ID: 962290977

View in Genome Browser
Species Human (GRCh38)
Location 3:134136107-134136129
Sequence AAGAGACCTGGACCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962290977_962290979 5 Left 962290977 3:134136107-134136129 CCTGCAGTGGGTCCAGGTCTCTT 0: 1
1: 0
2: 3
3: 13
4: 150
Right 962290979 3:134136135-134136157 TCAGCTTCTCCTACGCTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 145
962290977_962290983 23 Left 962290977 3:134136107-134136129 CCTGCAGTGGGTCCAGGTCTCTT 0: 1
1: 0
2: 3
3: 13
4: 150
Right 962290983 3:134136153-134136175 CCTGGCAAAAACTGGTGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 116
962290977_962290981 15 Left 962290977 3:134136107-134136129 CCTGCAGTGGGTCCAGGTCTCTT 0: 1
1: 0
2: 3
3: 13
4: 150
Right 962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962290977 Original CRISPR AAGAGACCTGGACCCACTGC AGG (reversed) Intronic
901027907 1:6288705-6288727 AACAGAGCTGGGCCCACGGCAGG + Intronic
901362041 1:8709896-8709918 ACAGGACCAGGACCCACTGCTGG - Intronic
901656909 1:10774626-10774648 CAGAGCTCTGGCCCCACTGCTGG + Intronic
904248091 1:29202417-29202439 AAGAGACCCAGAGCCACTCCTGG - Intronic
907493555 1:54826366-54826388 TAGGGACCTGGCCGCACTGCTGG + Intronic
908883296 1:68758453-68758475 AAGAGCCCTGGAGTCACTACTGG + Intergenic
911436086 1:97859606-97859628 AAGAGACCTGGAGCTAGTGAAGG - Intronic
912704536 1:111902192-111902214 CAGAGGCCTGGACCCACTTTGGG - Intronic
915285685 1:154850548-154850570 GAGAGCCCTGGGCCCTCTGCAGG + Intronic
916254976 1:162778185-162778207 GAGAGTCCTGGATTCACTGCAGG + Intronic
920500623 1:206482854-206482876 AAAATACCTGGTTCCACTGCGGG - Intronic
922468638 1:225861946-225861968 ATGTGGCCTGGCCCCACTGCTGG - Intronic
922701540 1:227763993-227764015 AAGAGCCCAGGGCACACTGCTGG - Intronic
922986596 1:229870683-229870705 AAGAGTCGTGGACCCTCTGTGGG + Intergenic
1065328522 10:24570724-24570746 AGGAGACCTGGTGCCATTGCAGG - Intergenic
1065926718 10:30441106-30441128 AAGAGCACAGGACCCACAGCAGG - Intronic
1067266273 10:44748162-44748184 AAGAGCTCAGGACCCACTGAGGG - Intergenic
1067805154 10:49386913-49386935 CAGAACCCTGGACCCAGTGCTGG + Intronic
1072047188 10:91668862-91668884 AAGAGACCTGGAGACATTGCCGG + Intergenic
1073121508 10:101124999-101125021 CAGAGGCCTGGTCCCACAGCAGG + Intronic
1074891945 10:117743134-117743156 GAGCGACTGGGACCCACTGCAGG + Intergenic
1075064877 10:119282616-119282638 GAGAAACCTGGACCCACAGGGGG - Intronic
1075390473 10:122087478-122087500 AGGAGACCCGGAGTCACTGCTGG + Exonic
1077055343 11:589556-589578 AAGAGGCCTGGACACACTCGGGG + Intronic
1079911895 11:26320160-26320182 AAAAGAGCTGGACACAGTGCTGG + Intronic
1080448492 11:32359025-32359047 AGCAGTCCTGGACACACTGCAGG - Intergenic
1082073865 11:47961491-47961513 AATAGATGTGGACACACTGCTGG - Intergenic
1083645241 11:64168267-64168289 AACAGACCTGGACCCAAGTCGGG - Intergenic
1083668933 11:64289813-64289835 AAGGGACATGGCCCCTCTGCTGG + Intergenic
1083750962 11:64760318-64760340 AAGGAACCAGGACCCCCTGCAGG + Intergenic
1083940292 11:65891833-65891855 AAGGGAGCTGGAGCCACTTCAGG - Intergenic
1084901536 11:72313656-72313678 AAGAGACCTAGGCCTTCTGCAGG - Intronic
