergenic
983542782 4:168930945-168930967 GGCCCCACAGCAGGCACCTAAGG - Intronic
983634532 4:169883598-169883620 GGACCCTCTGCAGAGTCCTGAGG - Intergenic
983656815 4:170091653-170091675 GGCCCCAGTGCCGGCTCCACTGG + Intronic
985201818 4:187491847-187491869 AGACACAATGCAGTCTCCTCTGG + Intergenic
985410393 4:189677986-189678008 GGACCAACTGCAGGGTGCTGAGG + Intergenic
985689137 5:1297444-1297466 GGACCCACTGCAGGGGCAGCTGG - Intergenic
985705016 5:1395491-1395513 GGCCACACCACAGGCTCCTCTGG + Intronic
994496352 5:100517909-100517931 GGACTCACAGCAGTCTGCTCAGG + Intergenic
994932369 5:106206027-106206049 GGCCCCAGTGCAGGATCCACTGG - Intergenic
997842700 5:137256658-137256680 CAAACCACTGCAGGCTCCTGTGG + Intronic
999697441 5:154199347-154199369 GGACCCACTCCATTCTCCCCAGG + Intronic
1001454365 5:171849364-171849386 GCACCCTCTGCAGGCTCCCTGGG + Intergenic
1002102140 5:176862903-176862925 GGGGCAGCTGCAGGCTCCTCTGG - Intronic
1002340789 5:178515513-178515535 CATCCCACTCCAGGCTCCTCAGG + Intronic
1003062995 6:2876913-2876935 GGAGCCTCTGCATGCTGCTCTGG - Intergenic
1003635255 6:7826094-7826116 GGCACCACTGCATGCTCCTGGGG - Intronic
1004220621 6:13743356-13743378 GGACCCAGTGCACCCTCCGCAGG - Intergenic
1004260216 6:14101425-14101447 GGACCCAGGGCAGGCTGCTCAGG - Intergenic
1005849479 6:29810652-29810674 GGACTCTCTGAAGGCTGCTCAGG + Intergenic
1006334559 6:33413760-33413782 GGAACCACTGCAGGCAGCTCCGG - Exonic
1006779313 6:36621386-36621408 GAACCCAAGGCAGGCTCCTAGGG + Intergenic
1007662677 6:43496327-43496349 GCACCCACCCCGGGCTCCTCTGG + Intronic
1012851062 6:104446708-104446730 CGGCCCACTGCAGGATCCACTGG + Intergenic
1014703381 6:124716544-124716566 GGAGCCACTGTAGGCTTCTAAGG - Intronic
1015410466 6:132888139-132888161 GGATATACTGCAGACTCCTCAGG - Intergenic
1015601908 6:134918526-134918548 GGACCAACTGCTGGCTCATCAGG - Exonic
1017072197 6:150585370-150585392 TGTCCCACTGGAGGGTCCTCAGG - Intergenic
1018308117 6:162479637-162479659 GGTCCCACTGGAGGGTCTTCAGG + Intronic
1018469776 6:164085194-164085216 GGCCCCTCCGCTGGCTCCTCCGG + Intergenic
1019529743 7:1497402-1497424 AGACCCACTGCAGCGCCCTCGGG - Intronic
1019563613 7:1669471-1669493 GGACCCCCGGCAGGAGCCTCGGG - Intergenic
1020075029 7:5252237-5252259 GGACCTCCTCCAGGCCCCTCGGG - Intergenic
1022611228 7:31875473-31875495 GGCCCCACAGCAGGATTCTCTGG - Intronic
1023041898 7:36179905-36179927 GGACACACTTAAGGCTCCTCGGG - Intronic
1023110688 7:36807976-36807998 TGACCTCCTGCAGGCCCCTCAGG + Intergenic
1023812117 7:43919697-43919719 GGATCCTCTGCAGGCTCTTGTGG - Intronic
1025998963 7:66546464-66546486 TGACCCACTGCAGCCTCAACAGG + Intergenic
1026277104 7:68889571-68889593 GGACCTAAGGCAGGCTGCTCAGG - Intergenic
1027563743 7:79765157-79765179 TGAGCCACTGGAGGCTCCCCTGG + Intergenic