1085281707 11:75335241-75335263 GACAGACTTGGACCTACTGCAGG - Intronic
1085459700 11:76686147-76686169 AGGAGCCCTGTGCCCACTGCTGG - Intergenic
1085593883 11:77790776-77790798 ATGAGACCTGGAGTCACTGGAGG - Intronic
1087386930 11:97483278-97483300 AACATGCATGGACCCACTGCTGG + Intergenic
1090358202 11:126154775-126154797 GAGAGACCTGGACCAAGAGCTGG + Intergenic
1092277731 12:7074902-7074924 AAGAATCCTGGGGCCACTGCAGG + Intergenic
1095802200 12:46281122-46281144 TAGGGACCTGGCCACACTGCTGG - Intergenic
1096579465 12:52575239-52575261 AAGACAACTGCTCCCACTGCTGG + Intergenic
1101235166 12:102781276-102781298 AAGGGACCTGGGCCCAAAGCTGG - Intergenic
1103551753 12:121743044-121743066 AAGAGACTTCGCCCCAGTGCTGG - Intronic
1103622987 12:122200264-122200286 CAGGGACCTGGTCCCACTGAAGG + Exonic
1104953705 12:132453826-132453848 AGCAGGCCTGGAGCCACTGCAGG - Intergenic
1111282914 13:86051016-86051038 AAGAGCCCTGGAGGCACTCCCGG + Intergenic
1111421597 13:88018769-88018791 CAGAGACCTGGACCCAGCCCAGG - Intergenic
1115786761 14:36835434-36835456 GAGAGAGCTGGACCTCCTGCAGG + Intronic
1117479814 14:56131499-56131521 CAGAGACCTGGAAGCACTGCAGG + Intronic
1118742100 14:68747151-68747173 GAGAGACCTGCATCCACTGAGGG - Intergenic
1120686953 14:87548718-87548740 AAGAGACCTGGAGTTATTGCTGG - Intergenic
1121448174 14:93991541-93991563 AATAGTACTGGACCCACAGCAGG - Intergenic
1124512746 15:30340611-30340633 AAGAGGCTTGGATCCCCTGCAGG - Intergenic
1124730169 15:32190139-32190161 AAGAGGCTTGGATCCCCTGCAGG + Intergenic
1125029258 15:35060082-35060104 GAGAGACCAGGAGCCACTGAGGG + Intergenic
1129753843 15:78084138-78084160 ACTAGGCCTGGCCCCACTGCAGG + Intronic
1130063943 15:80589586-80589608 AAGCAACATGGACCCACTGAAGG + Intronic
1132109957 15:99095823-99095845 AAGAGACCCTCACCCCCTGCAGG + Intergenic
1135165869 16:20138703-20138725 AGGAGACCTTGACCCTCAGCTGG - Intergenic
1136988861 16:35139961-35139983 AAGAGAACTGGCCCGCCTGCAGG + Intergenic
1137824493 16:51479448-51479470 ATGAGACTTGGACCCAGGGCGGG - Intergenic
1138442918 16:57045970-57045992 AAGAGGCCTGGTCCCACTAGAGG - Intronic
1141171133 16:81692461-81692483 AAGAGACCTGGAGGCATTTCAGG - Intronic
1142108359 16:88318267-88318289 AACAGACCCGGGCCCACTGGGGG - Intergenic
1142375255 16:89703292-89703314 AGGAGAGCTAGGCCCACTGCTGG - Intergenic
1148134429 17:45283182-45283204 AAGAGACGCGCACCCAGTGCTGG - Intronic
1154127643 18:11706383-11706405 AAGAGATCCGGACTCACTGAAGG - Intronic
1158206741 18:55001424-55001446 AAGAGAGCTGGAGCCTCAGCAGG + Intergenic
1160546298 18:79658445-79658467 AAGAGATTTGGACTCACTGAAGG - Intergenic
1160686867 19:440971-440993 AAGGGACGTGGCTCCACTGCGGG - Intronic
1161199777 19:3008183-3008205 AAGTGTTCTAGACCCACTGCTGG - Intronic
1165289867 19:34874385-34874407 AAAAGTCCTGGGCCCACAGCAGG - Intergenic
1165365569 19:35362914-35362936 AGAAGACCTGGCCCCAGTGCAGG + Intergenic
1165771767 19:38384559-38384581 TAGAGGCCTGGTCCCATTGCTGG - Intronic
1166524325 19:43501727-43501749 AACAGACCTGTTCCCGCTGCTGG + Exonic
925192968 2:1900217-1900239 AGGAGATCTGGCCCCACTCCTGG - Intronic
926587006 2:14697665-14697687 GAGAGACCACAACCCACTGCAGG + Intergenic
928868931 2:35951559-35951581 AATTGACCTGGAGCCAATGCAGG - Intergenic
929605954 2:43234289-43234311 AATAGTCCTGGCCCTACTGCAGG - Intronic
935083992 2:99826939-99826961 AAGAGAAGTGGACCCACCGGAGG + Intronic
936079243 2:109421176-109421198 AAGAAACCTGCACCCACAGTGGG + Intronic
936598629 2:113873904-113873926 CAGAGTCCTGGAGCCATTGCTGG + Intergenic
936815552 2:116456337-116456359 ATGAGAGCTGTACCCACTGCTGG - Intergenic
937014239 2:118589072-118589094 AAGAAACCAGGCCCCACAGCAGG - Intergenic
938604620 2:132879623-132879645 AGGTGACCTGGTTCCACTGCAGG + Intronic
943854785 2:192775462-192775484 AATAAACCTGGGGCCACTGCAGG + Intergenic
944143384 2:196480624-196480646 TGGAGAGCTGGATCCACTGCAGG + Intronic
944216629 2:197263064-197263086 AGGAGAGCTGGGCCCAGTGCAGG - Intronic
947370980 2:229445279-229445301 AAGAAAACTGGACCCTCTGAGGG + Intronic
1171171476 20:23019337-23019359 GAGTGACATGGACCCACAGCGGG - Intergenic
1171181664 20:23095316-23095338 AAGTGACCTGAGCCCAGTGCGGG + Intergenic
1172759386 20:37311354-37311376 AAGAGGCCTGGAGCCCCTGCTGG + Intronic
1172913155 20:38425074-38425096 AAGAGACCTGGAGCCAGTGAAGG - Intergenic
1172956316 20:38762107-38762129 AAGTTGCCTGGAGCCACTGCTGG + Intronic
1173103305 20:40107647-40107669 AAGAGACATGGTCTCACTGCAGG + Intergenic
1175930749 20:62492736-62492758 AAGAGACCCTCACCCACAGCTGG - Intergenic
1176000549 20:62829569-62829591 CAGCGACCTGGCCCCAGTGCAGG + Intronic
1180188565 21:46152011-46152033 CTGAGTCCTGGACCCCCTGCCGG - Intronic
1181675522 22:24449079-24449101 AAGAGGCCTGGACCCCCTTATGG + Intergenic
1182026307 22:27121919-27121941 AAGAGACGTGGGCACAGTGCTGG - Intergenic
1182537279 22:31014062-31014084 AAGAGACCAGGAATCACTGGAGG + Intergenic
1183012669 22:34959774-34959796 AAGCAAACTGGACCCACTGCAGG + Intergenic
1183492028 22:38121873-38121895 TAGAGAGCTGGGCACACTGCTGG + Intronic
1184251026 22:43260411-43260433 CAGAGCCCAGGACCCACTCCAGG - Intronic
1185058299 22:48592488-48592510 AAGAGACCTGGACCCAGGGCTGG - Intronic
1185286230 22:50001018-50001040 AAGGCACCTGGGCCCACTGCTGG + Intronic
1185402107 22:50624544-50624566 AAGGGGCCTGGAGCCCCTGCTGG - Intronic
950964981 3:17139811-17139833 AAGAAACCTGGAGCCACAGAAGG - Intergenic
951709149 3:25571910-25571932 CAGAGACCTGGCCCCCATGCTGG + Intronic
952206150 3:31182646-31182668 AGGAGAGCAAGACCCACTGCTGG + Intergenic
954745165 3:52783712-52783734 AAGAGCCCGGGACCTACTGGGGG + Intronic
954830795 3:53419575-53419597 TTGTGACCTGGACTCACTGCAGG + Intergenic
955149999 3:56357521-56357543 AGGAGACCAGGACCCTGTGCTGG - Intronic
956620209 3:71214376-71214398 AAGAGAAGTGGCCCCACTGTTGG - Intronic
958466999 3:94471428-94471450 AAGAGAGCTGGCTCCCCTGCTGG + Intergenic
962290977 3:134136107-134136129 AAGAGACCTGGACCCACTGCAGG - Intronic
967883942 3:194320773-194320795 AAAAGACCAAGACCCACAGCAGG - Intergenic
969621387 4:8280623-8280645 GAGAGCCCTGGGCCCACAGCAGG + Intronic
971210036 4:24607521-24607543 AAGAGACATGGACCAGCTGGAGG + Intergenic
971304801 4:25470318-25470340 AAGTGACCTGTGCTCACTGCAGG - Intergenic
978897599 4:113907918-113907940 AAGACACCAGGACCCACTTCAGG + Intronic
984174628 4:176401101-176401123 AAAAGATTTGGACCCACTGAAGG + Intergenic
986286097 5:6360238-6360260 ACGAGTCCTGCAGCCACTGCAGG + Intergenic