1033599299 7:142877314-142877336 GGACCCCCTGCAGGATCCTGGGG - Intronic
1034086780 7:148329120-148329142 GGACACCCAGCAGGCTCCCCAGG + Intronic
1035936376 8:3845943-3845965 TGTCCCACTGCAGGCTCCTCAGG + Intronic
1037516596 8:19637979-19638001 GGACCCACTGCTGCTTCCTTCGG - Intronic
1037634850 8:20692374-20692396 AGAACCACTGCCTGCTCCTCTGG - Intergenic
1038182788 8:25244645-25244667 GGACCCCGTGCAGGTTCCTAGGG + Intronic
1040351346 8:46571948-46571970 GGCCCCAGTGCAGGATCCACTGG + Intergenic
1040734622 8:50490730-50490752 AGTCCCGCTGCAGGCACCTCAGG - Intronic
1042898372 8:73695464-73695486 GGGCCCACTGCATACTCCTTGGG - Intronic
1044790098 8:95838415-95838437 TGACCCAATTCAGGCTCGTCAGG + Intergenic
1045544789 8:103118828-103118850 GGAGCCACTGAAGGGTCTTCAGG + Intergenic
1048256785 8:132910910-132910932 TGATGTACTGCAGGCTCCTCAGG - Intronic
1048558410 8:135505730-135505752 GGACCCTCTTCAAGCTCCTGAGG - Intronic
1049365077 8:142233151-142233173 GGTCCCTCTGCAGTCTACTCAGG - Intronic
1049531690 8:143158549-143158571 GGACCCAGCCCAGGCCCCTCCGG + Intronic
1049671006 8:143869848-143869870 GCACGGCCTGCAGGCTCCTCTGG + Exonic
1052855643 9:33404633-33404655 GAACCCTTTGCAGGCTCCTCAGG - Intergenic
1053721408 9:40950751-40950773 TCACCCACTGCAGCTTCCTCAGG - Intergenic
1054344590 9:63901417-63901439 TCACCCACTGCAGCTTCCTCAGG + Intergenic
1054459950 9:65457270-65457292 GGACCCGGTGCGGGCTCCTGTGG + Intergenic
1056053151 9:82791221-82791243 GGACCTCCTGCAGGCTTCTGAGG - Intergenic
1056139697 9:83663996-83664018 GGAAGCACTGGAGGCTCTTCGGG - Exonic
1057023271 9:91717482-91717504 GGCCCCACGGCAGGCTCTTCTGG - Intronic
1057051466 9:91927422-91927444 GGTCCCCCTTCAGGGTCCTCTGG - Intronic
1057211707 9:93204160-93204182 GGAGCCACTGAAGGCTCCTGGGG + Intronic
1061517451 9:131097960-131097982 ATTCCCCCTGCAGGCTCCTCTGG + Intronic
1061678314 9:132230571-132230593 GGTGCCACTGCAGGTTCCTTTGG + Exonic
1062656368 9:137606056-137606078 GGACCCGCTTCAGGCCCCGCCGG - Intronic
1062672427 9:137719391-137719413 GGCCGGACTGCTGGCTCCTCAGG + Intronic
1203453781 Un_GL000219v1:145395-145417 TCACCCACTGCAGCTTCCTCAGG + Intergenic
1203672365 Un_KI270755v1:27439-27461 GGACCAACTGCAGGGTGCTGAGG - Intergenic
1185643121 X:1599378-1599400 GGATGGACTGCAGGTTCCTCTGG - Exonic
1186295581 X:8144909-8144931 GGCCCCAGTGCAGGATCCACCGG - Intergenic
1187234285 X:17452416-17452438 GGCCCCACTGCAGGGTCACCGGG - Intronic
1187474158 X:19595442-19595464 GGGCCCACTGCAGCCACATCAGG + Intronic
1189397377 X:40635029-40635051 AGACCCAGTGCAAGCTCCTTGGG + Intronic
1192798690 X:74445858-74445880 GGATCCACTGCTGACTTCTCAGG + Intronic
1195259997 X:103122530-103122552 AGCCCCAGTGCAGGCTCCTGGGG - Intergenic
1199579659 X:149348451-149348473 TGACTCCCTCCAGGCTCCTCAGG - Intergenic
1200827688 Y:7660615-7660637 GGACCCAGAGCAGGTTCCCCAGG + Intergenic