990006389 5:50948238-50948260 TTTAGAGCTGGACCCACTGCTGG + Intergenic
995247486 5:109950990-109951012 AATAGACCTAGACCCACAGGTGG + Intergenic
1001513237 5:172338053-172338075 GAGAGTCTTGGTCCCACTGCTGG + Exonic
1002074240 5:176698585-176698607 AACAGAACAGGACCTACTGCAGG + Intergenic
1004208277 6:13613033-13613055 AAGAGACCTGGAGCTAGTGAAGG + Exonic
1005200614 6:23340376-23340398 AAGAAAACTGGAACCCCTGCCGG + Intergenic
1010208388 6:73343195-73343217 AAGAGACCTGGAGCCAGTGGAGG - Intergenic
1012853433 6:104473420-104473442 AAGAGGCCTGGGGGCACTGCGGG + Intergenic
1018962885 6:168460612-168460634 AAGACACCTGGCCCCACACCGGG - Intronic
1021081471 7:16370400-16370422 ATCAGAGCTGAACCCACTGCTGG + Intronic
1021665712 7:22976782-22976804 CAGAGCCATGGACCCAATGCTGG + Exonic
1025115596 7:56255477-56255499 AGGAGACCTGGAGCCAGTGAAGG + Intergenic
1026199992 7:68206388-68206410 AGGAGACCTGGAGCCAGTGAAGG + Intergenic
1026742856 7:72990036-72990058 AAGAGAACAGGATCCACTGGAGG - Intergenic
1026802708 7:73410426-73410448 AAGAGAACGGGATCCACTGGAGG - Intergenic
1027028969 7:74874741-74874763 AAGAGAACGGGATCCACTGGAGG - Intergenic
1027100879 7:75375042-75375064 AAGAGAACAGGATCCACTGGAGG + Intergenic
1030246139 7:107386334-107386356 AAGCGGCCTGGACCCTCAGCTGG + Intronic
1031857283 7:126937829-126937851 CAGAGACCTGGACTCTCAGCTGG + Intronic
1036614799 8:10379815-10379837 AAGCAACATGGACCCACTGATGG - Intronic
1036687856 8:10923765-10923787 AAGAGACCAGGAGGTACTGCTGG + Intronic
1036940774 8:13049677-13049699 CAGAGACCTGCAGCCACTCCAGG - Intergenic
1037381239 8:18287508-18287530 AAGATGACTGGACCCGCTGCTGG + Intergenic
1038930844 8:32191968-32191990 AGCAGACATGGACCCACTTCAGG + Intronic
1039274477 8:35920174-35920196 AAGAGACCTGAAGCCAGTGAAGG - Intergenic
1040530883 8:48265514-48265536 AGGAGAGCTGGAGCCACTGCAGG + Intergenic
1042792080 8:72619271-72619293 CAGATACCTGGAACCAGTGCTGG + Intronic
1045745129 8:105409379-105409401 AATAGACCTGTAGCCACTTCAGG - Intronic
1048927302 8:139282422-139282444 AAGTGGCCTGGACCCTCAGCTGG + Intergenic
1053468596 9:38328554-38328576 GAGACACCTAGACCCAGTGCAGG - Intergenic
1058718465 9:107742506-107742528 GAGGGTGCTGGACCCACTGCTGG - Intergenic
1059247566 9:112861723-112861745 AAGACACCAGGACCCACCGCAGG - Intronic
1060107894 9:120885671-120885693 CAGAGGCCTGGACCCACTTATGG - Intronic
1061290367 9:129647327-129647349 GACAGGCCTGGACCCCCTGCTGG - Intergenic
1061398495 9:130355965-130355987 AAGAGGCCTGGAGCCACGGCTGG + Intronic
1062425249 9:136503281-136503303 AGGAGGCCTGCACACACTGCCGG + Exonic
1185469119 X:372032-372054 AAGAGCCAGGGCCCCACTGCAGG + Intronic
1186583049 X:10841350-10841372 AAGTGACGTGGAACTACTGCAGG - Intergenic
1189497257 X:41520431-41520453 AGGAGACAGGGACCCACTGTGGG + Exonic
1189514208 X:41694969-41694991 AAGAGAGCTGGGCCCACTGCTGG - Intronic
1192819910 X:74634264-74634286 CAGAAACCTGGAACCACTTCTGG + Intergenic
1193203000 X:78714658-78714680 AAGAGCCCTGGAGGCACTCCTGG + Intergenic
1197920795 X:131591596-131591618 AAAAGATCTGGAATCACTGCAGG + Intergenic
1198055201 X:132987353-132987375 AAGTGACTTGGATCCACAGCAGG + Intergenic
1198775657 X:140176426-140176448 AAGAGTCCTGGACCCACTGGAGG + Intergenic